The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	445193	478452	5393855	head,tail,protease,tRNA,integrase,portal,capsid,terminase	uncultured_Caudovirales_phage(75.0%)	34	462802:462819	478797:478814
WP_002919147.1|445193_446141_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|446155_446665_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446793_447918_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447889_448363_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448388_448931_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|448935_449508_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449511_450330_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450326_450584_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450559_451114_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456910_457132_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|457425_460536_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460548_461688_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|462066_462717_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462802:462819	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462992_464219_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|464311_465253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465434_465719_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465729_466509_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|466960_467230_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|467222_467411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|467403_467718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467714_468083_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|468079_468445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468444_470580_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470922_471258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|471306_471819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|472082_473249_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|473300_473861_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473862_475104_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|475100_475436_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475432_475732_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475731_476175_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|476167_476320_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|476450_476807_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476790_478452_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
478797:478814	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	1207680	1281816	5393855	head,tail,integrase,tRNA,portal,capsid,lysis,terminase,plate	Salmonella_phage(78.26%)	81	1205974:1206020	1242541:1242587
1205974:1206020	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1207680_1208706_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1208708_1209338_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1209460_1209703_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1209735_1210245_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1210252_1210453_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1210416_1210755_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1210822_1211056_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1211055_1211283_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1211279_1212131_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1212127_1214512_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1214674_1214863_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1214874_1215108_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1215203_1215887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1215873_1216953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1216952_1217954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1218475_1218745_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1218801_1219845_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1219844_1221608_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1221748_1222582_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1222598_1223651_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1223654_1224308_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1224403_1224868_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1224867_1225071_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1225074_1225290_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1225270_1225780_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1225784_1226168_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1226164_1226593_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1226567_1226726_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1226688_1227111_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1227103_1227550_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1227572_1228439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1228533_1229106_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1229102_1229465_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1229451_1230360_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1230352_1231024_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1231025_1232975_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1232984_1234103_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1234154_1235228_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1235376_1236549_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1236558_1237074_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1237126_1237426_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1237440_1237560_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1237552_1240183_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1240179_1240665_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1240661_1241756_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1241822_1242041_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1242068_1242446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1243049_1243532_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1242541:1242587	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1243642_1244119_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1244108_1244399_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1244465_1244807_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1244954_1246616_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1246702_1247581_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1247705_1248296_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1248415_1249702_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1249721_1250513_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1250676_1252041_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1252300_1252549_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1252567_1253116_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1253147_1253915_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1253954_1254302_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914119.1|1254421_1254880_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914118.1|1254936_1256307_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914117.1|1256315_1256798_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1256811_1258035_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1258027_1258537_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1258879_1259950_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_002914113.1|1259959_1261081_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914112.1|1261143_1262016_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1262012_1263173_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1263273_1263321_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_002914111.1|1263427_1263763_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|1264033_1264771_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1264902_1265883_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002914109.1|1265879_1266611_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1266740_1269314_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914097.1|1275279_1276578_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_002914095.1|1276581_1276905_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914094.1|1276946_1278302_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004151994.1|1278422_1281083_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1281117_1281816_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	1358640	1405252	5393855	tail,integrase,holin,capsid,terminase	Salmonella_phage(44.0%)	61	1361204:1361218	1372384:1372398
WP_004151980.1|1358640_1360107_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1360174_1361752_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1361204:1361218	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004152549.1|1361944_1363195_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1363211_1363403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1363399_1363582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1363578_1364172_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1364168_1364327_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1364319_1364613_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1364722_1364971_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1365022_1366045_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1366054_1366954_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1366950_1367250_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1367246_1367396_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152539.1|1367616_1368198_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1368351_1368585_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1368731_1368941_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1368940_1369708_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1369704_1370490_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1370609_1370957_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1371149_1371560_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1371543_1371735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1371731_1372157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1372153_1372897_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1372384:1372398	