The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	17856	67798	3113601	bacteriocin,holin,protease,transposase	Paenibacillus_phage(33.33%)	51	NA	NA
WP_003568480.1|17856_18714_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|18793_18976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|19026_19206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568484.1|19694_20930_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_020751361.1|21133_23707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|23719_24421_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003568490.1|24700_25252_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568492.1|25295_26102_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568494.1|26106_26427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568543.1|26652_27333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659016.1|27265_27769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659018.1|27788_29939_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003568499.1|30283_31057_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003568500.1|31234_31840_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568502.1|32179_32404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568598.1|32559_33237_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003568507.1|33401_34295_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|34343_34982_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|35210_36587_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|36809_37154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|37229_37589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562542.1|37829_39272_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562544.1|39466_40102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562546.1|40151_40463_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003562548.1|40631_40820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245310.1|40951_41563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013245311.1|41919_42393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245312.1|42589_43123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245314.1|43558_44608_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013245315.1|44604_45342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562555.1|45553_46264_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003577245.1|46250_46580_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_013245316.1|47460_47676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673954.1|48031_48907_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562571.1|49252_49903_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003572914.1|50300_50993_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016386482.1|51269_51626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572918.1|51690_52011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245319.1|52199_53075_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	27.3	2.3e-11
WP_013245320.1|53167_54760_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	2.3e-12
WP_013245321.1|55105_56479_-	MFS transporter	NA	NA	NA	NA	NA
WP_013245322.1|56656_56980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013245323.1|57832_58588_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.7	3.9e-31
WP_123796487.1|58563_59460_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.3	6.7e-30
WP_013245326.1|59668_62986_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003562586.1|62982_63585_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|63835_64096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|64309_64972_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|64971_65901_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020751362.1|65912_66542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012490780.1|66544_67798_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
>prophage 2
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	596100	611861	3113601	integrase	Lactobacillus_phage(76.92%)	26	585408:585421	606862:606875
585408:585421	attL	ATGAAAGCATTGAT	NA	NA	NA	NA
WP_003577893.1|596100_597030_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
WP_013245460.1|597219_597765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751437.1|598085_599255_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.4	3.6e-217
WP_003573997.1|599367_599628_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003589914.1|599717_600338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589917.1|600321_600558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589919.1|600750_601458_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|601616_602039_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|602031_602385_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|602628_602877_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|602918_603119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|603089_603923_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|603983_604742_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|604742_604922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604448.1|604914_605166_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|605231_605588_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_020751438.1|605672_605876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|605858_606404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168839.1|606584_606899_+	hypothetical protein	NA	NA	NA	NA	NA
606862:606875	attR	ATCAATGCTTTCAT	NA	NA	NA	NA
WP_003589923.1|606891_607638_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_003589925.1|607652_608477_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.1	6.6e-117
WP_003574016.1|608476_608995_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|609041_609464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493149.1|610213_610501_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|610570_610903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168840.1|611417_611861_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	96.6	8.0e-77
