The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009914	Mycobacterium sp. VKM Ac-1817D, complete genome	6324222	5668223	5711243	6324222	protease,capsid,transposase,holin,integrase	Gordonia_phage(16.67%)	43	5666240:5666277	5675907:5675944
5666240:5666277	attL	ATGGAGCCACCCAGGGGAATCGAACCCCTGACCTATTC	NA	NA	NA	NA
WP_003882584.1|5668223_5669327_-|capsid	phage major capsid protein	capsid	A0A162E105	Gordonia_phage	59.6	4.5e-20
WP_003882585.1|5669482_5669983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882587.1|5669997_5670264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882589.1|5670260_5670554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882590.1|5670550_5672326_-	hypothetical protein	NA	A0A076GE28	Mycobacterium_phage	32.6	3.3e-44
WP_003882591.1|5672322_5672679_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003882592.1|5672678_5673365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882593.1|5673361_5673667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038565518.1|5674090_5674660_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_038565521.1|5674652_5675828_+|integrase	integrase	integrase	A0A1D8EX55	Mycobacterium_phage	65.7	3.2e-141
WP_003882597.1|5676039_5677248_-	DNA polymerase III subunit delta'	NA	D9ZNI9	Clostridium_phage	33.7	2.4e-06
5675907:5675944	attR	ATGGAGCCACCCAGGGGAATCGAACCCCTGACCTATTC	NA	NA	NA	NA
WP_038567461.1|5677330_5678959_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	33.3	5.7e-19
WP_003882599.1|5679055_5681881_-	type I DNA topoisomerase	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	32.7	4.8e-98
WP_003882600.1|5681984_5682578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882601.1|5682674_5682878_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	56.2	1.5e-14
WP_003882602.1|5683175_5685530_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.4	4.7e-06
WP_003882603.1|5685807_5686833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080596755.1|5686843_5687299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071533381.1|5687186_5687471_-	pilus biosynthesis protein TadE	NA	NA	NA	NA	NA
WP_003882606.1|5687521_5687725_-	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_003882607.1|5687752_5688334_-	type II secretion system protein F	NA	NA	NA	NA	NA
WP_003882608.1|5688330_5689119_-	membrane protein	NA	NA	NA	NA	NA
WP_003882609.1|5689115_5689292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003882610.1|5689466_5690177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003882611.1|5690238_5691483_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	35.8	1.7e-15
WP_003882612.1|5691508_5692702_+|transposase	transposase	transposase	U3PJ31	Staphylococcus_phage	26.9	4.5e-05
WP_003882613.1|5692688_5694920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003882614.1|5694916_5695327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003882615.1|5695323_5695983_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003882616.1|5696126_5696639_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_048895662.1|5696668_5697259_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003882618.1|5697332_5697758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003882619.1|5697882_5700969_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003882620.1|5701068_5702139_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_003882621.1|5702135_5703215_-	ATPase AAA	NA	NA	NA	NA	NA
WP_074405352.1|5703424_5703604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038565529.1|5703622_5704492_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_038565532.1|5704920_5705661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003883798.1|5705787_5707749_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.3	3.9e-83
WP_051018998.1|5707760_5708426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003883800.1|5708571_5709093_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003883801.1|5709092_5710052_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003883802.1|5710052_5711243_-|protease	acid resistance periplasmic serine protease MarP	protease	B4UTS4	Rhizobium_phage	31.4	1.4e-06