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004152528.1|1372896_1373067_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|1373067_1373280_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1373276_1373945_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1373937_1374177_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1374176_1374515_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004178082.1|1374611_1376099_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152524.1|1376499_1376757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1376834_1377419_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1377415_1378891_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1378934_1379456_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1380161_1380365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1380368_1382048_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1382044_1382350_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_019404949.1|1382352_1383030_+	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004152467.1|1383042_1384050_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1384059_1384452_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1384444_1384723_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1384771_1385383_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1385382_1387860_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1387861_1388332_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1388324_1388822_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004243852.1|1388834_1391579_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004152459.1|1391578_1394968_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1394977_1395592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1395866_1396265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1396269_1396452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1396642_1397338_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1397421_1397610_-	ash family protein	NA	NA	NA	NA	NA
WP_004152454.1|1397718_1397916_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1397919_1398177_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152452.1|1398267_1398564_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004221284.1|1398715_1401085_+|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|1401093_1401246_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|1401369_1401774_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1401760_1402066_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1402055_1402685_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1402681_1403164_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1403383_1405252_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	1733976	1740883	5393855	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1733976_1734840_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1734850_1735624_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1735866_1736763_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1737005_1738367_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1738685_1739408_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1739404_1740883_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	1777450	1785075	5393855		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1777450_1778857_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1779081_1780146_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1780172_1781042_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1781073_1781964_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1781978_1782533_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1782713_1783880_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1784073_1785075_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	2025906	2082394	5393855	transposase,plate,protease	Staphylococcus_phage(16.67%)	55	NA	NA
WP_002910830.1|2025906_2026653_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2027091_2028078_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2028070_2028871_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2028857_2029031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2029328_2029472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2029648_2030590_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2030683_2031673_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2031698_2033030_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2033057_2034266_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2034294_2036589_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2036640_2036787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2037076_2038135_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2038244_2039159_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2039168_2040446_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2040442_2041318_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2041314_2042034_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2042039_2042933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2043216_2044860_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2044909_2045386_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2045484_2046411_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2046714_2048010_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2048021_2048831_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2048805_2049705_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2049814_2050297_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2050487_2051186_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2051211_2051751_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2051865_2052195_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2052763_2054104_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2054100_2054754_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2054757_2056455_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2059418_2060774_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2060774_2061284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2061280_2061787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2061881_2062034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2062023_2062533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2064138_2065107_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2065248_2065431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2065427_2065757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2065753_2066260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227470.1|2066641_2067730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2067776_2068082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2068103_2068997_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2069042_2069159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2069180_2070074_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2070099_2070228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2070249_2071143_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2071318_2072209_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2072545_2073526_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2073583_2073886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2074146_2074332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2074629_2074896_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2074899_2076057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2076040_2079451_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2079584_2081348_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2081377_2082394_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	2751245	2762132	5393855		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2751245_2754353_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2754407_2755673_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2755703_2756792_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2756878_2757139_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2757436_2758297_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2758317_2759079_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2759339_2760242_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2760253_2761519_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2761511_2762132_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	2950827	3023630	5393855	transposase,integrase,holin,terminase,plate	uncultured_Caudovirales_phage(35.29%)	84	3014743:3014757	3020752:3020766
WP_002902268.1|2950827_2951913_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2951876_2953631_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2955302_2958728_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2958711_2959851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2959847_2960105_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2960149_2962567_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2962554_2963085_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2963152_2963683_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2963751_2964282_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2964349_2964880_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2964948_2965479_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2965542_2966322_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2966322_2968692_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2968693_2971348_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2971612_2972104_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|2972108_2973815_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2973811_2974501_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2974497_2975841_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2975850_2977395_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2977437_2977929_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2978774_2979023_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2979245_2979530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2979634_2979844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2979840_2980572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2980582_2981311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2983661_2983859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2983858_2984725_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2984724_2985498_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2985494_2986691_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2986690_2987044_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2987045_2987699_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2987752_2988319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2988361_2988544