>prophage 3
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	616677	647766	3113601	holin,transposase	Lactobacillus_phage(40.0%)	38	NA	NA
WP_076626284.1|616677_617010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|617039_617768_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_123796492.1|617701_618643_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.7	1.1e-17
WP_016364094.1|618688_619552_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_020751443.1|620233_620512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|620523_620790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|620808_620985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|620986_621214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168841.1|621256_622498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751445.1|622475_624026_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003589969.1|624035_624455_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016388730.1|624463_625042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605686.1|625068_627525_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_020751446.1|627521_629579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582234.1|629584_629920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583424.1|629903_630500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605684.1|630480_632409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751447.1|632410_633421_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.3	9.0e-15
WP_003605679.1|633436_634081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168842.1|634077_634485_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_020751449.1|634474_635296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587040.1|635899_636079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751450.1|636119_636374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751451.1|636363_636801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751452.1|636793_638038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751453.1|638079_638325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751454.1|638311_640852_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_020751455.1|641190_641313_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003605664.1|641449_641827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605663.1|641829_641973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751456.1|641965_642415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605660.1|642428_642719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003590008.1|642728_643175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582052.1|643677_644571_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_020751457.1|644576_644936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796494.1|644943_645730_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003606341.1|646180_647530_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.7	1.7e-122
WP_071799104.1|647571_647766_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	966284	1006800	3113601	head,capsid,portal,tail,integrase,terminase,holin,tRNA,protease	Lactobacillus_phage(97.78%)	51	970524:970538	979170:979184
WP_003564129.1|966284_968696_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.3	0.0e+00
WP_003564130.1|968960_970604_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
970524:970538	attL	TTGATTTTGAAAACG	NA	NA	NA	NA
WP_003564131.1|970608_971319_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003564132.1|971461_971677_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003564133.1|971793_972615_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003564134.1|972611_973115_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003593814.1|973438_974578_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.9	7.8e-217
WP_003598052.1|974695_975763_-	Abi family protein	NA	A0A0N7IRA5	Lactobacillus_phage	100.0	1.1e-207
WP_003598055.1|975907_976339_-	hypothetical protein	NA	A0A0P0IJV8	Lactobacillus_phage	100.0	6.8e-73
WP_012491228.1|976408_976891_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	100.0	2.1e-83
WP_003598059.1|976894_977188_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	100.0	5.7e-47
WP_020751498.1|977371_978232_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	91.6	3.5e-145
WP_020751499.1|978218_978578_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I3L3	Lactobacillus_phage	64.7	1.8e-34
WP_003578190.1|978847_979045_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_020751500.1|979041_979839_+	ORF6N domain-containing protein	NA	A0A0P0IDD0	Lactobacillus_phage	59.8	1.7e-56
979170:979184	attR	CGTTTTCAAAATCAA	NA	NA	NA	NA
WP_003593164.1|979846_980059_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	98.6	1.7e-29
WP_003657835.1|980167_980392_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_020751501.1|980480_980693_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	95.7	5.2e-34
WP_020751502.1|980702_981578_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	98.6	4.7e-169
WP_016364601.1|981580_981775_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	98.4	5.5e-30
WP_020751503.1|981774_982662_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	98.6	4.7e-161
WP_080652408.1|982670_982916_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	95.1	2.5e-35
WP_041168849.1|982920_983766_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	98.2	2.8e-131
WP_020751505.1|983803_984625_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.6	3.0e-154
WP_025376211.1|984691_985111_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	98.6	3.5e-74
WP_019884715.1|985115_985406_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	98.9	4.3e-39
WP_016364251.1|985402_985726_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
WP_041168850.1|985804_986254_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	93.3	1.7e-74
