The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021725	Lactobacillus rhamnosus LOCK908, complete sequence	2990900	837461	916285	2990900	integrase,protease,portal,holin,terminase,capsid,tRNA,head,tail,transposase	Lactobacillus_phage(82.22%)	87	817058:817117	880591:880666
817058:817117	attL	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGA	NA	NA	NA	NA
WP_020752155.1|837461_838589_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	9.8e-212
WP_025014108.1|838696_838960_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	41.3	8.5e-10
WP_005714766.1|839098_839320_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
WP_032957965.1|839602_840694_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005712700.1|840802_841021_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_025014107.1|841092_841740_-	LexA family transcriptional regulator	NA	B4XYR6	Lactobacillus_phage	43.1	9.7e-39
WP_020752157.1|841888_842155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020752159.1|842516_843257_+	phage regulatory protein/antirepressor Ant	NA	B4XYR8	Lactobacillus_phage	84.8	7.8e-109
WP_015764320.1|843257_843518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764321.1|843510_843816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020752160.1|843890_844247_+	DUF771 domain-containing protein	NA	B4XYS0	Lactobacillus_phage	99.2	5.3e-63
WP_020752161.1|844331_844535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025014106.1|844609_844924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020752163.1|844916_845753_+	helix-turn-helix domain-containing protein	NA	A0A0P0ICZ8	Lactobacillus_phage	67.5	2.1e-110
WP_020752164.1|845749_847012_+	replicative DNA helicase	NA	A8YQM1	Lactobacillus_phage	97.6	3.9e-233
WP_020752165.1|847013_847358_+	hypothetical protein	NA	U5U420	Lactobacillus_phage	88.6	1.4e-55
WP_020752166.1|847370_847658_+	helix-turn-helix transcriptional regulator	NA	U5U4M6	Lactobacillus_phage	93.7	7.8e-41
WP_020752167.1|847644_847899_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	95.2	1.2e-37
WP_003607027.1|847895_848261_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
WP_020752168.1|848273_848738_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	9.5e-20
WP_025014105.1|848749_848935_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	1.5e-24
WP_020752169.1|848931_849438_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	71.2	1.2e-57
WP_020752170.1|849427_849604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020752171.1|849593_849911_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	50.0	4.2e-19
WP_020752172.1|849907_850117_+	hypothetical protein	NA	A8YQM9	Lactobacillus_phage	92.8	1.0e-29
WP_005711378.1|850461_850890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688553.1|851424_852090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020752173.1|852732_853950_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.3	5.6e-237
WP_020752174.1|853936_854467_+	HNH endonuclease	NA	U5U4N5	Lactobacillus_phage	96.6	2.0e-98
WP_025014104.1|854470_854794_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	88.5	2.3e-49
WP_185954906.1|855038_855791_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	98.0	2.5e-139
WP_005712753.1|855991_856447_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
WP_020752178.1|856468_858181_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	98.4	0.0e+00
WP_003661399.1|858192_858384_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_020752179.1|858388_859642_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	98.3	6.5e-233
WP_015764348.1|859595_860225_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	100.0	3.3e-116
WP_020752181.1|860266_861469_+|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	96.2	1.2e-210
WP_005686975.1|861486_861726_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	96.2	2.1e-31
WP_005686976.1|861736_862096_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	96.6	3.6e-59
WP_020752182.1|862085_862415_+|head,tail	head-tail adaptor protein	head,tail	P94213	Lactobacillus_phage	98.2	6.8e-57
WP_015764352.1|862414_862801_+	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
WP_005686982.1|862800_863187_+	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	97.7	1.4e-69
WP_020752183.1|863220_863835_+|tail	phage major tail protein	tail	U5U3Z7	Lactobacillus_phage	97.1	1.4e-108
WP_003661382.1|863937_864351_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_020752184.1|864473_869366_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	90.8	0.0e+00
WP_020752185.1|869365_870079_+	Prophage Lp1 protein 51	NA	A0A1B2APY0	Phage_Wrath	40.0	2.6e-45
WP_020752186.1|870080_871553_+|tail	phage tail protein	tail	A0A286QMQ0	Streptococcus_phage	25.4	4.6e-36
WP_020752187.1|871552_874666_+	CotH kinase family protein	NA	NA	NA	NA	NA
WP_014569500.1|874807_875101_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_020752188.1|875090_875504_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	95.8	7.1e-43
WP_025014102.1|875518_875791_+	hypothetical protein	NA	C1KFI4	Lactobacillus_virus	67.8	4.8e-32
WP_020752189.1|875802_876987_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	89.6	6.0e-204
WP_019728331.1|877913_878930_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_005688600.1|880818_881472_-	hypothetical protein	NA	NA	NA	NA	NA
880591:880666	attR	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGCCCTGTATCCTCCAT	NA	NA	NA	NA
WP_005713641.1|881650_882835_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
WP_005688606.1|883364_884858_+	MFS transporter	NA	NA	NA	NA	NA
WP_005688608.1|885034_885505_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005688612.1|887201_887927_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_005688613.1|887991_888663_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005687226.1|889083_891495_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
WP_014571206.1|892014_893658_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005688618.1|893662_894373_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005688621.1|894458_894674_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_005688624.1|894804_895635_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005687236.1|895631_896132_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005688627.1|896528_897002_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_015764365.1|897108_898317_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_005688631.1|898444_899773_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005687240.1|899987_900254_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_005688634.1|900408_901752_+	PFL family protein	NA	NA	NA	NA	NA