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2988593_2988935_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2988934_2989957_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2989959_2990187_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2990262_2990862_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2990861_2992865_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2992854_2993007_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2993042_2993468_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|2993794_2994986_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|2994927_2995218_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|2995228_2996374_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2996377_2996818_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2996912_2997299_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2997298_2997805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2997801_2998221_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2998189_2998471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2998510_2999452_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2999463_2999958_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2999961_3001164_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3001215_3001764_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3001819_3003271_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3003508_3004909_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3004859_3005348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3005713_3006034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3006268_3006658_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3006654_3007185_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3007187_3007436_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3007841_3008624_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3008620_3009097_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3009093_3010056_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3010057_3011716_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3012292_3012514_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3012611_3013280_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3013450_3013765_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3013757_3013946_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3014115_3014481_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3014473_3014728_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3014699_3014918_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3014743:3014757	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3014914_3015340_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3015336_3015531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3015527_3016355_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3016459_3016978_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3016983_3017694_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3017683_3017908_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3017904_3018117_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3018359_3018593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3018665_3018812_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3018771_3019014_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3018994_3020176_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3020372_3020921_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3020752:3020766	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3021119_3022652_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3022868_3023630_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	3079940	3152030	5393855	tail,protease,integrase,portal,holin,terminase	Enterobacterial_phage(25.0%)	69	3068547:3068562	3153330:3153345
3068547:3068562	attL	TACCTGCCCTGACCGG	NA	NA	NA	NA
WP_002901758.1|3079940_3080987_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004148112.1|3081031_3081247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901754.1|3081241_3082003_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
WP_002901749.1|3081999_3082590_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_002901746.1|3082649_3083552_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_004151909.1|3083833_3084730_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_002901739.1|3084841_3085750_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002901738.1|3085771_3086392_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_002901735.1|3086408_3087272_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_004198226.1|3087560_3089123_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_004148109.1|3089122_3090718_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
WP_002901733.1|3090721_3092080_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_002901730.1|3092089_3093283_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_002901728.1|3093282_3094092_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_002901726.1|3094310_3095570_-	glycerate kinase	NA	NA	NA	NA	NA
WP_002901724.1|3095572_3096661_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_002901722.1|3096675_3097986_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901720.1|3098114_3099023_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901718.1|3099065_3099524_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901714.1|3099598_3100546_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004151911.1|3100654_3100855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151912.1|3100973_3101681_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004151913.1|3101990_3104276_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_004151914.1|3104324_3105002_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
WP_020315055.1|3105378_3106671_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	89.3	7.5e-208
WP_020317845.1|3106703_3114908_-	DUF1983 domain-containing protein	NA	A0A0P0IKE4	Klebsiella_phage	69.4	0.0e+00
WP_020315039.1|3116871_3117462_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	72.4	4.7e-72
WP_020315033.1|3117510_3117924_-	lipoprotein	NA	G8C7Q7	Escherichia_phage	65.7	3.7e-52
WP_020315057.1|3117966_3118677_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	91.5	1.0e-137
WP_020315054.1|3118678_3119434_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	87.3	2.5e-134
WP_020315047.1|3119430_3119778_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	63.5	5.4e-36
WP_020315061.1|3119828_3122975_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	71.6	0.0e+00
WP_071599137.1|3122958_3123273_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	76.0	1.7e-41
WP_020315038.1|3123293_3123722_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.7	1.7e-36
WP_020315046.1|3123732_3124476_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	84.2	3.1e-113
WP_004122971.1|3124484_3124886_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	77.1	1.4e-56
WP_020315398.1|3124882_3125461_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	79.7	1.6e-77
WP_032422412.1|3125464_3125740_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	66.2	9.2e-23
WP_004122973.1|3125732_3126059_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.7	1.6e-34
WP_020319759.1|3126140_3128162_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	82.3	0.0e+00
WP_032422410.1|3128112_3129615_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.8	5.1e-248
WP_020315048.1|3129614_3129827_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_020315040.1|3129823_3131926_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.1	0.0e+00
WP_020315053.1|3131925_3132414_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	7.8e-73
WP_020315023.1|3132645_3132960_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	63.8	2.0e-29
WP_020315022.1|3133064_3133373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315035.1|3133454_3133931_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_032425500.1|3133963_3134494_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.2	1.8e-83
WP_004111739.1|3134471_3134708_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	82.6	4.0e-27
WP_071599135.1|3135072_3135819_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_020315027.1|3136008_3136188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315056.1|3136191_3136809_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	1.4e-31
WP_020315059.1|3136837_3137185_-	phage antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	8.3e-53
WP_020315049.1|3137197_3138229_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	2.4e-95
WP_020315031.1|3138428_3138821_-	repressor LexA	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_071599138.1|3138861_3139101_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	57.1	2.1e-15
WP_012542186.1|3139163_3139397_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_004178082.1|3139475_3140963_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_020315086.1|3141718_3143506_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.6	1.6e-14
WP_020318285.1|3143714_3144152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173399828.1|3144165_3144837_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	2.2e-62
WP_014907826.1|3145657_3146212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3146214_3146430_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3146531_3146921_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_032425547.1|3147763_3147958_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_020315083.1|3148000_3148345_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_020315089.1|3148486_3150625_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	1.9e-99
WP_071599122.1|3150676_3150925_+	excisionase	NA	NA	NA	NA	NA
WP_020315090.1|3150902_3152030_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	54.9	7.7e-108
3153330:3153345	attR	TACCTGCCCTGACCGG	NA	NA	NA	NA
>prophage 10
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	3233700	3321019	5393855	head,tail,tRNA,integrase,portal,capsid,holin,terminase	Klebsiella_phage(48.78%)	92	3260503:3260517	3318830:3318844
