The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	316060	428170	3044678	protease,bacteriocin,tRNA,transposase,holin	Bacillus_phage(21.43%)	106	NA	NA
WP_016526887.1|316060_316990_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
WP_015639914.1|317219_318632_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641910.1|318697_318943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643749.1|319071_319635_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003646429.1|319672_320644_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003646430.1|320640_320961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646431.1|321114_322290_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003646432.1|322465_323632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646433.1|324226_325042_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641921.1|325054_326146_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
WP_003643757.1|326524_326797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646434.1|327023_327566_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016526888.1|327562_329008_+	MFS transporter	NA	NA	NA	NA	NA
WP_003643760.1|329337_330654_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	1.1e-33
WP_003646436.1|331149_332109_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003641927.1|332211_332481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526889.1|332710_333274_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003646437.1|333467_334136_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003646438.1|334293_335799_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|336063_336432_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|336544_337054_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003646439.1|337084_338281_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|338390_338861_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|338879_339335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643766.1|339438_340011_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|340176_341097_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003643768.1|341233_342145_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003646442.1|343034_343481_-	ribonuclease H	NA	NA	NA	NA	NA
WP_016526890.1|343718_345245_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|345245_346217_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|346294_347626_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|348091_349609_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|349623_351453_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|351467_352190_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_016526891.1|352384_354733_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_016526892.1|354734_356567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646448.1|356572_356806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108725669.1|357186_357303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646449.1|357426_358344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526893.1|358350_358524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646450.1|359069_359612_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016526894.1|359759_360935_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_016526896.1|361821_362565_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003646470.1|362865_363639_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|363737_363896_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646471.1|363920_364085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526897.1|364351_366502_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_016526898.1|366517_367894_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_131510832.1|368395_369292_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.2	2.7e-39
WP_016526651.1|369246_369771_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080131824.1|369832_370042_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_187289257.1|370227_371202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526900.1|371162_372521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526902.1|373845_374028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526903.1|374060_374240_+	DUF2929 family protein	NA	NA	NA	NA	NA
WP_016526904.1|374790_375360_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	5.4e-33
WP_016526905.1|375454_377299_-	MFS transporter	NA	NA	NA	NA	NA
WP_016526906.1|377463_378039_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015474752.1|378316_379102_+	ParA family protein	NA	Q7M293	Enterobacteria_phage	26.8	2.4e-07
WP_015474751.1|379152_379356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526907.1|380018_381125_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_016526908.1|381386_381668_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_080131825.1|381657_381840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080131826.1|381849_382164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526909.1|382153_382432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075168781.1|382453_382681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041161853.1|382932_384993_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_049816384.1|385047_385260_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_016526913.1|385315_386563_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	45.5	7.5e-88
WP_016526914.1|386684_386900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526915.1|386903_388028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041161806.1|388057_388537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016526917.1|390231_392256_-	MFS transporter	NA	NA	NA	NA	NA
WP_016526918.1|392340_392829_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021353390.1|393183_393273_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016526921.1|395168_395612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526922.1|395671_396655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526924.1|397509_398568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526925.1|398683_398977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526926.1|399629_399767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526927.1|400410_400947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526929.1|402086_404237_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_016526930.1|404252_405629_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003646474.1|405718_406408_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646475.1|406475_407144_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646476.1|407230_407911_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646477.1|408004_408691_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_101494318.1|408806_409079_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003646479.1|409110_409404_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_003646480.1|409693_412003_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646481.1|412261_413038_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003646482.1|413477_414494_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|414901_415612_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|415684_417046_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|417052_417241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646484.1|417230_417653_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003646485.1|417786_418005_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646486.1|417991_418357_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	44.1	1.8e-21
