The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021738	Mannheimia haemolytica D171, complete sequence	2501382	359319	411867	2501382	integrase,plate,terminase,head,holin	Mannheimia_phage(46.15%)	68	361894:361913	412019:412038
WP_006252023.1|359319_359784_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|359776_360400_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_020824101.1|360400_363340_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.5	0.0e+00
361894:361913	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|363412_364033_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|364029_365226_-|plate	baseplate J/gp47 family protein	plate	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|365222_365573_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|365576_366239_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|366228_367116_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|367115_367412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|367414_368122_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|368356_369253_-	ORF6C domain-containing protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|369537_369717_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|369868_370540_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|370562_371225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|371224_373894_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_006252675.1|373893_374040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824108.1|374066_374471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|374538_375060_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|375194_375638_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|375695_377174_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|377189_377696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|377680_378061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|378068_378773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|379376_379808_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|379810_380185_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|380254_381385_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|381396_381906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|381917_383174_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252680.1|384412_385243_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|385217_386729_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|386796_388176_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|388178_388676_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_020824118.1|389065_389299_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	89.2	3.2e-32
WP_020824119.1|389264_389594_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	93.6	3.2e-22
WP_020824120.1|389594_390191_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_165876904.1|390205_390565_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.5e-12
WP_006251969.1|390700_391174_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|391163_391733_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|391805_392267_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_020824124.1|392287_392860_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.8e-106
WP_020824125.1|392870_393917_-	conserved phage C-terminal domain-containing protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|393913_394753_-	Rha family transcriptional regulator	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|394815_395259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|395307_395502_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|395598_396258_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|396257_397097_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|397113_397941_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_020824126.1|397956_398292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|398339_398798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|398954_399251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|399716_399968_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|399970_400246_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|400923_401439_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|401705_402416_+	Bro-N domain-containing protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_020824128.1|402522_403029_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006252960.1|403032_403392_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_020824129.1|403388_403868_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	95.0	3.1e-74
WP_020824130.1|404001_404214_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|404226_405150_+	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|405142_405805_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|405845_406112_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|406139_406592_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|406690_406909_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_020824132.1|408792_409635_+	ORF6C domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_006247825.1|409886_410063_+	hypothetical protein	NA	A0A0M3LR16	Mannheimia_phage	100.0	2.8e-25
WP_020824134.1|410150_410534_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|410583_410805_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|410826_411867_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
412019:412038	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 2
NC_021738	Mannheimia haemolytica D171, complete sequence	2501382	854337	918617	2501382	integrase,tail,protease,tRNA,terminase,portal,transposase,holin	Mannheimia_phage(57.45%)	76	856210:856227	916604:916621
WP_020824044.1|854337_855378_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247810.1|855450_855750_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|855721_856111_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
856210:856227	attL	CTACAAGCGGTCTTTTTT	NA	NA	NA	NA
WP_006247812.1|856254_856548_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247809.1|857972_858131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824195.1|858140_865274_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.4	0.0e+00
WP_020824196.1|865276_865867_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_020824197.1|866135_866867_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|866870_867587_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|867586_867916_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|867915_871467_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|871520_871748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|871810_872041_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|872085_872487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|872569_873211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|873238_873631_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|873627_874152_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|874155_874458_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|874450_874774_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_158497199.1|874786_874948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824209.1|875026_876988_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|877391_878588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|878591_880103_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|880102_880327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824212.1|880323_882435_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|882434_882914_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_020824118.1|883183_883417_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	89.2	3.2e-32
WP_020824214.1|883382_883712_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|883712_884306_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_020824216.1|884295_884649_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	99.1	1.1e-60
WP_006250096.1|884791_884962_-	hypothetical protein	NA	A0A0M3LPX3	Mannheimia_phage	100.0	4.6e-25
WP_006251707.1|884987_885173_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|885681_885876_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|885843_886284_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|886273_886633_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|886625_887654_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_020824220.1|887780_888374_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	82.1	1.7e-93
