The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	0	4075	4977480		Bacillus_phage(33.33%)	6	NA	NA
WP_001114516.1|28_838_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.8	1.0e-24
WP_001051798.1|935_1103_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001519051.1|1123_1360_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_000380129.1|1577_2243_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050176.1|2418_3639_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	5.5e-43
WP_000976078.1|3616_4075_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
>prophage 2
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	10053	15079	4977480		Sphingobium_phage(33.33%)	4	NA	NA
WP_020837859.1|10053_11739_-	NAD-dependent DNA ligase LigB	NA	A0A1W6DX16	Sphingobium_phage	22.8	1.4e-20
WP_000046966.1|11995_12619_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
WP_000135058.1|12673_12949_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280481.1|12967_15079_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 3
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	19328	20720	4977480		environmental_Halophage(100.0%)	1	NA	NA
WP_000115428.1|19328_20720_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 4
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	29061	31914	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_020837866.1|29061_31914_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.8	5.9e-96
>prophage 5
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	35826	41847	4977480	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000131292.1|35826_38553_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.6e-34
WP_000392698.1|38771_39467_-	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
WP_000535970.1|39972_40875_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000749530.1|40917_41847_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.2	4.6e-66
>prophage 6
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	50211	51594	4977480		Pandoravirus(100.0%)	1	NA	NA
WP_020837871.1|50211_51594_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	2.0e-41
>prophage 7
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	64532	69489	4977480		Micromonas_pusilla_virus(50.0%)	5	NA	NA
WP_000168438.1|64532_66221_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	3.2e-57
WP_001541152.1|66327_66426_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000117642.1|67059_67149_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001531658.1|67241_68102_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000828744.1|68304_69489_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	2.2e-12
>prophage 8
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	77992	78944	4977480		Synechococcus_phage(50.0%)	2	NA	NA
WP_001246919.1|77992_78421_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
WP_001532742.1|78530_78944_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
>prophage 9
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	86587	100398	4977480		Staphylococcus_phage(20.0%)	10	NA	NA
WP_023253115.1|86587_87205_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.1e-10
WP_020837888.1|87210_88611_-	heme-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020837889.1|88800_89433_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_020837890.1|89425_91978_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	3.7e-73
WP_001230254.1|91967_93152_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001562512.1|93281_93974_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
WP_001202038.1|93946_94987_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_020837891.1|95066_97802_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.8	8.6e-36
WP_000253524.1|97827_99165_-	MFS transporter	NA	NA	NA	NA	NA
WP_000704735.1|99249_100398_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
>prophage 10
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	105246	115037	4977480		Oenococcus_phage(25.0%)	9	NA	NA
WP_001589928.1|105246_106440_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	1.2e-47
WP_001054596.1|106554_107451_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072047.1|107469_109884_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
WP_000060081.1|109912_110986_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673474.1|111133_112234_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000059093.1|112238_113639_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|114299_114440_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239725.1|114456_114816_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|114779_115037_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 11
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	122030	129781	4977480		Moraxella_phage(33.33%)	8	NA	NA
WP_020837893.1|122030_123368_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.1e-63
WP_023182397.1|123573_124383_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_020837895.1|124395_125061_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000377800.1|125155_125881_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063118.1|125895_126669_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
WP_000212197.1|126755_127646_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741630.1|127645_128605_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867131.1|128740_129781_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.9	1.2e-46
>prophage 12
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	134188	137577	4977480		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334059.1|134188_136018_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.2e-129
WP_001525665.1|136206_137577_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	3.3e-36
>prophage 13
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	150461	151454	4977480		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845123.1|150461_151454_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 14
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	154747	158765	4977480		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000102338.1|154747_156616_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
WP_000715944.1|156832_157252_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_023253543.1|157259_158765_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
>prophage 15
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	174059	175706	4977480		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012554.1|174059_175706_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
>prophage 16
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	181066	181408	4977480		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000560822.1|181066_181408_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 17
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	185979	192210	4977480		Vibrio_phage(25.0%)	5	NA	NA
WP_020838007.1|185979_186708_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	31.2	2.7e-21
WP_001238842.1|186807_188832_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
WP_001089447.1|188871_190353_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047524.1|190471_191737_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
WP_001280776.1|191880_192210_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 18
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	196344	202505	4977480		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866676.1|196344_197475_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	1.8e-27
WP_000011236.1|197471_198734_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.6e-24
WP_000822142.1|198733_199801_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.2e-97
WP_000676077.1|199833_200715_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	1.3e-107
WP_001145154.1|200692_201370_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_020838090.1|201374_202505_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 19
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	221502	225418	4977480		Bacillus_phage(100.0%)	3	NA	NA
WP_000132877.1|221502_222405_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	7.7e-26
WP_001213560.1|222404_223121_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383436.1|223255_225418_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
>prophage 20
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	230290	232120	4977480		Catovirus(100.0%)	1	NA	NA
WP_001533487.1|230290_232120_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.6e-81
>prophage 21
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	246363	249798	4977480		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187559.1|246363_248004_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
WP_000508972.1|248209_248464_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459612.1|248467_249016_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000257554.1|249018_249798_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
>prophage 22
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	260725	261340	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378904.1|260725_261340_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	1.1e-18
>prophage 23
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	273683	276470	4977480		Enterococcus_phage(100.0%)	1	NA	NA
WP_000249972.1|273683_276470_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 24
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	281827	282877	4977480		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000146190.1|281827_282877_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	7.6e-09
>prophage 25
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	302470	305265	4977480		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000268248.1|302470_303367_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
WP_001520529.1|303531_304428_+	sugar kinase	NA	NA	NA	NA	NA
WP_000059693.1|304461_305265_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
>prophage 26
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	308354	309269	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_020838183.1|308354_309269_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	55.8	2.1e-07
>prophage 27
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	312608	315659	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_077909673.1|312608_315659_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
>prophage 28
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	334390	338617	4977480		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
WP_000122632.1|334390_335011_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559225.1|335080_335770_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|335781_336177_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338672.1|336297_336501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|336548_337922_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|337918_338617_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 29
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	355033	359644	4977480		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084285.1|355033_355879_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|356277_356517_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|356738_357224_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|357316_358246_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|358312_359644_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
>prophage 30
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	382991	386166	4977480		Synechococcus_phage(50.0%)	2	NA	NA
WP_000424866.1|382991_383654_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
WP_020838267.1|383664_386166_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
>prophage 31
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	407305	409150	4977480		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591403.1|407305_409150_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 32
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	417803	420897	4977480		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000023068.1|417803_418754_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
WP_001541267.1|418962_419136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031748.1|419712_420897_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 33
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	425017	435471	4977480		Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000263105.1|425017_429046_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653965.1|429122_433346_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_023888286.1|433387_433714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020838414.1|434442_435471_+	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.9	1.8e-103
>prophage 34
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	443888	445651	4977480		Klosneuvirus(50.0%)	3	NA	NA
WP_000362359.1|443888_444560_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
WP_000940092.1|444601_445192_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|445378_445651_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 35
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	451135	452725	4977480		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_020838423.1|451135_452725_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	7.1e-67
>prophage 36
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	467544	471228	4977480		Dickeya_phage(100.0%)	1	NA	NA
WP_020838426.1|467544_471228_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 37
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	477123	578320	4977480	integrase,tRNA,lysis,capsid,terminase,protease,plate,tail	Salmonella_phage(53.54%)	134	526229:526245	582821:582837
WP_000587738.1|477123_477852_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_024142925.1|478430_478847_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_017465885.1|479227_479683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023888617.1|479679_480234_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_020838432.1|480238_481984_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	6.4e-53
WP_020838433.1|481986_482619_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	2.5e-23
WP_020838434.1|482611_483727_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	9.0e-101
WP_001093501.1|483717_484077_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095010.1|484240_485788_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703634.1|485787_486717_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593182.1|486713_487076_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679393.1|487402_488125_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_020838438.1|488134_489178_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|489165_489375_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020838439.1|489374_490328_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_020838441.1|490327_492694_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.9	1.3e-69