WP_041168851.1|986478_987093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168852.1|987263_987644_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	96.8	1.8e-69
WP_003582259.1|987713_988088_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_020751508.1|988090_989821_+|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	99.3	0.0e+00
WP_020751509.1|989839_991075_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	99.3	8.4e-233
WP_020751510.1|991052_991760_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	98.7	3.9e-126
WP_016387127.1|991764_992997_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	95.6	1.4e-216
WP_016382022.1|993070_993319_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
WP_020751511.1|993332_993659_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	99.1	2.0e-53
WP_012491255.1|993597_993936_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_020751512.1|993919_994249_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	98.2	4.9e-55
WP_016387125.1|994238_994622_+	phage protein	NA	A0A0P0IQS9	Lactobacillus_phage	98.4	2.2e-67
WP_020751513.1|994633_995281_+	hypothetical protein	NA	A0A0P0I7R6	Lactobacillus_phage	94.9	2.7e-113
WP_016387123.1|995357_995723_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	99.2	1.0e-61
WP_020751514.1|995803_995965_+	hypothetical protein	NA	A0A1B0Y4R4	Lactobacillus_phage	98.1	1.7e-24
WP_020751515.1|995984_999155_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	98.4	0.0e+00
WP_020751516.1|999161_999857_+	hypothetical protein	NA	A0A1B0Y2S2	Lactobacillus_phage	97.8	3.0e-126
WP_020751517.1|999853_1004146_+|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	75.1	0.0e+00
WP_020751518.1|1004174_1004600_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	98.6	3.7e-71
WP_020751519.1|1004602_1004872_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	97.7	4.4e-38
WP_020751520.1|1004917_1005211_+	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	88.7	3.2e-42
WP_020751521.1|1005200_1005617_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	98.9	5.5e-43
WP_020751522.1|1005627_1006800_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	93.1	4.6e-212
>prophage 5
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	1891086	1901589	3113601	protease,transposase	Paenibacillus_phage(33.33%)	9	NA	NA
WP_003565997.1|1891086_1892499_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.7	8.4e-27
WP_003565999.1|1892797_1894525_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.8	2.9e-21
WP_003566007.1|1894524_1894791_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003566008.1|1894934_1895126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751588.1|1895474_1897571_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.6	2.7e-114
WP_003570563.1|1897691_1897985_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_123796487.1|1898271_1899168_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.3	6.7e-30
WP_013245323.1|1899143_1899899_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.7	3.9e-31
WP_016386813.1|1900014_1901589_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.0	3.4e-29
>prophage 6
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	2034904	2087898	3113601	capsid,portal,tail,integrase,terminase,protease,head	Lactobacillus_phage(57.14%)	66	2046873:2046898	2085241:2085266
WP_003566268.1|2034904_2035666_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003566270.1|2035840_2036608_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003566272.1|2036916_2038512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566275.1|2039212_2039542_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566277.1|2039918_2040563_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013245859.1|2040888_2042382_-	protein kinase	NA	M1HHG8	Acanthocystis_turfacea_Chlorella_virus	30.0	3.9e-14
WP_003566280.1|2042750_2042963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566282.1|2043262_2043739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566286.1|2044200_2044425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751600.1|2044862_2046278_-	group II intron reverse transcriptase domain-containing protein	NA	NA	NA	NA	NA
WP_003566290.1|2046423_2046576_+	hypothetical protein	NA	NA	NA	NA	NA
2046873:2046898	attL	ACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_020751601.1|2047030_2048083_-	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	95.1	5.2e-199
WP_020751602.1|2048084_2048357_-	hypothetical protein	NA	Q9MCC7	Lactobacillus_phage	94.4	1.7e-40
WP_187289199.1|2048346_2048589_-	hypothetical protein	NA	U5U779	Lactobacillus_phage	75.0	1.5e-13
WP_041168860.1|2048572_2048950_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	88.7	1.9e-58
WP_020751604.1|2048962_2052982_-	CotH kinase family protein	NA	Q597U3	Lactobacillus_virus	47.1	7.9e-38
WP_020751605.1|2052950_2055053_-|tail	phage tail protein	tail	A0A2K9VBZ3	Lactobacillus_phage	52.1	4.1e-203
WP_020751606.1|2055065_2055884_-|tail	phage tail family protein	tail	Q597U5	Lactobacillus_virus	37.6	4.2e-71
WP_020751607.1|2055887_2058884_-|tail	phage tail tape measure protein	tail	A0A097BYC3	Leuconostoc_phage	66.4	2.9e-125
WP_123796509.1|2058883_2059153_-	hypothetical protein	NA	Q597U7	Lactobacillus_virus	35.2	6.1e-11
WP_020751609.1|2059188_2059629_-	hypothetical protein	NA	A0A2P0ZL56	Lactobacillus_phage	51.4	2.4e-25
WP_020751610.1|2059692_2060322_-|tail	phage major tail protein, TP901-1 family	tail	G8FV40	Pediococcus_virus	77.9	7.1e-87
WP_020751611.1|2060324_2060690_-	hypothetical protein	NA	Q597V0	Lactobacillus_virus	47.4	6.7e-21
WP_020751612.1|2060686_2061061_-	HK97 gp10 family phage protein	NA	Q597V1	Lactobacillus_virus	40.5	1.6e-17
WP_041168861.1|2061053_2061350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751614.1|2061346_2061688_-|head,tail	phage head-tail connector protein	head,tail	Q597V3	Lactobacillus_virus	59.3	1.9e-33
WP_020751615.1|2061684_2062563_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	80.1	1.2e-143
WP_020751616.1|2062631_2063552_-|capsid	phage capsid protein	capsid	A0A2P0ZL66	Lactobacillus_phage	74.9	1.3e-116