WP_002901088.1|3233700_3234201_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3234317_3234764_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3234747_3235542_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014343001.1|3235649_3236825_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3236856_3237549_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3237694_3238204_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3238208_3238547_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150780.1|3238536_3238776_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3239076_3240090_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3240147_3240249_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3240248_3240323_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3240440_3240566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3240625_3240889_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3241019_3241658_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3241747_3242662_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3243323_3244367_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3244669_3245878_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3245951_3247736_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3247742_3248633_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3248753_3250262_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150789.1|3250295_3250460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3250572_3251259_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3251656_3251836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3251875_3252508_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3253074_3253272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3253387_3254398_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3254394_3255801_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3255856_3256744_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3256760_3257267_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3257293_3257788_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3257878_3258064_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3258685_3259879_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3259991_3260219_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004225560.1|3260360_3260537_+	hypothetical protein	NA	NA	NA	NA	NA
3260503:3260517	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3260655_3260979_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3260971_3261364_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3261360_3262074_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3262346_3262499_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_020317728.1|3263148_3263841_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020317995.1|3264200_3265259_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	1.6e-14
WP_020317726.1|3265681_3267109_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.2	1.5e-100
WP_050893387.1|3267177_3279882_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.9	0.0e+00
WP_014228919.1|3279944_3280556_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|3280571_3280922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228918.1|3280953_3281664_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
WP_014907809.1|3281665_3282421_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
WP_014228916.1|3282417_3282756_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_032422481.1|3282755_3286091_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.5	0.0e+00
WP_014228914.1|3286323_3286689_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3286746_3287208_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228912.1|3287239_3287632_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	3.5e-60
WP_014228911.1|3287637_3288027_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	4.0e-56
WP_014228910.1|3288007_3288346_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_020317538.1|3288342_3288660_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228908.1|3288640_3288901_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	1.6e-21
WP_014228907.1|3288959_3290246_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_014907815.1|3290323_3291244_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3291280_3292540_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_020318187.1|3292539_3292719_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_014228904.1|3292712_3294434_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_012542168.1|3294433_3294868_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014228903.1|3295117_3295549_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_014228902.1|3295545_3295863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228901.1|3295814_3296177_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_049800533.1|3296402_3296879_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_014228899.1|3296911_3297442_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.2	6.2e-84
WP_014228898.1|3297419_3297656_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	82.6	3.1e-27
WP_020318001.1|3298957_3299401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317678.1|3299402_3300272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228895.1|3300300_3300645_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
WP_050893388.1|3300657_3301689_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.0	2.4e-95
WP_041165280.1|3301888_3302281_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	3.6e-12
WP_071845804.1|3302321_3302561_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_014228891.1|3302623_3302857_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	69.7	2.4e-24
WP_004178082.1|3302935_3304423_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_050583672.1|3305421_3306783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014229941.1|3307064_3307637_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_020317772.1|3307766_3308666_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014228888.1|3308787_3309228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858073.1|3309241_3309913_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.9	2.4e-64
WP_014228885.1|3310762_3311317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228884.1|3311322_3311544_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	55.2	3.8e-11
WP_014228883.1|3311645_3312029_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_016160636.1|3312854_3313049_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3313091_3313436_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_050893389.1|3313577_3315716_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	1.5e-99
WP_012542206.1|3315768_3316014_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|3315994_3317122_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3317239_3318490_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3318730_3319381_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3318830:3318844	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3319397_3319856_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3319912_3321019_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	3537215	3630166	5393855	head,tail,protease,tRNA,integrase,portal,capsid,lysis,terminase,plate	Salmonella_phage(58.62%)	94	3592741:3592759	3630241:3630259
WP_002898139.1|3537215_3538508_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3538598_3539942_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3539950_3540562_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3540684_3544938_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_020314624.1|3545073_3545568_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3546100_3547069_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3547183_3548950_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3548950_3550672_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3550716_3551418_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3551771_3551990_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3552110_3554390_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3554420_3554738_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3555063_3555285_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3555361_3557302_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3557298_3558414_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3558560_3560219_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3560638_3561334_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3561449_3562349_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3562492_3564145_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3564155_3565124_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3565335_3565770_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3565921_3567640_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3567678_3568680_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3568690_3570133_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3570220_3571234_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3571230_3572061_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3572092_3573232_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3574109_3574625_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3574851_3575580_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3575600_3576332_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3576338_3577055_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3577054_3577723_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3577906_3578638_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_002896382.1|3578680_3580153_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3580149_3580866_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3580944_3582072_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3582113_3582602_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3582659_3583505_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3583501_3584455_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3584465_3585599_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3585762_3586875_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3587223_3587703_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3587791_3588694_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3589515_3589803_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3590005_3590269_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3590275_3590659_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3590925_3592611_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3592741:3592759	