WP_001185654.1|492790_492919_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|492878_493196_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|493247_493772_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_020838443.1|493771_495199_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	4.0e-194
WP_020838445.1|495188_495386_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|495382_495838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|495997_496312_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_020838446.1|496324_496930_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_001226439.1|496932_497220_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|497796_498144_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136394.1|498274_499624_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790025.1|499968_501618_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|502061_502304_+	outer membrane protein	NA	NA	NA	NA	NA
WP_023888164.1|502337_503006_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977889.1|503002_503740_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750805.1|503739_505836_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982752.1|505978_506389_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252081.1|506554_507445_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_020838454.1|507459_509004_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|509135_510326_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|510687_511797_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973644.1|511885_513244_+	maltoporin	NA	NA	NA	NA	NA
WP_020838457.1|513407_514325_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019219.1|514504_515002_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|515015_515888_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|515986_518407_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|518577_518946_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|519054_519663_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_020838465.1|519841_521167_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_010989093.1|521163_521277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|521298_521508_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|521606_522122_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039335.1|522368_523679_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_020838468.1|523986_524520_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	84.7	8.7e-86
WP_020838469.1|524715_524889_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	1.7e-22
WP_020838472.1|524953_525226_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	89.8	1.2e-38
WP_020838474.1|525264_525837_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.1	3.0e-92
526229:526245	attL	CGGTTCCGGCGCTGGCG	NA	NA	NA	NA
WP_020838478.1|526518_526758_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	65.4	2.2e-20
WP_020838479.1|526757_527291_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	94.3	4.6e-95
WP_020838481.1|527319_527553_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	1.6e-12
WP_020838482.1|527549_528140_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	68.7	1.9e-65
WP_001214770.1|528136_528307_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_001111322.1|528317_528611_-	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_001016189.1|528626_529175_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.9	6.6e-105
WP_000168281.1|529183_529690_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	100.0	1.0e-91
WP_020838484.1|529690_530398_-	recombinase	NA	E7C9Q0	Salmonella_phage	97.4	3.8e-137
WP_000361564.1|530591_530705_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001541875.1|530697_530844_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	1.3e-20
WP_020838489.1|531072_531573_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	43.2	9.8e-31
WP_020838490.1|531656_531851_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	98.4	6.0e-29
WP_000216184.1|531929_532265_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	86.9	5.0e-47
WP_125866875.1|532285_532468_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	96.7	6.3e-28
WP_020838491.1|532859_533204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024142926.1|533244_534108_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	63.2	2.6e-95
WP_020838493.1|534197_534830_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.4	1.3e-32
WP_020838494.1|534928_535147_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	67.6	4.9e-19
WP_020838495.1|535258_535540_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	84.9	2.3e-37
WP_020838496.1|535574_536312_+	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	31.4	2.8e-10
WP_020838497.1|536311_537190_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	62.3	1.9e-90
WP_020838498.1|537192_538035_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.9e-107
WP_024142930.1|538271_538733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020838500.1|538729_538900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440794.1|538919_539210_+	hypothetical protein	NA	E7C9R6	Salmonella_phage	99.0	1.1e-50
WP_000049339.1|539212_539509_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	100.0	1.1e-48
WP_000811304.1|539465_539912_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	100.0	3.2e-81
WP_000679702.1|539908_540082_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113771.1|540048_540231_+	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_020838506.1|540227_540407_+	NinF family protein	NA	I6R994	Salmonella_phage	93.2	8.9e-27
WP_001531202.1|540381_540990_+	recombination protein NinG	NA	I6S604	Salmonella_phage	95.0	6.4e-93
WP_000188966.1|540986_541190_+	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
WP_000219139.1|541170_541350_+	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	98.3	2.7e-23
WP_020838507.1|541346_542111_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	98.0	4.7e-141
WP_000947857.1|542393_542912_+	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
WP_000781414.1|543135_543408_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
WP_001089360.1|543407_543905_+	lysozyme	NA	A5LH83	Enterobacteria_phage	93.3	1.5e-87
WP_023253534.1|543993_544461_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	88.4	1.9e-68
WP_001530409.1|544670_545168_+	KilA-N domain-containing protein	NA	A0A1V0E5R9	Salmonella_phage	100.0	1.4e-93
WP_001283924.1|545164_545422_+	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_020838509.1|545816_546248_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	99.3	4.9e-71
WP_000445802.1|546231_547551_+|terminase	terminase	terminase	H6WRS9	Salmonella_phage	100.0	1.9e-262
WP_020838511.1|547683_549036_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.6	1.3e-258
WP_020838512.1|548989_549949_+|capsid	minor capsid protein	capsid	H6WRT1	Salmonella_phage	99.7	4.6e-178
WP_020838513.1|549964_551230_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	95.0	9.2e-227
WP_020838514.1|551242_551704_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
WP_020838515.1|551716_552814_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.4	1.1e-180
WP_020838516.1|552824_553109_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	75.3	1.7e-32
WP_020838517.1|553170_553377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020838519.1|553379_553781_+	hypothetical protein	NA	I6S619	Salmonella_phage	75.9	1.0e-54
WP_020838521.1|553780_553960_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
WP_020838522.1|553952_554315_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	92.5	2.4e-63
WP_020838523.1|554322_554760_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	99.3	1.0e-76
WP_020838524.1|554756_555143_+	hypothetical protein	NA	I6R9A6	Salmonella_phage	99.2	2.7e-68
WP_020838525.1|555158_555704_+	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	46.3	3.6e-34
WP_020838526.1|555708_556449_+	immunoglobulin domain-containing protein	NA	H6WRU1	Salmonella_phage	96.7	2.0e-128
WP_020838527.1|556493_557147_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.2	4.3e-119
WP_020838528.1|557330_557861_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	99.4	7.3e-93
WP_020838529.1|557975_558350_+	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	99.2	4.1e-66
WP_024132274.1|558423_558720_+	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	100.0	8.6e-43
WP_020838531.1|558802_559156_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	97.4	7.9e-59
WP_020838532.1|559253_559550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020838533.1|559610_562763_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	66.6	7.0e-300
WP_001650218.1|562762_563110_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	96.5	6.3e-61
WP_016062819.1|563120_563327_+	hypothetical protein	NA	H6WRV9	Salmonella_phage	100.0	5.3e-31
WP_001650217.1|563295_563511_-	hypothetical protein	NA	H6WRW0	Salmonella_phage	100.0	2.1e-30
WP_006754904.1|563676_564381_+|tail	phage minor tail protein L	tail	H6WRW1	Salmonella_phage	100.0	8.4e-137
WP_020838539.1|564380_565100_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	93.3	3.9e-137
WP_020838540.1|565042_565570_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	95.2	1.7e-65
WP_020838541.1|565579_568750_+	host specificity protein J	NA	A0A1V0E5M1	Salmonella_phage	96.3	0.0e+00
WP_020898865.1|568758_569718_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
WP_020838543.1|569727_571065_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.8	3.4e-110
WP_003840850.1|571199_571442_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_020838546.1|571520_571910_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	73.6	9.3e-53
WP_020838547.1|571941_573036_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	84.8	4.8e-179
WP_020838548.1|573123_574161_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|574328_574571_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235550.1|574745_575729_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|575793_577209_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_020838550.1|577240_578320_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.8	2.0e-28
582821:582837	attR	CGCCAGCGCCGGAACCG	NA	NA	NA	NA
>prophage 38
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	582415	586019	4977480		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357725.1|582415_585241_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_000168322.1|585488_586019_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
>prophage 39
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	608400	610467	4977480		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_020838556.1|608400_610467_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	24.1	4.8e-15
>prophage 40
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	615352	616702	4977480		Moraxella_phage(100.0%)	1	NA	NA
WP_000106907.1|615352_616702_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 41
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	622920	624879	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000083877.1|622920_624879_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 42
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	634572	642943	4977480		Escherichia_phage(25.0%)	8	NA	NA
WP_011233236.1|634572_636720_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
WP_000457029.1|637085_637994_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	5.9e-34
WP_000602319.1|638251_638716_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_001131305.1|638837_639281_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_000056482.1|639400_639736_-	phnA family protein	NA	NA	NA	NA	NA
WP_000919710.1|640203_641706_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
WP_000844399.1|641775_641865_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_001212189.1|641872_642943_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
>prophage 43
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	663574	665635	4977480		Escherichia_phage(100.0%)	3	NA	NA
WP_000816143.1|663574_664201_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
WP_020838567.1|664193_664967_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	79.1	1.3e-103
WP_001112219.1|664981_665635_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	73.0	2.7e-81
>prophage 44
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	691057	692614	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_020838584.1|691057_692614_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	8.4e-105
>prophage 45
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	699809	704801	4977480	integrase	Pseudomonas_phage(50.0%)	4	698195:698207	712306:712318
698195:698207	attL	TCTTTTTCAAGCT	NA	NA	NA	NA
WP_024142936.1|699809_701132_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	31.3	6.9e-23
WP_077909675.1|701204_703136_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_020838595.1|703211_703562_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_020838596.1|703613_704801_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
712306:712318	attR	TCTTTTTCAAGCT	NA	NA	NA	NA
>prophage 46
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	714689	716673	4977480		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|714689_714983_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_000729126.1|715026_716673_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
>prophage 47
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	721748	722282	4977480		Morganella_phage(100.0%)	1	NA	NA
WP_020838610.1|721748_722282_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.4	7.2e-48
>prophage 48
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	726008	726986	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000004794.1|726008_726986_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 49
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	734710	735256	4977480		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001271546.1|734710_735256_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 50
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	740276	743465	4977480		Vibrio_phage(50.0%)	2	NA	NA
WP_020838619.1|740276_741599_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_020838621.1|741608_743465_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	3.4e-60
>prophage 51
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	749010	753430	4977480		Pithovirus(50.0%)	3	NA	NA
WP_020838622.1|749010_750309_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	6.4e-66