WP_020751617.1|2063565_2064105_-	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	55.8	2.4e-22
WP_020751618.1|2064276_2064618_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	53.9	5.0e-26
WP_020751619.1|2064627_2065338_-	hypothetical protein	NA	Q597V7	Lactobacillus_virus	51.3	5.3e-62
WP_020751620.1|2065363_2066884_-|portal	phage portal protein	portal	Q597V8	Lactobacillus_virus	64.3	1.3e-179
WP_020751621.1|2066885_2068178_-|terminase	PBSX family phage terminase large subunit	terminase	Q597V9	Lactobacillus_virus	69.6	7.3e-179
WP_020751622.1|2068167_2068719_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	92.4	5.0e-60
WP_020751623.1|2068718_2068856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751624.1|2068865_2070014_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.4	2.9e-219
WP_016372095.1|2070038_2070293_-	hypothetical protein	NA	U5U404	Lactobacillus_phage	95.2	7.4e-43
WP_041168864.1|2070651_2071095_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	98.0	1.1e-78
WP_020751625.1|2071577_2071766_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	62.3	5.7e-08
WP_041168865.1|2071762_2072050_-	hypothetical protein	NA	Q8LTB3	Lactobacillus_phage	88.4	1.9e-42
WP_020751626.1|2072046_2072418_-	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	72.7	2.4e-42
WP_041168866.1|2072414_2072807_-	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	58.0	4.4e-34
WP_020751627.1|2072796_2073015_-	hypothetical protein	NA	B4XYT5	Lactobacillus_phage	95.8	7.0e-34
WP_020751628.1|2072998_2073310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168867.1|2073306_2073513_-	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	95.6	1.4e-31
WP_020751629.1|2073505_2074072_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	57.4	7.2e-46
WP_020751630.1|2074068_2074332_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	97.7	2.9e-42
WP_020751631.1|2074344_2074953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751632.1|2074963_2075887_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	42.1	1.1e-67
WP_020751633.1|2075873_2076584_-	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	98.2	2.0e-125
WP_020751634.1|2076594_2076978_-	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	93.7	2.6e-63
WP_020751635.1|2076980_2077430_-	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	87.9	2.5e-65
WP_020751636.1|2077445_2077931_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	85.7	1.6e-62
WP_020751637.1|2077943_2078897_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	87.7	6.7e-121
WP_080652413.1|2078912_2079713_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.8	4.0e-143
WP_020751639.1|2079693_2080560_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	96.5	2.1e-153
WP_016371376.1|2080572_2080980_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	99.3	4.0e-75
WP_019885644.1|2081221_2081431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562014.1|2081436_2081943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016376224.1|2082000_2082159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751641.1|2082155_2082401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020751642.1|2082530_2083214_+	LexA family transcriptional regulator	NA	A6M973	Geobacillus_virus	37.1	4.5e-10
WP_041168868.1|2083229_2083808_+	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	89.6	3.1e-97
WP_020751644.1|2083917_2085081_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	31.0	1.5e-45
WP_020751646.1|2085245_2086799_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
2085241:2085266	attR	ACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_013245861.1|2086971_2087898_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
>prophage 7
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	2387831	2465327	3113601	capsid,portal,tail,integrase,terminase,holin,tRNA,protease,head	Lactobacillus_phage(77.59%)	92	2427651:2427666	2471005:2471020
WP_003567053.1|2387831_2388476_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003571272.1|2388556_2389615_+	LCP family protein	NA	NA	NA	NA	NA
WP_003571273.1|2389676_2390705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571274.1|2390705_2391593_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003567064.1|2391589_2391955_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567066.1|2392096_2392750_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003580616.1|2392967_2394920_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	7.4e-58
WP_003567071.1|2395193_2395529_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003571278.1|2395624_2396650_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.6	1.2e-59
WP_003567075.1|2396683_2397217_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567077.1|2397200_2397923_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003571280.1|2398238_2398844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567081.1|2399074_2399593_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003567083.1|2400064_2401045_+	asparaginase	NA	NA	NA	NA	NA
WP_003567089.1|2401140_2401884_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003571286.1|2401978_2402836_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	53.0	4.9e-70
WP_003567092.1|2402837_2403176_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
WP_003567093.1|2403180_2404158_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	28.1	3.8e-26
WP_003567098.1|2404157_2404487_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003567099.1|2404521_2405166_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	4.0e-53
WP_003571289.1|2405759_2406023_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003567101.1|2406022_2406622_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003567105.1|2406937_2407246_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003571293.1|2407262_2408960_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	3.0e-55