WP_020824125.1|888384_889431_-	conserved phage C-terminal domain-containing protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|889427_890267_-	Rha family transcriptional regulator	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|890442_890703_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|890723_890924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|891054_891738_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|891812_892193_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006252741.1|892197_892683_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.8e-44
WP_006250075.1|892813_892996_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|893034_893454_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|893520_893826_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|893834_894110_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|894399_894630_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|895108_895432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|895624_895810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824223.1|895793_895958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|895963_896422_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|896457_896817_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|896888_897692_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|897785_898220_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|898229_898718_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|898738_898948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|899094_899220_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|899266_900109_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|900171_900555_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|900604_900880_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|900839_901895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|902042_903305_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
WP_006249906.1|903580_903802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252134.1|903889_904921_-	methionine synthase	NA	NA	NA	NA	NA
WP_006252133.1|905008_905986_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_006252132.1|906124_907009_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_006249901.1|908232_909045_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_006252130.1|909089_910943_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006252129.1|911128_912715_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_006252128.1|912775_913570_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_006252127.1|913560_914319_-	biotin ligase	NA	NA	NA	NA	NA
WP_006252126.1|914399_914966_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_020824230.1|915169_916519_+	MFS transporter	NA	NA	NA	NA	NA
WP_006252121.1|916685_918617_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.8e-128
916604:916621	attR	AAAAAAGACCGCTTGTAG	NA	NA	NA	NA
>prophage 3
NC_021738	Mannheimia haemolytica D171, complete sequence	2501382	2167781	2216611	2501382	capsid,tail,protease,plate,transposase,terminase,head	Mannheimia_phage(81.63%)	62	NA	NA
WP_020831168.1|2167781_2168822_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	94.5	4.7e-192
WP_051138299.1|2168945_2169506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|2169486_2171418_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|2171560_2171743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|2171892_2172933_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|2172932_2173406_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|2173395_2174604_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|2174866_2176099_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|2176165_2177152_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|2177192_2177603_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|2177668_2178979_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|2179393_2180113_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|2180289_2180568_+	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|2182494_2183376_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|2183386_2183635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|2183644_2183965_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|2183967_2184159_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|2184171_2184789_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|2185107_2185320_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|2185325_2185508_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|2185530_2186106_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|2186118_2186487_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251271.1|2186558_2186729_+	hypothetical protein	NA	A0A0M3LPZ3	Mannheimia_phage	92.9	4.2e-26
WP_006251272.1|2186728_2187283_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|2187266_2187689_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|2188044_2188644_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|2188654_2188861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|2188953_2189844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248646.1|2190486_2191020_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|2191022_2191265_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|2191261_2191621_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_006251280.1|2191635_2191791_+	hypothetical protein	NA	A0A0M3LQ02	Mannheimia_phage	96.1	3.7e-21
WP_005606396.1|2191783_2192041_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|2192040_2192295_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|2192302_2192803_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_006251282.1|2192802_2192949_+	hypothetical protein	NA	A0A0M3LQM0	Mannheimia_phage	93.8	5.0e-20
WP_020831198.1|2192952_2194578_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|2194646_2196320_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|2196306_2197596_+|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|2197743_2198160_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|2198156_2198375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|2198418_2199486_+|protease	phage protease	protease	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|2199485_2200403_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|2200448_2200766_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|2200765_2201191_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|2201187_2201829_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|2201829_2202009_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|2202008_2203418_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|2203428_2203803_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|2203802_2204171_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|2204200_2204389_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|2204441_2206721_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|2206720_2208013_+	DNA circularization protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|2208015_2209143_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006253023.1|2209147_2209795_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|2209903_2210254_+	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|2210266_2211328_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|2211327_2211894_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|2211894_2214621_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|2214621_2215245_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|2215237_2215702_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|2215822_2216611_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
>prophage 4
NC_021738	Mannheimia haemolytica D171, complete sequence	2501382	2463765	2470550	2501382		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|2463765_2464548_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|2464557_2465286_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|2465421_2466441_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|2466442_2467045_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|2467173_2467329_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|2467406_2467988_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|2468002_2468650_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|2468753_2469383_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|2469497_2470550_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