WP_001177632.1|750528_750954_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076357.1|750991_753430_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
>prophage 52
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	758293	759457	4977480		Ralstonia_phage(100.0%)	1	NA	NA
WP_020838626.1|758293_759457_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.5e-82
>prophage 53
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	794666	796422	4977480		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000055079.1|794666_795197_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_000853764.1|795423_796422_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 54
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	831377	835936	4977480	transposase	uncultured_Caudovirales_phage(25.0%)	4	NA	NA
WP_000212724.1|831377_831620_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
WP_115399553.1|831749_833005_-|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	30.3	1.7e-18
WP_020898293.1|833212_833677_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	4.6e-51
WP_000187818.1|833797_835936_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
>prophage 55
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	839602	846151	4977480	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
WP_001181297.1|839602_840550_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
WP_105789234.1|840694_840793_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_020898295.1|840933_843642_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.8	4.5e-45
WP_000252550.1|843757_844204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|844278_844665_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148567.1|844741_845203_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|845215_846151_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
>prophage 56
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	858257	863204	4977480	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_020898298.1|858257_861113_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.0e-140
WP_001523689.1|861112_861556_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|861692_863204_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
>prophage 57
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	871035	873830	4977480	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	860076:860090	878553:878567
860076:860090	attL	AGCAACGACTGCTTT	NA	NA	NA	NA
WP_000152563.1|871035_872055_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
WP_020898299.1|872561_873830_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.8	1.5e-80
878553:878567	attR	AAAGCAGTCGTTGCT	NA	NA	NA	NA
>prophage 58
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	880159	886375	4977480		Liberibacter_phage(50.0%)	3	NA	NA
WP_020898304.1|880159_883291_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.7	7.0e-74
WP_020898305.1|883290_884676_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_020898306.1|884665_886375_-	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	25.6	5.4e-12
>prophage 59
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	897001	897820	4977480		Yersinia_phage(100.0%)	1	NA	NA
WP_020898319.1|897001_897820_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	7.4e-44
>prophage 60
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	923894	924860	4977480	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000749991.1|923894_924860_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	8.2e-66
>prophage 61
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	933511	935173	4977480		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919511.1|933511_935173_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 62
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	940905	941967	4977480		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_020898341.1|940905_941967_+	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.8	1.2e-09
>prophage 63
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	946221	947501	4977480		Shigella_phage(50.0%)	2	NA	NA
WP_000799924.1|946221_946959_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
WP_000098573.1|946961_947501_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
>prophage 64
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	952475	953540	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_000211207.1|952475_953540_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 65
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	957318	960217	4977480		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175965.1|957318_958908_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
WP_000178963.1|959309_959927_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490276.1|960055_960217_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
>prophage 66
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	965764	967087	4977480		Geobacillus_virus(100.0%)	1	NA	NA
WP_020898346.1|965764_967087_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.4e-79
>prophage 67
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	979237	984401	4977480		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093829.1|979237_980470_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	6.7e-89
WP_000046770.1|980587_982255_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
WP_020898350.1|982463_984401_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.4e-11
>prophage 68
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	988350	989775	4977480		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001219523.1|988350_989775_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	7.9e-09
>prophage 69
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1008526	1020830	4977480	holin	Cyanophage(20.0%)	12	NA	NA
WP_000130175.1|1008526_1009480_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
WP_000380373.1|1009590_1010181_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_020898352.1|1010237_1010804_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001103477.1|1010953_1011667_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_020898353.1|1011702_1012107_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516126.1|1012455_1014372_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
WP_001119009.1|1014457_1015597_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
WP_000534911.1|1015877_1016825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000026889.1|1016951_1017296_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001068132.1|1017356_1017890_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
WP_000860681.1|1017906_1018350_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020898354.1|1018730_1020830_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.7	3.6e-34
>prophage 70
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1036549	1038043	4977480		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000754366.1|1036549_1038043_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	29.3	1.5e-29
>prophage 71
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1041301	1042468	4977480		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000681340.1|1041301_1042468_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 72
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1048966	1051801	4977480	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001674865.1|1048966_1051801_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 73
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1070808	1071957	4977480		Halovirus(100.0%)	1	NA	NA
WP_000597280.1|1070808_1071957_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	3.4e-50
>prophage 74
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1077494	1083134	4977480		Hepacivirus(50.0%)	4	NA	NA
WP_020898367.1|1077494_1079048_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	2.6e-29
WP_001016213.1|1079110_1080328_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347134.1|1080439_1081582_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_020898368.1|1081616_1083134_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.4	1.1e-08
>prophage 75
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1090889	1092779	4977480		Catovirus(100.0%)	1	NA	NA
WP_000066316.1|1090889_1092779_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 76
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1095916	1097360	4977480		Bacillus_phage(50.0%)	2	NA	NA
WP_000624379.1|1095916_1096396_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
WP_000257211.1|1096511_1097360_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
>prophage 77
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1105089	1110521	4977480		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_020898372.1|1105089_1107996_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	4.9e-21
WP_020898373.1|1108169_1110521_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	1.6e-14
>prophage 78
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1118296	1119004	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_000915962.1|1118296_1119004_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	1.4e-22
>prophage 79
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1127053	1128625	4977480		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082819.1|1127053_1128625_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 80
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1160665	1161709	4977480		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217365.1|1160665_1161709_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 81
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1165966	1166530	4977480		Sphingobium_phage(100.0%)	1	NA	NA
WP_020898386.1|1165966_1166530_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.8	4.4e-11
>prophage 82
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1177767	1179192	4977480		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001519338.1|1177767_1179192_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 83
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1195371	1205075	4977480		Escherichia_phage(25.0%)	9	NA	NA
WP_000678254.1|1195371_1196139_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
WP_000734276.1|1196168_1196963_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000829968.1|1196983_1197844_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000846613.1|1197950_1198298_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000946047.1|1198499_1200110_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
WP_000829732.1|1200187_1202578_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683342.1|1202783_1203320_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_000651590.1|1203377_1204040_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150628.1|1204148_1205075_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
>prophage 84
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1223092	1224511	4977480		unidentified_phage(100.0%)	1	NA	NA
WP_020898403.1|1223092_1224511_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.1e-26
>prophage 85
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1227574	1230004	4977480		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_023252167.1|1227574_1230004_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	5.5e-34
>prophage 86
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1235251	1236049	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_020898407.1|1235251_1236049_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	2.1e-14
>prophage 87
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1249431	1249776	4977480		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|1249431_1249776_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 88
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1253759	1259585	4977480	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000753961.1|1253759_1255187_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_000929420.1|1255339_1256497_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_020898413.1|1256615_1259585_-	viral enhancing factor	NA	A0A288QW20	Cyclophragma_undans_nucleopolyhedrovirus	25.8	5.3e-47
>prophage 89
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1271809	1272568	4977480		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000947413.1|1271809_1272568_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 90
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1281379	1285482	4977480		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569411.1|1281379_1281976_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	4.3e-25
WP_001294835.1|1281999_1285482_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
>prophage 91
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1299469	1300501	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_020898418.1|1299469_1300501_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 92
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1307412	1308216	4977480		Indivirus(100.0%)	1	NA	NA
WP_000154866.1|1307412_1308216_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	7.1e-39
>prophage 93
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1312266	1316477	4977480		Lactobacillus_phage(33.33%)	5	NA	NA
WP_000644706.1|1312266_1313634_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052773.1|1313705_1314461_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_020898420.1|1314495_1315218_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|1315214_1315682_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|1315745_1316477_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
>prophage 94
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1323536	1326176	4977480		Vibrio_phage(100.0%)	1	NA	NA
WP_000449790.1|1323536_1326176_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	35.7	2.3e-78
>prophage 95
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1380332	1380911	4977480		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284051.1|1380332_1380911_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 96
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1384125	1385265	4977480		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528901.1|1384125_1385265_+	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.8	7.7e-31
>prophage 97
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1390038	1394369	4977480		Enterobacteria_phage(50.0%)	4	NA	NA
WP_020898447.1|1390038_1391091_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-113
WP_001285275.1|1391373_1392477_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_020898448.1|1392488_1393739_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.0e-97
WP_023252600.1|1394093_1394369_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	3.2e-23
>prophage 98