WP_003646487.1|418587_419601_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642008.1|420042_420960_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|421005_422280_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_016526931.1|422272_423247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646490.1|423268_423973_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|423972_424815_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646492.1|425411_425801_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003646493.1|426118_428170_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 2
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	590819	599443	3044678		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|590819_592517_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|592538_592847_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|592862_593462_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|593476_593728_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|594125_594791_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|594787_595117_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|595133_596153_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|596177_596525_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|596623_597520_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|597523_598309_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643943.1|598447_599443_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
>prophage 3
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	791826	828440	3044678	integrase,transposase,protease	unidentified_phage(22.22%)	29	823175:823196	826993:827014
WP_016526887.1|791826_792756_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
WP_003641157.1|794366_794885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041161819.1|796663_798088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641164.1|798624_798993_-	membrane protein	NA	NA	NA	NA	NA
WP_003641165.1|799226_799595_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_003645770.1|800160_800844_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003645769.1|801063_801408_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645768.1|801563_802271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015640093.1|802279_803155_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
WP_003645765.1|804799_807301_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645764.1|807785_808169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526983.1|808158_810006_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003641172.1|810246_810501_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003644045.1|810512_811058_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|811070_811253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|811267_811690_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016526984.1|811750_812191_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016526985.1|812394_813195_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003645760.1|813326_814337_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003644049.1|814698_815031_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003644050.1|815136_815709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645758.1|815890_818425_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
WP_016526986.1|818652_821526_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_016526987.1|821539_823126_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	62.9	4.2e-176
WP_016526988.1|823122_824220_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.4	8.5e-11
823175:823196	attL	CTTGGGAGCAGCGTAAGCTAAA	NA	NA	NA	NA
WP_016526887.1|824314_825244_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
WP_016526989.1|825511_826429_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
WP_046783358.1|826439_827027_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
826993:827014	attR	TTTAGCTTACGCTGCTCCCAAG	NA	NA	NA	NA
WP_016526894.1|827264_828440_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	1196159	1205997	3044678		Lactobacillus_phage(87.5%)	9	NA	NA
WP_041161831.1|1196159_1197389_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.4	7.9e-215
WP_015640259.1|1197479_1198451_-	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_003645222.1|1198636_1199584_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.7e-177
WP_003643097.1|1199927_1200542_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_015380220.1|1200544_1202983_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_016527054.1|1203070_1203631_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.3e-100
WP_003643094.1|1203701_1204142_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_015380221.1|1204237_1204375_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1205001_1205997_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 5
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	2026598	2089266	3044678	integrase,transposase,portal,tail,head,holin,capsid,terminase	Lactobacillus_phage(53.66%)	81	2040370:2040385	2095532:2095547
WP_003645428.1|2026598_2028329_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	7.6e-46
WP_003641420.1|2028552_2028945_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003645429.1|2029167_2030013_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016527163.1|2030496_2031507_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	26.3	3.3e-25
WP_016527164.1|2031716_2032715_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.9	2.9e-50
WP_016527165.1|2033544_2033922_-|holin	prophage P2a protein 58, holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	1.3e-14
WP_016527166.1|2033932_2034196_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	86.2	9.4e-33
WP_016527167.1|2034195_2035368_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.9	1.1e-194
WP_016527168.1|2035379_2035592_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	85.2	3.6e-19
WP_041161837.1|2035588_2036794_-	collagen-like protein	NA	A0A2K9VCK7	Lactobacillus_phage	64.8	1.5e-40
WP_016527170.1|2036806_2037385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526887.1|2037440_2038370_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
WP_016527171.1|2038411_2039344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527172.1|2039357_2040179_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016527173.1|2040193_2041234_-	hypothetical protein	NA	E9LUJ9	Lactobacillus_phage	33.9	4.4e-25
2040370:2040385	attL	GCAACTTCAACAGTTG	NA	NA	NA	NA
WP_016527174.1|2041217_2041628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527175.1|2041628_2041880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167803126.1|2041879_2042023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527179.1|2043933_2044830_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	27.1	3.2e-16
WP_016527180.1|2044839_2048769_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	45.6	3.3e-81
