The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021663	Corynebacterium terpenotabidum Y-11, complete sequence	2751233	469330	524264	2751233	protease,transposase,integrase,tRNA	Hokovirus(18.18%)	52	517439:517454	525152:525167
WP_156980071.1|469330_470380_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_020440408.1|470393_470963_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	28.7	1.3e-10
WP_020440409.1|471102_473442_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.7	3.8e-109
WP_052317314.1|473453_474077_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.6	5.5e-47
WP_052317315.1|474094_474970_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	31.4	4.4e-18
WP_020440412.1|474962_475376_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_020440413.1|475372_475918_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_020440414.1|475905_476430_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_041631049.1|476440_477481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440416.1|477477_478443_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_020440417.1|478493_479393_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_020440418.1|479412_479826_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_041631269.1|480018_480528_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_020440420.1|480514_481729_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
WP_020440421.1|481759_482323_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020440422.1|482379_482763_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020440423.1|483045_483426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440424.1|483510_485118_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	33.7	2.0e-69
WP_020440425.1|485268_486681_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020440426.1|486712_487918_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_156980073.1|490770_491187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156980075.1|491583_491994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440429.1|492176_492401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020440430.1|492677_493916_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	40.8	2.8e-79
WP_020440435.1|495777_497556_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.7	9.9e-25
WP_020440436.1|497919_500538_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.5	8.8e-131
WP_020440437.1|500596_501583_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_020440438.1|501657_502332_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_156980077.1|502422_503124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440440.1|503110_504526_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_020440441.1|504627_505233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020440442.1|505381_505975_+	transcription factor	NA	NA	NA	NA	NA
WP_020440443.1|505978_506878_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_020440444.1|506904_508326_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	4.0e-45
WP_020440445.1|508333_508756_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041631273.1|508752_509007_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_169456809.1|509118_510615_-	MFS transporter	NA	NA	NA	NA	NA
WP_020440448.1|510613_511567_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_084680626.1|511571_512450_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_020440450.1|512461_513166_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	28.1	6.1e-10
WP_020440451.1|513162_514155_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020440452.1|514275_515469_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_156980079.1|515425_516364_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_020440454.1|516260_516719_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_041631052.1|516715_518254_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
517439:517454	attL	GATCTCCCCGTCCGGC	NA	NA	NA	NA
WP_020440456.1|518258_518603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041631277.1|518648_520136_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_020440458.1|520491_521475_-|integrase	site-specific integrase	integrase	A0A222ZES9	Arthrobacter_phage	35.4	1.2e-35
WP_156980081.1|521690_522266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020440460.1|522267_522978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020440461.1|522974_523433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041631055.1|523457_524264_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
525152:525167	attR	GATCTCCCCGTCCGGC	NA	NA	NA	NA
>prophage 2
NC_021663	Corynebacterium terpenotabidum Y-11, complete sequence	2751233	758314	813738	2751233	protease,transposase,integrase,holin	Gordonia_phage(16.67%)	54	766791:766810	772504:772523
WP_156980120.1|758314_758620_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_020440662.1|758629_759226_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_156980466.1|759292_760438_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_020440664.1|760434_761106_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_020440665.1|761102_761996_+	glutamate racemase	NA	NA	NA	NA	NA
WP_020440666.1|762062_762872_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_020440667.1|762918_763683_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_020440668.1|763685_764360_+	non-canonical purine NTP pyrophosphatase	NA	E5DUE6	Cassava_brown_streak_virus	31.1	8.4e-09
WP_020440669.1|764425_765805_+	amidohydrolase	NA	NA	NA	NA	NA
WP_020440670.1|765801_766167_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
766791:766810	attL	GTGGGGGTTCAAGTCCCCCC	NA	NA	NA	NA
WP_169456813.1|766836_767232_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J790	uncultured_Caudovirales_phage	34.1	1.5e-05
WP_169456815.1|767542_768178_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	64.1	1.7e-24
WP_169456816.1|768530_769325_+	porin	NA	NA	NA	NA	NA
WP_156980126.1|769654_770212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156980129.1|770529_770943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440676.1|772843_773311_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
772504:772523	attR	GTGGGGGTTCAAGTCCCCCC	NA	NA	NA	NA
WP_020440677.1|773425_773704_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_020440678.1|773756_774836_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_041631315.1|774849_775263_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_020440680.1|775670_776843_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_156980469.1|776920_777583_-	flavin reductase	NA	NA	NA	NA	NA
WP_020440682.1|777497_777812_+	quaternary ammonium compound resistance protein	NA	NA	NA	NA	NA
WP_020440683.1|777852_778851_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020440684.1|778878_779448_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_084680572.1|780571_781852_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_020440687.1|781938_783006_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_020440688.1|783107_785228_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.1	8.1e-42
WP_041631074.1|785504_786617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440690.1|786920_789542_+	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	1.2e-63
WP_156980472.1|789563_790601_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_084680573.1|790590_790950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440693.1|791179_791821_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.6	2.2e-22
WP_020440694.1|791830_792658_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_052317261.1|792879_793425_+	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	36.9	6.8e-09
WP_156980132.1|793361_794000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440695.1|794075_794840_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	26.0	2.0e-06
WP_020440696.1|795053_797222_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_156980475.1|797419_798073_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_156980478.1|798498_799428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440699.1|799856_801527_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	29.4	1.9e-49
WP_020440700.1|801564_802065_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_020440701.1|802203_802926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041631320.1|802944_803790_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_020440703.1|803860_804280_-	globin	NA	NA	NA	NA	NA
WP_020440704.1|804298_807004_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	30.3	3.0e-41
WP_020440705.1|807065_807704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041631075.1|807877_808057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440706.1|808066_808270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020440707.1|808395_808872_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_020440708.1|808879_809083_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	45.5	3.3e-09
WP_020440709.1|809173_810037_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_020440710.1|810498_811077_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_020440711.1|811444_812830_+	trigger factor	NA	NA	NA	NA	NA
WP_041631323.1|813135_813738_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.3	1.3e-42
>prophage 3
NC_021663	Corynebacterium terpenotabidum Y-11, complete sequence	2751233	2149099	2157701	2751233	tRNA	uncultured_virus(33.33%)	7	NA	NA
WP_020441857.1|2149099_2149417_+	WhiB family transcriptional regulator	NA	I6XD27	Mycobacterium_virus	40.3	4.3e-08
WP_020441858.1|2149541_2151158_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	50.0	1.4e-139
WP_020441859.1|2151165_2151465_-	co-chaperone GroES	NA	A0A221S308	uncultured_virus	43.4	2.0e-18
WP_020441860.1|2151591_2153928_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.6e-51
WP_052317374.1|2154097_2154592_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_041631169.1|2154651_2155770_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.5	3.0e-35
WP_020441861.1|2155826_2157701_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	33.3	3.4e-92