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1402729	1403002	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_023193128.1|1402729_1403002_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 99
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1415552	1416077	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_000830237.1|1415552_1416077_+	Ail/Lom family outer membrane beta-barrel protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 100
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1423724	1433436	4977480		Streptococcus_phage(33.33%)	6	NA	NA
WP_000083323.1|1423724_1426013_+	gold/copper-translocating P-type ATPase GolT	NA	E4ZFI9	Streptococcus_phage	33.3	2.1e-91
WP_001020584.1|1426024_1426489_+	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
WP_001159470.1|1426566_1426761_+	gold resistance metallochaperone GolB	NA	NA	NA	NA	NA
WP_000288503.1|1427053_1428307_+	MFS transporter	NA	NA	NA	NA	NA
WP_020898459.1|1428495_1430454_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.4	7.4e-82
WP_077909682.1|1430463_1433436_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	9.2e-84
>prophage 101
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1446865	1448752	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_020898465.1|1446865_1448752_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	7.0e-53
>prophage 102
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1463259	1464372	4977480		Bacillus_phage(100.0%)	1	NA	NA
WP_000484097.1|1463259_1464372_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 103
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1468059	1477978	4977480		Bacillus_phage(60.0%)	7	NA	NA
WP_000964305.1|1468059_1468971_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
WP_001219276.1|1469096_1470005_+	fructokinase	NA	NA	NA	NA	NA
WP_020898468.1|1470024_1471197_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_020898469.1|1471369_1474510_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
WP_020898470.1|1474506_1475709_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	1.3e-07
WP_000113921.1|1475923_1476613_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_000893633.1|1476682_1477978_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	1.5e-27
>prophage 104
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1485949	1490289	4977480	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000667305.1|1485949_1487077_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
WP_000007628.1|1487099_1487432_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
WP_000934811.1|1487459_1489307_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046629.1|1489317_1490289_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
>prophage 105
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1494969	1496632	4977480		Indivirus(50.0%)	2	NA	NA
WP_020898475.1|1494969_1496073_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
WP_001021372.1|1496161_1496632_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
>prophage 106
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1506151	1507261	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_020898477.1|1506151_1507261_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 107
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1528289	1533457	4977480	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122257.1|1528289_1528913_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130314.1|1529164_1530436_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
WP_001067723.1|1530621_1532976_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
WP_001043544.1|1533184_1533457_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 108
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1536751	1537447	4977480		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817210.1|1536751_1537447_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	3.5e-87
>prophage 109
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1541846	1545393	4977480		Bacillus_phage(100.0%)	2	NA	NA
WP_001235560.1|1541846_1543619_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
WP_020898484.1|1543611_1545393_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.2e-39
>prophage 110
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1563010	1574041	4977480	transposase	Sodalis_phage(20.0%)	12	NA	NA
WP_000440526.1|1563010_1563946_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.2e-63
WP_000051161.1|1564015_1564183_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_001519637.1|1564196_1564724_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_020898485.1|1564792_1565170_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_020898486.1|1565322_1565874_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
WP_000121967.1|1565986_1567915_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000467098.1|1567960_1568290_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195023.1|1568289_1568895_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_001523272.1|1569005_1570880_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
WP_001220237.1|1571237_1571882_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250078.1|1572110_1573073_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801786.1|1573069_1574041_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
>prophage 111
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1583141	1588360	4977480		uncultured_virus(50.0%)	5	NA	NA
WP_000083913.1|1583141_1585643_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.2	6.7e-112
WP_001026760.1|1585752_1586169_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020898488.1|1586169_1586622_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000906146.1|1586618_1587536_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000140197.1|1587682_1588360_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	6.6e-22
>prophage 112
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1591635	1592322	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110598.1|1591635_1592322_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
>prophage 113
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1597175	1598192	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_000569660.1|1597175_1598192_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 114
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1602663	1604445	4977480		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001096868.1|1602663_1604445_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 115
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1611895	1613044	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706331.1|1611895_1613044_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	9.1e-48
>prophage 116
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1624316	1628750	4977480	tRNA	Moumouvirus(50.0%)	6	NA	NA
WP_020898493.1|1624316_1625702_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_020898494.1|1625745_1626570_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_001038574.1|1626566_1627004_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_001143507.1|1626996_1627542_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190280.1|1627669_1627882_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|1627883_1628750_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
>prophage 117
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1638829	1648250	4977480	integrase	Salmonella_phage(60.0%)	7	1638772:1638816	1644585:1644629
1638772:1638816	attL	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_020898499.1|1638829_1639993_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	96.9	2.2e-222
WP_020898503.1|1641593_1643018_-	glucosyltransferase domain-containing protein	NA	F1C5A9	Cronobacter_phage	26.5	1.1e-29
WP_020898504.1|1643014_1643932_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	93.4	3.4e-162
WP_000915523.1|1643928_1644291_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_020898505.1|1644715_1644925_-	hypothetical protein	NA	NA	NA	NA	NA
1644585:1644629	attR	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_020898507.1|1645854_1646709_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_020898508.1|1646924_1648250_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	6.7e-103
>prophage 118
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1672051	1678169	4977480		Tupanvirus(50.0%)	3	NA	NA
WP_020898519.1|1672051_1675936_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	8.4e-61
WP_020898520.1|1676185_1677322_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140622.1|1677374_1678169_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.9e-08
>prophage 119
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1692640	1694466	4977480		uncultured_marine_virus(50.0%)	2	NA	NA
WP_023888511.1|1692640_1693258_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.8	5.1e-53
WP_000118142.1|1693230_1694466_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.3e-60
>prophage 120
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1697842	1704390	4977480		Bacillus_virus(33.33%)	6	NA	NA
WP_000887644.1|1697842_1699408_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
WP_020898527.1|1699740_1700301_+	molecular chaperone	NA	NA	NA	NA	NA
WP_000064317.1|1700293_1702573_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.5	5.8e-46
WP_001250381.1|1702569_1703127_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000417102.1|1703126_1703894_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_000278499.1|1703961_1704390_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
>prophage 121
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1719504	1720155	4977480		Morganella_phage(50.0%)	2	NA	NA
WP_000034826.1|1719504_1719714_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
WP_000939753.1|1719771_1720155_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
>prophage 122
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1724990	1727475	4977480		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000858711.1|1724990_1726202_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
WP_020898537.1|1726341_1727475_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 123
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1735702	1738285	4977480	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157916.1|1735702_1738285_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.7	5.6e-186
>prophage 124
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1749101	1753904	4977480		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000368031.1|1749101_1750781_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.1	1.0e-76
WP_020898546.1|1750856_1752095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001207422.1|1752126_1753062_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631369.1|1753178_1753904_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
>prophage 125
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1759804	1760851	4977480		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018045.1|1759804_1760851_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 126
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1765506	1767171	4977480		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_020898549.1|1765506_1767171_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.4	1.4e-86
>prophage 127
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1771825	1782037	4977480	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_020898550.1|1771825_1773778_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
WP_001287181.1|1773987_1775655_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
WP_001258803.1|1776315_1777722_+	chitoporin	NA	NA	NA	NA	NA
WP_000722260.1|1777771_1778104_+	lipoprotein	NA	NA	NA	NA	NA
WP_000057014.1|1778152_1779457_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
WP_000811134.1|1779507_1780647_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
WP_000228705.1|1780633_1782037_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	7.8e-09
>prophage 128
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1793119	1793797	4977480		Bacillus_phage(100.0%)	1	NA	NA
WP_000186053.1|1793119_1793797_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 129
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1797067	1804500	4977480		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000088034.1|1797067_1799116_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.4e-27
WP_020898553.1|1799136_1800816_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001670793.1|1800815_1800905_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000401437.1|1801241_1801448_+	YbfA family protein	NA	NA	NA	NA	NA
WP_020898554.1|1801558_1802980_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.5	1.3e-56
WP_001041123.1|1803018_1804500_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
>prophage 130
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1808015	1808807	4977480		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113967.1|1808015_1808807_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 131
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1835258	1838782	4977480		Vibrio_phage(33.33%)	4	NA	NA
WP_001728872.1|1835258_1835978_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.8	1.3e-23
WP_000951250.1|1835974_1836913_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.0e-25
WP_000784380.1|1837023_1837410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109234.1|1837729_1838782_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
>prophage 132
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1842507	1843776	4977480		Oenococcus_phage(100.0%)	1	NA	NA
WP_020898559.1|1842507_1843776_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.6	3.2e-33
>prophage 133
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1849454	1850231	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_001214710.1|1849454_1850231_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 134
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1854539	1862157	4977480		Tupanvirus(33.33%)	8	NA	NA
WP_001265465.1|1854539_1855556_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
WP_000885515.1|1855778_1856687_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_000096931.1|1856857_1858333_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
WP_001147416.1|1858400_1859189_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891513.1|1859317_1859467_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001522982.1|1859633_1860407_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604026.1|1860406_1861096_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_020898563.1|1861098_1862157_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.0e-20
>prophage 135
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1870614	1874043	4977480		Catovirus(50.0%)	3	NA	NA
WP_020898566.1|1870614_1872135_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