WP_014571209.1|901918_902986_+	competence protein	NA	NA	NA	NA	NA
WP_005687248.1|903226_903862_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005688639.1|903931_904525_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_005713649.1|904691_905369_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005687253.1|905370_906168_+	NAD kinase	NA	NA	NA	NA	NA
WP_005688644.1|906167_907070_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005688645.1|907213_908272_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005688646.1|908488_909127_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005688647.1|909146_909965_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005688649.1|910169_911210_-	lactonase family protein	NA	NA	NA	NA	NA
WP_005688651.1|911453_911828_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|911877_912147_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005713651.1|912261_913251_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_005688655.1|913434_914382_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_005688657.1|914447_915290_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_072137696.1|915555_915774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688659.1|915775_916285_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NC_021725	Lactobacillus rhamnosus LOCK908, complete sequence	2990900	1003708	1059174	2990900	integrase,portal,terminase,capsid,tRNA,head,tail	Staphylococcus_phage(23.53%)	58	997412:997427	1053614:1053629
997412:997427	attL	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_005688741.1|1003708_1004173_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005688742.1|1004378_1005275_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.2e-24
WP_014571234.1|1005267_1006527_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688746.1|1006714_1007257_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	8.2e-23
WP_014571235.1|1007268_1008027_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.1	6.2e-61
WP_014571236.1|1008552_1009416_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005688750.1|1009452_1011567_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005684568.1|1011790_1012330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005688752.1|1012343_1013432_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.0	1.4e-37
WP_005684570.1|1013525_1014350_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.7	8.9e-13
WP_005684571.1|1014339_1015173_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005684572.1|1015156_1016230_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005688758.1|1016439_1017012_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	48.1	2.1e-29
WP_005688760.1|1017039_1017405_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	77.8	3.9e-45
WP_005688762.1|1017726_1017918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688764.1|1018110_1020903_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.5e-72
WP_005688766.1|1020978_1021659_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005688768.1|1021692_1022832_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688770.1|1022821_1023556_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-25
WP_005684581.1|1023815_1024673_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_005688772.1|1024669_1025767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688773.1|1025795_1027160_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014571238.1|1027588_1029400_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	37.2	2.0e-89
WP_005713700.1|1029549_1031355_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_005716007.1|1031428_1031920_+	VanZ family protein	NA	NA	NA	NA	NA
WP_005684587.1|1031990_1032722_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014571239.1|1033098_1033968_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_005688784.1|1033964_1034918_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005684590.1|1034920_1035241_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688785.1|1035237_1035660_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688787.1|1035629_1035941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569400.1|1035900_1036368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688791.1|1036364_1036688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688793.1|1036970_1037984_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005688795.1|1038252_1038708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684599.1|1038922_1040287_+	amino acid permease	NA	NA	NA	NA	NA
WP_005688798.1|1040318_1041083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571241.1|1041079_1041919_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005688802.1|1041919_1042876_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_005688804.1|1042872_1043745_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014571243.1|1043968_1046263_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_019728364.1|1046928_1048077_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.3	6.0e-31
WP_019728365.1|1048184_1048844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019728366.1|1049012_1049282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005716036.1|1049349_1049571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020752196.1|1049681_1049873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019728369.1|1049917_1050193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005716042.1|1050189_1050378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019728370.1|1050361_1051189_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	31.8	3.4e-12
WP_019728371.1|1051181_1052606_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	1.1e-63
WP_013245609.1|1052869_1053211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005690496.1|1053293_1053668_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
1053614:1053629	attR	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_003593553.1|1053792_1054263_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_005716050.1|1054259_1055963_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.2	6.0e-120
WP_003593556.1|1055928_1056108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005716051.1|1056112_1057297_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	3.7e-60
WP_019728373.1|1057283_1058828_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	31.0	3.8e-33
WP_019728374.1|1058883_1059174_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