WP_041161838.1|2048768_2049005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527182.1|2049097_2049586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527183.1|2049603_2050164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080131836.1|2050175_2050562_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016527185.1|2050563_2051118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041161865.1|2051107_2051431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527187.1|2051435_2051801_-|head,tail	phage head-tail connector protein	head,tail	A0A1W6JNH7	Staphylococcus_phage	39.6	2.3e-05
WP_016527188.1|2051815_2052868_-	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	31.0	2.6e-33
WP_016527189.1|2052884_2053532_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_016527190.1|2053638_2054583_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_041161839.1|2054585_2056238_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.9	2.4e-65
WP_016527192.1|2056227_2057514_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	50.1	2.8e-114
WP_016527193.1|2057497_2058025_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	64.2	2.5e-48
WP_016527194.1|2058065_2058215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527195.1|2058246_2058519_-	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	50.6	1.8e-18
WP_016527196.1|2058487_2058667_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	52.7	7.8e-07
WP_016527197.1|2059359_2059569_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_143453264.1|2059565_2059733_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_003642805.1|2059955_2060417_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_016527200.1|2060640_2060952_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	99.0	4.3e-53
WP_016527201.1|2060954_2061329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527202.1|2061325_2061844_-	hypothetical protein	NA	O03915	Lactobacillus_phage	68.6	1.3e-54
WP_016527203.1|2061848_2062571_-	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	2.1e-50
WP_016527204.1|2062567_2062855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527205.1|2062851_2063784_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	45.5	7.4e-56
WP_016527206.1|2063871_2064267_-	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	67.2	2.5e-45
WP_016527207.1|2064263_2064911_-	ERF family protein	NA	D6PSU1	Lactobacillus_phage	59.5	1.3e-64
WP_016527208.1|2064913_2065426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167803041.1|2065676_2065820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527210.1|2065920_2066433_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	3.0e-27
WP_016527211.1|2066500_2066806_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_049816387.1|2066817_2067012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527213.1|2067004_2067241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644967.1|2067390_2067759_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	44.1	5.7e-20
WP_003644968.1|2067770_2068184_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_016527214.1|2068206_2068998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527215.1|2069007_2069262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527216.1|2069398_2070109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511204.1|2070711_2070888_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	3.9e-11
WP_016527217.1|2071084_2072179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527218.1|2072468_2073590_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	7.6e-47
WP_003642774.1|2073940_2074147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527219.1|2074578_2074884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527220.1|2074966_2075338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527221.1|2075519_2075789_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016527222.1|2075877_2077404_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	5.8e-42
WP_016527223.1|2077400_2078501_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.7	7.4e-47
WP_111443457.1|2078501_2078717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527225.1|2078655_2080359_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	3.2e-121
WP_016511396.1|2080355_2080829_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_016527226.1|2081683_2082073_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_041161867.1|2082065_2082404_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	33.7	5.1e-07
WP_016527228.1|2082390_2082675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527229.1|2082699_2083119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527230.1|2083262_2084657_-	prophage P2b protein 8, helicase	NA	Q4ZD27	Staphylococcus_phage	35.8	1.3e-69
WP_016527231.1|2084656_2085457_-	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	27.7	1.7e-13
WP_016527232.1|2085456_2085708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527234.1|2085978_2086158_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	3.0e-22
WP_016527235.1|2086315_2086936_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016527164.1|2086959_2087958_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.9	2.9e-50
WP_016527236.1|2088108_2089266_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	3.9e-54
2095532:2095547	attR	CAACTGTTGAAGTTGC	NA	NA	NA	NA
>prophage 6
NC_021514	Lactobacillus plantarum 16, complete sequence	3044678	2277819	2286330	3044678		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2277819_2278398_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_003645866.1|2278390_2279416_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_016527273.1|2279412_2280867_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.3e-50
WP_016527274.1|2280851_2283071_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	1.0e-143
WP_011101895.1|2283063_2283744_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2283743_2283998_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2283999_2284731_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2284733_2285864_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2285847_2286330_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NC_021517	Lactobacillus plantarum 16 plasmid Lp16E, complete sequence	40147	0	3438	40147		Clostridium_phage(100.0%)	2	NA	NA
WP_003646125.1|1598_2135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527412.1|2646_3438_+	AAA family ATPase	NA	E2ELL2	Clostridium_phage	25.7	4.6e-14
>prophage 2
NC_021517	Lactobacillus plantarum 16 plasmid Lp16E, complete sequence	40147	10919	18886	40147	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_041161890.1|10919_15671_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	28.3	7.5e-11
WP_016527428.1|17710_18886_+|transposase	IS256-like element IS1310 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
>prophage 3
NC_021517	Lactobacillus plantarum 16 plasmid Lp16E, complete sequence	40147	23935	32878	40147	transposase	Lactobacillus_phage(28.57%)	7	NA	NA
WP_080131851.1|23935_24778_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	6.3e-155
WP_002816285.1|24831_25083_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_003645574.1|25738_26356_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.5	1.8e-18
WP_016527437.1|26718_28437_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.0	1.4e-92
WP_181186338.1|28519_29167_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	54.2	3.2e-50
WP_003646551.1|29211_31635_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	50.3	2.0e-201