WP_000767403.1|1872219_1872696_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_000205502.1|1872753_1874043_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	7.7e-19
>prophage 136
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1880904	1884172	4977480		Phage_Gifsy-2(50.0%)	2	NA	NA
WP_020898568.1|1880904_1883172_+	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	4.1e-15
WP_001246033.1|1883263_1884172_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
>prophage 137
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1895886	1897623	4977480		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_020898573.1|1895886_1897623_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 138
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1902967	1903813	4977480		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_000784292.1|1902967_1903813_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	32.3	1.7e-06
>prophage 139
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1907655	1913337	4977480		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	5	NA	NA
WP_020898577.1|1907655_1909014_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
WP_001218630.1|1909221_1911366_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
WP_020898578.1|1911395_1912370_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000849089.1|1912525_1912786_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146330.1|1913070_1913337_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
>prophage 140
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1916805	1922115	4977480		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569093.1|1916805_1917528_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
WP_001159076.1|1917524_1918184_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000838671.1|1918329_1919076_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100805.1|1919552_1920056_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
WP_001119554.1|1920358_1921246_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000716763.1|1921599_1922115_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
>prophage 141
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1927101	1928694	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000961479.1|1927101_1928694_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 142
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1933189	1935622	4977480		Citrobacter_phage(100.0%)	1	NA	NA
WP_020898582.1|1933189_1935622_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 143
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1939943	1941815	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120589.1|1939943_1941815_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 144
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1949415	1951421	4977480		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000195712.1|1949415_1950618_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
WP_000450103.1|1950662_1951421_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
>prophage 145
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1958992	1968162	4977480		Vibrio_phage(25.0%)	11	NA	NA
WP_000495513.1|1958992_1959256_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
WP_001259137.1|1959425_1959716_+	YbjC family protein	NA	NA	NA	NA	NA
WP_020898587.1|1959699_1960422_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684361.1|1960479_1961382_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
WP_020898588.1|1961478_1961955_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000125770.1|1962303_1963416_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001000698.1|1963503_1964637_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
WP_000105453.1|1964646_1965600_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061629.1|1965596_1966442_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000505788.1|1966515_1966989_+	YbjO family protein	NA	NA	NA	NA	NA
WP_020898589.1|1967031_1968162_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.4	2.4e-24
>prophage 146
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1974961	1977713	4977480		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027186.1|1974961_1975690_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
WP_001270724.1|1975919_1976435_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160725.1|1976562_1976886_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001202293.1|1976882_1977713_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
>prophage 147
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1981302	1983021	4977480		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815313.1|1981302_1983021_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
>prophage 148
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	1989806	1997575	4977480	transposase,protease	Dickeya_phage(16.67%)	6	NA	NA
WP_020898591.1|1989806_1990925_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125894.1|1990921_1992868_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1992997_1993219_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1993542_1993863_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1993893_1996170_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_115399553.1|1996319_1997575_-|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	30.3	1.7e-18
>prophage 149
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2002232	2019025	4977480	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_001202257.1|2002232_2003954_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
WP_001044541.1|2003954_2005721_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_000537406.1|2005834_2006803_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_000228469.1|2007349_2007844_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_024142954.1|2007978_2012058_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.7	2.2e-88
WP_023252214.1|2012200_2012812_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067782.1|2012821_2014165_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	2.8e-80
WP_000886697.1|2014423_2015716_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_020898595.1|2015952_2018397_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	2.4e-223
WP_020898596.1|2018407_2019025_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.5e-76
>prophage 150
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2023319	2028017	4977480		Tetraselmis_virus(100.0%)	3	NA	NA
WP_079843732.1|2023319_2024096_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.6e-22
WP_020898599.1|2024703_2025663_+	type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_001292799.1|2025734_2028017_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
>prophage 151
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2032113	2033202	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_020898600.1|2032113_2033202_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 152
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2038258	2042822	4977480		Bacillus_phage(66.67%)	3	NA	NA
WP_000167332.1|2038258_2038543_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_020898602.1|2038772_2041037_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|2041073_2042822_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
>prophage 153
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2057765	2063524	4977480	tRNA	Rhodobacter_phage(33.33%)	5	NA	NA
WP_000357052.1|2057765_2058314_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2058341_2058989_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462706.1|2059050_2060241_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|2060425_2061517_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|2062123_2063524_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 154
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2068873	2127669	4977480	lysis,capsid,protease,plate,tail	Salmonella_phage(84.91%)	70	NA	NA
WP_020898608.1|2068873_2070166_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	1.1e-251
WP_000065276.1|2070210_2070459_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|2070499_2070739_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_023888893.1|2070781_2071939_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.2	3.0e-216
WP_020898610.1|2071901_2074829_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	97.1	0.0e+00
WP_023252309.1|2074955_2075306_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.8	1.2e-59
WP_020898611.1|2075327_2075486_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_000981510.1|2075782_2076217_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|2076322_2076550_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|2076584_2076905_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001670138.1|2076989_2077973_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800012.1|2077975_2078725_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000113622.1|2078735_2079044_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.9	1.4e-48
WP_023888896.1|2079284_2079575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|2079866_2080100_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_020898613.1|2080514_2081117_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.2e-109
WP_020898614.1|2081325_2081760_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	59.6	1.1e-54
WP_000801757.1|2081756_2081897_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000993186.1|2081893_2082583_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	5.3e-59
WP_020898615.1|2083072_2083261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526513.1|2083463_2083766_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020898616.1|2083743_2084232_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	67.5	2.3e-56
WP_109511103.1|2084252_2084693_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	77.3	1.8e-52
WP_001113128.1|2084918_2085101_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_020898618.1|2085171_2085801_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	86.1	1.1e-90
WP_001130808.1|2085803_2087426_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_020898619.1|2087425_2088895_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.4	5.8e-281
WP_133308169.1|2088779_2089517_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	98.0	1.6e-109
WP_020898621.1|2089531_2090764_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	97.3	1.3e-225
WP_000128058.1|2090768_2091266_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	100.0	3.0e-88
WP_020898622.1|2091277_2092219_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	1.6e-178
WP_001040702.1|2092260_2092629_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_020898623.1|2092594_2093002_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	98.5	1.2e-71
WP_000008737.1|2092998_2093553_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_020898624.1|2093539_2093929_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_020898625.1|2093903_2094470_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	96.2	3.2e-102
WP_001051850.1|2094472_2095624_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	100.0	2.5e-215
WP_020898626.1|2095634_2096075_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	99.3	2.7e-77
WP_000389018.1|2096078_2096531_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	100.0	5.1e-79
WP_020898627.1|2096708_2098718_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	99.4	0.0e+00
WP_020898628.1|2098717_2099293_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	5.3e-97
WP_020898629.1|2099292_2099595_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	98.0	7.9e-52
WP_020898630.1|2099597_2100665_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.0	1.4e-172
WP_020898631.1|2100661_2101009_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.2	1.2e-22
WP_000931859.1|2101092_2101548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898632.1|2101666_2102422_+|plate	baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	92.0	5.0e-127
WP_001270643.1|2102421_2102775_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	2.1e-59
WP_020898633.1|2102775_2103975_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.2	1.5e-213
WP_000049936.1|2103971_2104652_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	8.1e-129
WP_023888900.1|2106048_2106858_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	93.5	3.1e-143
WP_020898635.1|2106861_2107437_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	7.2e-94
WP_020898636.1|2107632_2108370_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_020898637.1|2108582_2108795_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.6	7.6e-25
WP_000364380.1|2108910_2109087_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_020898639.1|2109128_2109440_+	excisionase family DNA-binding protein	NA	F1C5B3	Cronobacter_phage	51.8	3.0e-06
WP_024142956.1|2109462_2109885_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	51.4	2.4e-30
WP_020898641.1|2109933_2110767_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	43.8	3.5e-57
WP_020898642.1|2110888_2111128_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	8.5e-33
WP_020898643.1|2111554_2114167_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000291723.1|2114374_2115385_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2115550_2116093_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_020898644.1|2116089_2117199_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2117297_2119406_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053051.1|2119418_2121326_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
WP_000333152.1|2121340_2122594_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2122598_2124239_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759138.1|2124235_2124799_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2125054_2125222_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2125321_2125840_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|2125908_2127669_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 155
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2133847	2135902	4977480		Bacillus_phage(100.0%)	1	NA	NA
WP_017465794.1|2133847_2135902_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
>prophage 156
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2141681	2143639	4977480	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000374046.1|2141681_2142341_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_020898647.1|2142958_2143639_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.5	8.8e-83
>prophage 157
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2151483	2152164	4977480		Bacillus_phage(100.0%)	1	NA	NA
WP_001579225.1|2151483_2152164_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	36.5	2.0e-34
>prophage 158