WP_003659520.1|2409210_2409717_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003567111.1|2409859_2410189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567112.1|2410245_2410842_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003571315.1|2410946_2413556_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003571317.1|2413833_2414247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567118.1|2414396_2415329_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003659525.1|2415438_2421147_-	PII-type proteinase	NA	NA	NA	NA	NA
WP_003571321.1|2421436_2422336_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_025376236.1|2422664_2422889_-	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	97.3	1.8e-32
WP_020751694.1|2422933_2424079_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	53.1	4.8e-89
WP_020751695.1|2424089_2424536_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	91.9	2.3e-63
WP_041168873.1|2424528_2424738_-	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	100.0	1.5e-12
WP_020751696.1|2424718_2425105_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	97.7	2.1e-65
WP_020751697.1|2425135_2425267_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	7.2e-18
WP_020751698.1|2425259_2425550_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	56.2	3.0e-24
WP_020751699.1|2425551_2428479_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	65.7	0.0e+00
2427651:2427666	attL	TTAACAAACGTGAATA	NA	NA	NA	NA
WP_041168874.1|2428479_2430471_-|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	61.3	1.2e-217
WP_020751701.1|2430471_2433561_-	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	84.1	9.4e-257
WP_003602749.1|2433553_2433907_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	97.4	4.8e-56
WP_020751702.1|2434011_2434344_-|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	99.1	3.9e-52
WP_020751703.1|2434419_2435010_-|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	96.2	4.9e-98
WP_003582636.1|2435021_2435426_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	6.0e-71
WP_003602752.1|2435426_2435792_-	hypothetical protein	NA	A0A0P0IUZ3	Lactobacillus_phage	97.5	3.1e-58
WP_020751704.1|2435788_2436091_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	88.0	5.9e-47
WP_020751705.1|2436095_2436470_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	97.6	4.7e-62
WP_041168875.1|2436469_2437348_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	80.5	4.7e-145
WP_016385855.1|2437416_2438463_-|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	98.2	2.7e-187
WP_020751707.1|2438476_2438791_-	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	93.3	2.8e-47
WP_020751708.1|2438803_2439442_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	99.1	6.3e-91
WP_020751709.1|2439559_2439925_-	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	54.5	3.5e-17
WP_020751710.1|2439941_2440382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751711.1|2440393_2441380_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.4	8.9e-177
WP_041168876.1|2441345_2442773_-|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	93.9	1.9e-257
WP_020751713.1|2442777_2444031_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.3	6.1e-247
WP_020751714.1|2444014_2444593_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	78.8	5.1e-63
WP_020751715.1|2444978_2446127_-	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	95.3	1.0e-216
WP_041168877.1|2446408_2446858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751716.1|2446854_2447829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582019.1|2448454_2448883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751717.1|2449234_2449708_-	hypothetical protein	NA	A0A1I9KKE3	Lactobacillus_phage	42.5	6.5e-24
WP_020751718.1|2449704_2450097_-	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	73.3	3.4e-47
WP_003658047.1|2450093_2450300_-	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	98.5	1.5e-33
WP_020751719.1|2450292_2450505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751720.1|2450494_2450707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751721.1|2450696_2451089_-	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	50.0	2.8e-25
WP_020751722.1|2451075_2451582_-	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	62.3	8.1e-49
WP_020751723.1|2451578_2451821_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	51.7	7.6e-13
WP_020751724.1|2451832_2452297_-	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	1.7e-13
WP_016364507.1|2452309_2452675_-	hypothetical protein	NA	A0A2D1GPL1	Lactobacillus_phage	100.0	1.4e-66
WP_020751726.1|2452671_2452926_-	hypothetical protein	NA	U5U728	Lactobacillus_phage	90.5	6.7e-36
WP_020751727.1|2452926_2453256_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	83.3	1.1e-41
WP_020751728.1|2453252_2454035_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	92.3	9.1e-132
WP_020751729.1|2454021_2454873_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	96.3	2.4e-106
WP_080652417.1|2454888_2455689_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.1	5.2e-143
WP_020751731.1|2455669_2456533_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	96.5	3.8e-155
WP_020751732.1|2456545_2456953_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	96.3	4.9e-73
WP_020751733.1|2457183_2457510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751734.1|2457500_2457974_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020751735.1|2458036_2458195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751736.1|2458191_2458434_-	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	91.2	8.6e-33
WP_080647126.1|2458568_2458907_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	99.1	1.0e-55
WP_020751737.1|2458896_2459316_+	hypothetical protein	NA	A0A0P0IJN5	Lactobacillus_phage	99.3	2.0e-77
WP_020751738.1|2459379_2459985_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	98.0	2.9e-77
WP_020751740.1|2460945_2461332_+	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	45.2	2.3e-27
WP_041168878.1|2461593_2462019_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	87.9	3.1e-62