WP_003646115.1|32191_32878_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	49.6	9.9e-58
>prophage 4
NC_021517	Lactobacillus plantarum 16 plasmid Lp16E, complete sequence	40147	36059	37951	40147		Enterococcus_phage(100.0%)	2	NA	NA
WP_003646149.1|36059_36986_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	33.7	3.9e-41
WP_003646148.1|37000_37951_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	55.3	5.0e-100
>prophage 1
NC_021518	Lactobacillus plantarum 16 plasmid Lp16F, complete sequence	50195	0	6775	50195	holin,transposase	Paenibacillus_phage(33.33%)	6	NA	NA
WP_072533465.1|580_718_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016526665.1|1054_2623_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_013356282.1|2745_3900_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_104795485.1|4270_5046_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_016526667.1|5153_6056_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
WP_016526668.1|6142_6775_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
>prophage 2
NC_021518	Lactobacillus plantarum 16 plasmid Lp16F, complete sequence	50195	11900	18561	50195	holin	Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
WP_016526672.1|11900_13937_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.4	1.0e-62
WP_016526673.1|14051_14648_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	6.0e-19
WP_016526674.1|14757_15837_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	59.5	2.4e-05
WP_006293514.1|16115_16220_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_041142890.1|16507_17899_+	MFS transporter	NA	NA	NA	NA	NA
WP_014940864.1|17898_18561_+	HD domain-containing protein	NA	A0A1Q1PP35	Noumeavirus	31.4	5.0e-14
>prophage 3
NC_021518	Lactobacillus plantarum 16 plasmid Lp16F, complete sequence	50195	39002	47954	50195	transposase	Staphylococcus_phage(33.33%)	9	NA	NA
WP_016526702.1|39002_39863_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	5.1e-43
WP_016526703.1|39864_40164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526704.1|40201_41131_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_016526705.1|41280_42246_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	29.2	8.3e-26
WP_013356274.1|42491_43409_-	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_013356275.1|43416_44256_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_041161897.1|44255_45452_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	9.9e-29
WP_016526708.1|45868_46855_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	2.4e-44
WP_041161898.1|47237_47954_+	LysM peptidoglycan-binding domain-containing protein	NA	K4ID66	Lactobacillus_phage	55.7	3.6e-10
>prophage 1
NC_021519	Lactobacillus plantarum 16 plasmid Lp16H, complete sequence	74078	29	59238	74078	transposase,protease,holin	Bacillus_phage(25.0%)	58	NA	NA
WP_016526591.1|29_1205_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
WP_016526592.1|1428_2298_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.4	6.6e-99
WP_003644155.1|2301_2883_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	4.3e-38
WP_016526593.1|2892_3921_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	5.3e-71
WP_016526594.1|3953_4790_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	4.2e-34
WP_016526595.1|4805_5471_+	sugar transferase	NA	NA	NA	NA	NA
WP_016526596.1|6044_6815_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_016526597.1|6826_7546_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_041161916.1|7532_8306_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016526599.1|8360_9029_+	sugar transferase	NA	NA	NA	NA	NA
WP_016526600.1|9089_10262_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_016526601.1|10332_11268_+	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	28.3	5.9e-21
WP_016526602.1|11318_12470_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016526603.1|12491_13139_+	acyltransferase	NA	NA	NA	NA	NA
WP_016526605.1|13867_14986_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016526606.1|15026_16253_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016526607.1|16564_17704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187289259.1|17723_19145_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_016526609.1|19169_20336_+	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	51.8	9.4e-109
WP_144061830.1|21565_22459_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.9	2.4e-59
WP_016526613.1|22434_22695_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	45.3	8.2e-13
WP_016526615.1|23894_25070_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.8	1.6e-26
WP_016526616.1|25818_27213_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016526617.1|27307_28180_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.0	7.2e-21
WP_016526619.1|28833_29118_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_144061833.1|29783_32012_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016526621.1|32137_32356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526622.1|32356_34168_+	putative LtrC	NA	NA	NA	NA	NA
WP_041161920.1|34234_34573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526624.1|34650_35034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526625.1|35026_35347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526626.1|35339_36641_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.1	4.6e-80
WP_016526627.1|36756_37068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526628.1|37312_37537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526629.1|37539_38313_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	36.6	4.3e-33
WP_016526630.1|39089_40622_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016526631.1|40941_43518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526632.1|43782_44166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526633.1|44137_44797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526634.1|44812_46765_+	conjugation-related ATPase	NA	NA	NA	NA	NA
WP_016526635.1|46767_46974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526636.1|46974_48138_+	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	34.8	1.0e-09
WP_016526637.1|48150_48780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526638.1|49596_50556_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.2	4.8e-34
WP_041161921.1|50552_50768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526640.1|50769_50988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526641.1|50984_51284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526642.1|51280_51598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526643.1|51724_52633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526644.1|52918_53215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526645.1|53216_53717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526646.1|53734_54202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526647.1|54173_56363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526648.1|56364_57000_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016526649.1|57039_57306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006293514.1|57705_57810_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_131510832.1|57862_58759_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.2	2.7e-39
WP_016526651.1|58713_59238_-|transposase	transposase	transposase	NA	NA	NA	NA