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2165524	2167766	4977480		Phage_258-320(50.0%)	3	NA	NA
WP_001537781.1|2165524_2165887_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
WP_001284251.1|2166540_2166846_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420603.1|2166845_2167766_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 159
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2174051	2174219	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001273663.1|2174051_2174219_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 160
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2182229	2183018	4977480		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533527.1|2182229_2183018_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.4e-92
>prophage 161
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2190938	2191772	4977480		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001137620.1|2190938_2191772_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 162
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2195926	2196466	4977480		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000203944.1|2195926_2196466_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 163
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2205529	2206450	4977480		Morganella_phage(100.0%)	1	NA	NA
WP_000163973.1|2205529_2206450_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.5	8.1e-55
>prophage 164
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2211108	2211354	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_001217763.1|2211108_2211354_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 165
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2227372	2228323	4977480		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000578685.1|2227372_2228323_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 166
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2242142	2243269	4977480		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000007236.1|2242142_2242877_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
WP_000103754.1|2243032_2243269_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 167
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2246542	2247184	4977480		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000535399.1|2246542_2247184_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
>prophage 168
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2260345	2260603	4977480		Erwinia_phage(100.0%)	1	NA	NA
WP_020898684.1|2260345_2260603_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	4.3e-06
>prophage 169
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2266788	2270514	4977480		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033714.1|2266788_2267490_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
WP_000168091.1|2267489_2268734_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291322.1|2268762_2269674_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001191856.1|2269692_2270514_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
>prophage 170
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2274100	2276084	4977480		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000799391.1|2274100_2274964_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
WP_000531607.1|2274947_2276084_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
>prophage 171
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2282404	2283775	4977480		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423763.1|2282404_2283775_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 172
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2287302	2288553	4977480		Phage_21(100.0%)	1	NA	NA
WP_000444508.1|2287302_2288553_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 173
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2293065	2296394	4977480		Enterobacteria_phage(50.0%)	5	NA	NA
WP_000497451.1|2293065_2293305_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001534683.1|2293485_2294007_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_001537306.1|2294422_2294635_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_023888352.1|2294766_2295030_-	virulence protein PagD	NA	NA	NA	NA	NA
WP_000789472.1|2295836_2296394_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
>prophage 174
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2301034	2301565	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_000929974.1|2301034_2301565_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 175
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2306113	2306911	4977480		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000950209.1|2306113_2306911_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.2e-11
>prophage 176
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2321865	2325317	4977480		Bacillus_phage(100.0%)	3	NA	NA
WP_020898697.1|2321865_2323359_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
WP_000976278.1|2323658_2323877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020898698.1|2324030_2325317_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	4.5e-11
>prophage 177
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2334724	2335381	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000184701.1|2334724_2335381_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
>prophage 178
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2340266	2342216	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_020898703.1|2340266_2342216_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 179
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2345803	2347030	4977480		Klosneuvirus(100.0%)	1	NA	NA
WP_000059488.1|2345803_2347030_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 180
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2353728	2354556	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_000174982.1|2353728_2354556_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 181
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2360723	2362976	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_020898707.1|2360723_2362976_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	2.3e-143
>prophage 182
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2373106	2392735	4977480	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144226.1|2373106_2375035_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
WP_001574431.1|2375038_2375581_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|2375676_2375874_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2375924_2376281_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2376401_2376446_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|2376582_2377566_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_020898710.1|2377581_2379969_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|2379973_2380273_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000954982.1|2380475_2381456_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001181565.1|2381547_2382099_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000080607.1|2382098_2382848_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
WP_001213256.1|2382924_2383389_+	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
WP_020898711.1|2383702_2384416_+	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_020898712.1|2384477_2385920_+	YdiU family protein	NA	NA	NA	NA	NA
WP_000089118.1|2385954_2386146_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082196.1|2386302_2387349_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
WP_000370992.1|2387504_2388338_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_020898713.1|2388674_2391053_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	3.2e-172
WP_020898714.1|2391094_2392735_-	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
>prophage 183
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2415100	2418310	4977480		Cedratvirus(50.0%)	3	NA	NA
WP_000948902.1|2415100_2415847_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
WP_020898718.1|2415821_2417093_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000143859.1|2417089_2418310_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
>prophage 184
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2436486	2440825	4977480		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000122320.1|2436486_2437215_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
WP_000666334.1|2437393_2438032_-	two component system response regulator	NA	NA	NA	NA	NA
WP_020898723.1|2438062_2440825_-	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	1.0e-28
>prophage 185
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2464777	2472201	4977480		Orpheovirus(20.0%)	8	NA	NA
WP_000493971.1|2464777_2465419_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
WP_000098879.1|2465460_2466609_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
WP_020898736.1|2466898_2468104_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269523.1|2468216_2469149_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190992.1|2469145_2470171_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
WP_000102277.1|2470466_2470556_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000007294.1|2470638_2471220_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_001081022.1|2471346_2472201_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
>prophage 186
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2477275	2477797	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_000826820.1|2477275_2477797_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	4.0e-51
>prophage 187
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2484713	2485988	4977480	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168626.1|2484713_2485988_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 188
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2508208	2512622	4977480		Bacillus_phage(50.0%)	3	NA	NA
WP_020898746.1|2508208_2509510_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.4	2.2e-13
WP_023888163.1|2509620_2511327_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000824337.1|2511479_2512622_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.6	3.4e-111
>prophage 189
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2530331	2538662	4977480		Escherichia_phage(75.0%)	8	NA	NA
WP_000593092.1|2530331_2531480_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
WP_000379677.1|2531479_2532127_-	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_020898750.1|2532136_2533039_-	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_000557304.1|2533067_2533778_-	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_000206567.1|2534082_2534697_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	7.3e-28
WP_017465699.1|2534739_2535597_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_000213068.1|2535598_2536216_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
WP_020898751.1|2536226_2538662_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	4.6e-206
>prophage 190
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2543607	2549613	4977480		uncultured_virus(20.0%)	6	NA	NA
WP_000921382.1|2543607_2543934_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.0	2.9e-23
WP_000706269.1|2544055_2545270_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
WP_020438092.1|2545280_2546300_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000192118.1|2546353_2547733_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	5.7e-28
WP_020898752.1|2547876_2549343_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	3.3e-42
WP_000989267.1|2549409_2549613_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 191
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2558899	2559283	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091194.1|2558899_2559283_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 192
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2568220	2569339	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000758335.1|2568220_2569339_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 193
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2583709	2583994	4977480		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000221345.1|2583709_2583994_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	8.9e-21
>prophage 194
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2607183	2608194	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000642447.1|2607183_2608194_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 195
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2614562	2615645	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000769043.1|2614562_2615645_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	71.8	3.3e-140
>prophage 196
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2623807	2625352	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_020898773.1|2623807_2625352_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 197
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2633293	2635414	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_020898776.1|2633293_2635414_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.4e-134
>prophage 198
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2653012	2654977	4977480		Phage_TP(100.0%)	1	NA	NA
WP_001249753.1|2653012_2654977_-	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 199
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2667313	2669671	4977480		Oenococcus_phage(50.0%)	2	NA	NA
WP_020898786.1|2667313_2668567_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	31.4	1.6e-45
WP_000125687.1|2668903_2669671_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.2	7.0e-20
>prophage 200
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2675809	2682899	4977480		Megavirus(33.33%)	5	NA	NA
WP_020898788.1|2675809_2677318_-	carboxylesterase/lipase family protein	NA	G5CSV8	Megavirus	38.2	1.6e-31
WP_000024087.1|2677366_2678710_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414259.1|2679002_2679926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020898789.1|2679986_2681612_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
WP_000842142.1|2681780_2682899_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	7.6e-31
>prophage 201
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2689442	2690174	4977480		Planktothrix_phage(100.0%)	1	NA	NA
WP_020898792.1|2689442_2690174_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.0e-24
>prophage 202
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2693934	2699348	4977480		Escherichia_phage(50.0%)	3	NA	NA
WP_020898795.1|2693934_2694465_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_001098511.1|2694581_2695382_-	YdcF family protein	NA	NA	NA	NA	NA
WP_023137906.1|2695445_2699348_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.2	4.2e-52
>prophage 203