WP_041168879.1|2462042_2462246_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	2.7e-27
WP_020751742.1|2462353_2463928_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	25.0	3.3e-24
WP_051132531.1|2464112_2465327_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	28.0	8.5e-36
2471005:2471020	attR	TTAACAAACGTGAATA	NA	NA	NA	NA
>prophage 8
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	2499490	2564765	3113601	bacteriocin,transposase,tRNA,protease	Bacillus_phage(18.18%)	60	NA	NA
WP_003659543.1|2499490_2500897_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	5.7e-52
WP_013246002.1|2501137_2502532_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_013246003.1|2502657_2503245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567227.1|2503244_2503436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2503911_2505405_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013246004.1|2505552_2506533_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016386662.1|2506648_2507320_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013246006.1|2507503_2508334_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013246007.1|2508479_2509319_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013246008.1|2509331_2510348_-	membrane protein	NA	NA	NA	NA	NA
WP_013246009.1|2510354_2510729_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013246010.1|2510893_2512165_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003591638.1|2512482_2513259_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013246013.1|2515355_2516471_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_020751747.1|2516492_2517857_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2517873_2518416_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003595964.1|2518636_2518927_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2519043_2519421_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003571381.1|2519665_2520985_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003576225.1|2521343_2522690_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003588720.1|2522917_2524018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016386658.1|2524014_2525211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2525273_2526152_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_013246017.1|2526313_2528368_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	1.6e-63
WP_013246018.1|2528524_2531155_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.1e-88
WP_020751524.1|2531430_2532675_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.1e-11
WP_003576237.1|2532786_2533410_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013246019.1|2533909_2534581_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013246020.1|2534678_2534918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599717.1|2535092_2536214_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2536227_2536512_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|2536702_2537818_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2538005_2538212_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2538344_2538602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2538672_2538879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246021.1|2539103_2539355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246023.1|2539682_2540915_+	MFS transporter	NA	NA	NA	NA	NA
WP_003576247.1|2540993_2542250_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
WP_003588744.1|2542338_2543172_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_003567298.1|2543488_2543683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246024.1|2543936_2544473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246025.1|2544661_2545885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246026.1|2546473_2547301_-	class C sortase	NA	NA	NA	NA	NA
WP_020751748.1|2547307_2548867_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_016386628.1|2548863_2550186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246030.1|2550187_2553193_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2553470_2554028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246031.1|2554122_2555319_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003605954.1|2555527_2556583_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_013246032.1|2556853_2557501_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.7e-06
WP_003596042.1|2557636_2557966_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013246033.1|2557962_2558751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2558803_2559592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2559636_2559915_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2559938_2560223_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013246034.1|2560415_2560712_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013246035.1|2560816_2562172_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_013246036.1|2562477_2562789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246037.1|2562861_2563212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246038.1|2563385_2564765_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
>prophage 10
NC_021721	Lacticaseibacillus paracasei, complete sequence	3113601	2746669	2754564	3113601	transposase	Paenibacillus_phage(33.33%)	8	NA	NA
WP_123796487.1|2746669_2747566_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.3	6.7e-30
WP_013245323.1|2747541_2748297_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.7	3.9e-31
WP_003567716.1|2748407_2748746_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003567718.1|2749041_2750016_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.4	6.8e-44
WP_003567720.1|2750113_2751502_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.6	2.8e-27
WP_003567722.1|2751641_2752835_-	RDD family protein	NA	NA	NA	NA	NA
WP_003567724.1|2752831_2753680_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	26.4	1.1e-05
WP_003567726.1|2753913_2754564_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	2.8e-17