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3592830_3593049_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3593140_3594241_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3594237_3594723_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3594719_3597347_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3597339_3597459_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3597473_3597773_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3597825_3598341_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3598350_3599523_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3599661_3600738_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3600767_3600971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3600967_3601699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3601702_3602437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3604655_3605255_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3605247_3606156_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3606142_3606505_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3606501_3607074_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3607168_3607861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3607857_3608304_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3608296_3608728_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3608690_3608837_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3608823_3609252_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3609248_3609632_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3609636_3610146_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3610126_3610342_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3610345_3610549_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3610548_3611013_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3611108_3611759_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3611762_3612821_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3612837_3613671_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3613813_3615580_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3615579_3616605_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3616666_3618409_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3618684_3619362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3619476_3619710_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3619720_3619909_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3620062_3622477_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3622473_3623331_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3623327_3623555_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3623554_3623788_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3623855_3624197_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3624160_3624361_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3624368_3624878_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3624910_3625132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3625277_3626156_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3626167_3627112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3627210_3628698_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3629185_3630166_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3630241:3630259	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	4283512	4295166	5393855	integrase	Enterobacteria_phage(70.0%)	13	4283962:4283976	4307019:4307033
WP_004144574.1|4283512_4284616_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4283962:4283976	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4284626_4285880_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4286232_4287423_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4287410_4288361_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4288360_4288786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4289354_4289921_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4289938_4290184_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4290180_4290918_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4291459_4291726_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4291722_4292280_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4292276_4292504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4292500_4292821_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4292832_4295166_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4307019:4307033	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 13
NZ_CP011976	Klebsiella pneumoniae DMC1097 chromosome, complete genome	5393855	4763412	4769237	5393855		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4763412_4765746_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4765760_4766081_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4766077_4766305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4766301_4766850_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4766846_4767113_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4767673_4768411_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4768407_4768653_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4768670_4769237_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP011977	Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence	218836	9754	64834	218836	transposase,integrase	Escherichia_phage(48.0%)	50	NA	NA
WP_001138064.1|9754_12721_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|12723_13284_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|13409_13760_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|13962_14976_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|15120_15618_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|15729_16020_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|16025_16817_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|16980_17328_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|17321_18161_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|18288_18492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|18647_19853_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|19863_20169_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|20395_21160_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|21652_22237_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|22236_23475_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|23471_24377_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|24498_25203_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|25353_26169_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|26358_27063_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_044117068.1|28366_29035_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000948429.1|30589_31789_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|31798_31987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32642_33347_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|33483_34344_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002903955.1|35387_36290_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_000957857.1|36659_36848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|36857_38057_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000776034.1|39155_39587_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|39586_40858_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000064119.1|40939_41914_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|41913_43119_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|43533_43803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|43979_44846_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|45375_45480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|45608_45866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|45923_46700_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|46696_47440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|47490_47841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|48414_48645_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|48641_49058_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001143775.1|50794_53800_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001235713.1|53961_54519_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|55214_55919_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|56774_57602_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|57598_58462_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|58470_59298_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|59306_60317_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|60310_61180_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|62388_63369_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|64570_64834_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011977	Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence	218836	70321	94837	218836	protease,transposase,integrase	Escherichia_phage(50.0%)	29	67168:67183	92653:92668
67168:67183	attL	CCTGACCAAGATGGCG	NA	NA	NA	NA
WP_004152113.1|70321_71284_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|73126_74473_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|74684_75167_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|75154_75421_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|75596_75851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|75926_76184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|76232_76436_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|76469_76838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|76881_77376_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|77406_77982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|77969_78239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|78675_79365_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|79396_80086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|80638_80857_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001568026.1|80858_81164_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_017899885.1|81332_81728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|81754_82078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315256.1|82074_83091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|83288_84083_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|84498_84678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|84797_85424_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_022644731.1|86056_86932_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	57.1	1.9e-82
WP_000948429.1|88011_89211_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|89220_89409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|89678_90035_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|90024_90426_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|90422_90713_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015065644.1|90787_93754_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
92653:92668	attR	CCTGACCAAGATGGCG	NA	NA	NA	NA
WP_000427623.1|93832_94837_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