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2704167	2705157	4977480		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762206.1|2704167_2705157_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 204
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2710269	2722346	4977480	tRNA	Morganella_phage(16.67%)	9	NA	NA
WP_001082296.1|2710269_2710704_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159237.1|2710756_2711095_-	EamA family transporter	NA	NA	NA	NA	NA
WP_020898799.1|2711369_2714792_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.3	0.0e+00
WP_001156218.1|2715477_2716413_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123688.1|2716456_2717830_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
WP_000387373.1|2718316_2719300_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_020898800.1|2719445_2720600_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
WP_001046799.1|2721009_2721573_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945036.1|2721830_2722346_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
>prophage 205
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2732433	2733291	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_010989022.1|2732433_2733291_+	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 206
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2736841	2737711	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000456780.1|2736841_2737711_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.0e-51
>prophage 207
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2763211	2764018	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_000230462.1|2763211_2764018_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 208
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2769521	2773700	4977480		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_000485041.1|2769521_2771456_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	1.5e-05
WP_024142965.1|2771717_2773700_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.1	1.3e-17
>prophage 209
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2779284	2779875	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|2779284_2779875_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 210
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2784968	2790307	4977480	protease	Tupanvirus(33.33%)	4	NA	NA
WP_000513593.1|2784968_2787566_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
WP_000548616.1|2787968_2788220_+	YciN family protein	NA	NA	NA	NA	NA
WP_020898821.1|2788261_2789308_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	9.6e-20
WP_000559310.1|2789545_2790307_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
>prophage 211
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2795288	2798246	4977480		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763480.1|2795288_2796884_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
WP_020898824.1|2796887_2798246_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	2.3e-37
>prophage 212
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2809913	2812806	4977480		Lactobacillus_phage(33.33%)	3	NA	NA
WP_000059074.1|2809913_2810750_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
WP_000994698.1|2810797_2811802_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
WP_000058857.1|2811798_2812806_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.3e-13
>prophage 213
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2821189	2827597	4977480		Serratia_phage(33.33%)	7	NA	NA
WP_000068097.1|2821189_2821807_-	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
WP_001287383.1|2822469_2822883_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000729450.1|2823014_2823923_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_000193432.1|2824125_2825139_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001230575.1|2825229_2826135_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001540172.1|2826245_2826704_+	YchJ family protein	NA	NA	NA	NA	NA
WP_001191156.1|2826754_2827597_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
>prophage 214
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2832098	2833634	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_000702629.1|2832098_2833634_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 215
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2843973	2849631	4977480		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_001146392.1|2843973_2844204_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
WP_000148418.1|2844470_2845571_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000811046.1|2845624_2846479_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
WP_001257065.1|2846516_2847326_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000150667.1|2847329_2847719_-	SirB family protein	NA	NA	NA	NA	NA
WP_020898830.1|2847715_2848549_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804703.1|2848548_2849631_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
>prophage 216
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2852978	2855736	4977480		Tupanvirus(50.0%)	2	NA	NA
WP_001518537.1|2852978_2853926_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037181.1|2854050_2855736_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.9e-23
>prophage 217
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2892423	2899735	4977480	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_000758418.1|2892423_2894109_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_020898842.1|2894313_2894895_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_020898843.1|2894966_2895662_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2895719_2897630_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2897760_2898105_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2898110_2898290_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|2898370_2899735_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
>prophage 218
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2903705	2905265	4977480		Moraxella_phage(100.0%)	1	NA	NA
WP_000421815.1|2903705_2905265_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 219
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2912752	2912962	4977480		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2912752_2912962_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 220
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2918338	2920387	4977480		Moraxella_phage(100.0%)	1	NA	NA
WP_001091237.1|2918338_2920387_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 221
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2927893	2931018	4977480		Escherichia_phage(50.0%)	4	NA	NA
WP_000986168.1|2927893_2928544_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	8.5e-59
WP_001134851.1|2928767_2928932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898849.1|2929216_2929939_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422887.1|2930622_2931018_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
>prophage 222
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	2936704	3020461	4977480	integrase,tRNA,lysis,capsid,portal,terminase,protease,tail,head	Salmonella_phage(48.72%)	110	2932629:2932645	3010955:3010971
2932629:2932645	attL	AATTATTCATTAAAAAT	NA	NA	NA	NA
WP_077909686.1|2936704_2936974_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	35.6	6.5e-05
WP_031617672.1|2937139_2937280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024142969.1|2938055_2940476_-	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	72.7	1.1e-55
WP_001747902.1|2940594_2940729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072144994.1|2940731_2941091_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	46.1	1.5e-20
WP_000722368.1|2941453_2941807_-	YebY family protein	NA	NA	NA	NA	NA
WP_020898858.1|2941823_2942699_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168394.1|2942699_2943074_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2943211_2943442_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000100257.1|2943549_2944206_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_020898859.1|2944229_2944928_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000937000.1|2944964_2947016_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024707.1|2947228_2947888_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001042123.1|2947981_2948335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257723.1|2948402_2948693_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173430.1|2948823_2950002_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800494.1|2950101_2950743_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_020898860.1|2950780_2952592_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301711.1|2952826_2954302_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
WP_020898861.1|2954643_2955513_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091156.1|2955636_2957079_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448401.1|2957151_2958123_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184028.1|2958239_2959559_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_000939597.1|2959574_2960519_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000203023.1|2960597_2961353_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_000571508.1|2961349_2962135_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568504.1|2962213_2963224_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_000580335.1|2963232_2963844_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010989032.1|2964263_2965160_+	DUF4034 domain-containing protein	NA	NA	NA	NA	NA
WP_000716753.1|2965786_2966386_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000022509.1|2966387_2966909_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_000907242.1|2966945_2967686_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000653693.1|2967715_2968168_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258633.1|2968270_2970043_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000916144.1|2970367_2970934_+	hydrolase	NA	NA	NA	NA	NA
WP_020898862.1|2971256_2971928_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.3e-80
WP_020898863.1|2971920_2973189_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.3	2.2e-244
WP_000394200.1|2973191_2973611_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
WP_020898864.1|2973852_2975157_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	56.6	2.7e-128
WP_020898865.1|2975166_2976126_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
WP_001110473.1|2976134_2978855_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|2978854_2979253_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|2979259_2979844_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_000729325.1|2979843_2980437_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
WP_000064923.1|2980602_2980815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171561.1|2980853_2981165_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
WP_020898866.1|2981210_2984501_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	64.3	2.7e-310
WP_020898867.1|2984564_2985164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024142971.1|2985231_2985516_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.6e-44
WP_020898869.1|2985539_2985911_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	90.1	4.8e-59
WP_020898870.1|2985938_2986643_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	75.2	1.2e-93
WP_020898871.1|2986700_2987048_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	77.9	8.3e-45
WP_000573486.1|2987044_2987494_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	2.1e-72
WP_020898872.1|2987490_2987829_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|2987838_2988165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_020898873.1|2988164_2988425_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.9e-10
WP_020898874.1|2988468_2989686_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	2.7e-199
WP_020898875.1|2989695_2990544_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.4e-138
WP_020898876.1|2990557_2991862_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	3.3e-219
WP_031234234.1|2991861_2993604_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.4	5.9e-139
WP_000919034.1|2993557_2994022_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_020898878.1|2994154_2994499_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
WP_024142972.1|2994617_2995055_-|lysis	lysis protein	lysis	A0A088CQ67	Enterobacteria_phage	91.7	2.6e-67
WP_001089360.1|2995143_2995641_-	lysozyme	NA	A5LH83	Enterobacteria_phage	93.3	1.5e-87
WP_000781414.1|2995640_2995913_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
WP_000947857.1|2996136_2996655_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
WP_020838507.1|2996937_2997702_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	98.0	4.7e-141
WP_020898880.1|2997698_2997881_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	96.7	1.2e-23
WP_020898881.1|2997868_2998339_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.2	6.3e-88
WP_001749499.1|2998319_2998556_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
WP_020898882.1|2998548_2998719_-	NinF family protein	NA	I6R994	Salmonella_phage	83.3	2.4e-21
WP_000113771.1|2998715_2998898_-	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_024142973.1|2998864_2999038_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	96.5	5.8e-31
WP_020898884.1|2999034_2999481_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	2.1e-80
WP_020898885.1|2999437_2999734_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	1.4e-48
WP_024142974.1|2999736_3000030_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	55.7	1.2e-20
WP_001750243.1|3000041_3000236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898887.1|3000250_3000457_-	hypothetical protein	NA	I6RSI5	Salmonella_phage	95.6	2.4e-28
WP_020898888.1|3000529_3000799_-	hypothetical protein	NA	I6S1N5	Salmonella_phage	97.8	3.2e-44
WP_020898889.1|3000795_3002172_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	99.6	6.3e-253
WP_000067077.1|3002168_3003002_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.3	4.2e-151
WP_001125981.1|3002994_3003141_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3003175_3003457_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067727.1|3003570_3003786_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_020898890.1|3003903_3004557_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	94.4	2.3e-120
WP_020898891.1|3004939_3005242_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	97.0	1.8e-48
WP_020898892.1|3005320_3006250_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	87.4	4.9e-76
WP_020898893.1|3006459_3006618_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	98.1	5.3e-23
WP_000156731.1|3006598_3006787_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3006776_3006920_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_020898894.1|3006916_3007624_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	1.9e-136
WP_000168281.1|3007624_3008131_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	100.0	1.0e-91
WP_001016189.1|3008139_3008688_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.9	6.6e-105
WP_001111322.1|3008703_3008997_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_001214770.1|3009007_3009178_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_020838482.1|3009174_3009765_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	68.7	1.9e-65
WP_020838481.1|3009761_3009995_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	1.6e-12
WP_020898895.1|3010023_3010563_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	69.7	3.6e-63
WP_020898896.1|3010562_3010922_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	2.1e-22
WP_031617777.1|3010926_3011748_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	46.1	1.5e-60
3010955:3010971	attR	AATTATTCATTAAAAAT	NA	NA	NA	NA
WP_006669542.1|3011751_3012321_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	83.1	4.3e-91
WP_006669544.1|3012359_3012596_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	4.2e-40
WP_006669545.1|3012654_3013968_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.4	2.3e-228
WP_049827788.1|3013946_3014720_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.2e-57
WP_000252975.1|3014772_3015168_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019607.1|3015208_3015952_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	4.1e-25
WP_020898899.1|3015948_3016920_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001185772.1|3017155_3017902_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000024796.1|3017921_3018491_-	VOC family protein	NA	NA	NA	NA	NA
WP_020898900.1|3018727_3020461_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
>prophage 223
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3028413	3032548	4977480		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000763861.1|3028413_3028803_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
WP_000036392.1|3028820_3029870_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204362.1|3029866_3030733_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_020898902.1|3030886_3032548_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	5.8e-11
>prophage 224
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3047698	3048364	4977480		Sphingomonas_phage(100.0%)	1	NA	NA
WP_000781521.1|3047698_3048364_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 225
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3056627	3057380	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_001273038.1|3056627_3057380_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.0	2.4e-25
>prophage 226
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3085067	3096883	4977480		Burkholderia_phage(28.57%)	12	NA	NA
WP_001119828.1|3085067_3086780_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
WP_001178602.1|3086944_3087190_-	YodC family protein	NA	NA	NA	NA	NA
WP_020898911.1|3087206_3088118_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_020898912.1|3088293_3089214_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|3089202_3089673_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157304.1|3089653_3091084_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_020898913.1|3091157_3091853_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.1e-07
WP_000107443.1|3091932_3092244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024131109.1|3094335_3094524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3094534_3094747_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457660.1|3095192_3096461_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|3096463_3096883_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 227
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3102872	3105860	4977480	integrase	Vibrio_phage(50.0%)	3	NA	NA
WP_020898918.1|3102872_3103094_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.9	1.5e-15
WP_020898919.1|3103957_3104839_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_017900819.1|3105107_3105860_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	34.9	4.6e-08
>prophage 228
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3109336	3109861	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_001219023.1|3109336_3109861_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 229
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3121489	3122752	4977480	integrase	Pseudomonas_phage(100.0%)	1	3117972:3117987	3123755:3123770
3117972:3117987	attL	GCGCTCCAGCGCCTGC	NA	NA	NA	NA
WP_020898927.1|3121489_3122752_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	40.3	2.8e-74
WP_020898927.1|3121489_3122752_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	40.3	2.8e-74
3123755:3123770	attR	GCGCTCCAGCGCCTGC	NA	NA	NA	NA
>prophage 230
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3125921	3129425	4977480		Vibrio_phage(50.0%)	4	NA	NA
WP_020898930.1|3125921_3126143_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	68.3	1.6e-17
WP_020898931.1|3126139_3126613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898932.1|3126891_3127902_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_023888430.1|3128189_3129425_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	46.6	1.4e-94
>prophage 231
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3134125	3141084	4977480		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_020898936.1|3134125_3139966_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.6	3.3e-08
WP_024142979.1|3140060_3140474_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	48.8	5.6e-32
WP_020898938.1|3140781_3141084_+	DUF4102 domain-containing protein	NA	A7X7X0	Dichelobacter_phage	51.9	3.7e-09
>prophage 232
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3144369	3144846	4977480		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020898941.1|3144369_3144846_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	3.5e-38
>prophage 233
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3150868	3151684	4977480		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000881539.1|3150868_3151684_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.7	5.9e-09
>prophage 234
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3165196	3165991	4977480		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000025.1|3165196_3165991_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.8	2.1e-11
>prophage 235
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3185692	3190619	4977480		Escherichia_phage(66.67%)	4	NA	NA
WP_000925042.1|3185692_3186865_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	6.2e-201
WP_001092553.1|3186988_3187753_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001016236.1|3187749_3188328_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
WP_000028223.1|3188342_3190619_-	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.1	2.2e-37
>prophage 236
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3199305	3200205	4977480		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886600.1|3199305_3200205_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 237
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3207648	3225232	4977480		Bodo_saltans_virus(18.18%)	15	NA	NA
WP_000704833.1|3207648_3208815_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.7	1.1e-112
WP_020898968.1|3209050_3210457_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.5e-36
WP_020898969.1|3210586_3211483_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	29.9	1.8e-27
WP_000626464.1|3211493_3212231_-	glycosyltransferase	NA	A0A2H4UUS7	Bodo_saltans_virus	28.3	2.8e-05
WP_020898971.1|3212237_3213404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898972.1|3213551_3214790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898973.1|3214790_3216164_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	5.8e-33
WP_020898974.1|3216167_3217616_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.7	3.2e-58
WP_020898975.1|3217608_3218109_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_024142980.1|3218111_3219077_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_020898977.1|3219079_3220198_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	5.3e-133
WP_023888509.1|3220245_3221370_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001637675.1|3221406_3222426_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	3.2e-84
WP_000981469.1|3222757_3223651_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_020898979.1|3223828_3225232_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.8e-21
>prophage 238
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3230820	3237523	4977480		Bacillus_phage(25.0%)	6	NA	NA
WP_020898982.1|3230820_3232191_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	1.7e-32
WP_000605946.1|3232301_3233744_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	9.4e-50
WP_020898983.1|3233740_3234964_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_020898984.1|3234960_3235434_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_024142980.1|3235436_3236402_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_020898985.1|3236404_3237523_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
>prophage 239
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3242698	3251998	4977480		Streptococcus_phage(25.0%)	7	NA	NA
WP_020898986.1|3242698_3244858_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.2e-17
WP_000482224.1|3244854_3245304_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978077.1|3245309_3246449_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454713.1|3247123_3248704_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
WP_001252265.1|3248789_3250646_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234783.1|3250684_3251266_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
WP_000132082.1|3251356_3251998_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 240
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3262446	3269058	4977480		Bacillus_phage(66.67%)	4	NA	NA
WP_020898990.1|3262446_3265527_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.2	5.4e-63
WP_000137818.1|3265523_3266936_+	MFS transporter	NA	NA	NA	NA	NA
WP_000870081.1|3266935_3268339_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
WP_000137854.1|3268335_3269058_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
>prophage 241
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3275067	3275202	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_001538028.1|3275067_3275202_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	67.4	1.5e-07
>prophage 242
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3285841	3287203	4977480	tRNA	Phage_TP(100.0%)	1	NA	NA
WP_024142983.1|3285841_3287203_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.1	5.1e-207
>prophage 243
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3304820	3313991	4977480	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195343.1|3304820_3306854_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000703137.1|3307094_3307553_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3307724_3308255_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3308311_3308779_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3308825_3309545_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3309541_3311227_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|3311449_3312181_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3312240_3312348_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3312328_3313060_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3313043_3313991_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 244
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3325751	3327420	4977480	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_023252648.1|3325751_3326957_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	88.6	4.2e-168
WP_020899013.1|3327015_3327420_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	4.2e-32
>prophage 245
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3341865	3343386	4977480		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000535907.1|3341865_3343386_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 246
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3347345	3348014	4977480		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139611.1|3347345_3348014_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 247
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3353453	3355445	4977480		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000488255.1|3353453_3355445_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 248
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3359562	3360420	4977480		Catovirus(100.0%)	1	NA	NA
WP_020899019.1|3359562_3360420_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.9e-22
>prophage 249
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3370562	3371135	4977480		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241015.1|3370562_3371135_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 250
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3377059	3385386	4977480		Vibrio_phage(50.0%)	8	NA	NA
WP_000203612.1|3377059_3378649_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
WP_001094639.1|3378652_3378997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213349.1|3379387_3380578_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	5.4e-19
WP_001234836.1|3380605_3381301_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578115.1|3381452_3383213_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	3.2e-100
WP_000494192.1|3383337_3383622_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_020899026.1|3383730_3384351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050804.1|3384378_3385386_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
>prophage 251
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3395833	3396451	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_020899030.1|3395833_3396451_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.1e-10
>prophage 252
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3403533	3409351	4977480		Bacillus_phage(33.33%)	5	NA	NA
WP_020899033.1|3403533_3405177_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	1.7e-10
WP_000884991.1|3405252_3405903_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000975968.1|3405905_3406967_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
WP_000784307.1|3407047_3408100_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865521.1|3408214_3409351_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.6	1.5e-114
>prophage 253
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3413518	3420731	4977480		Hokovirus(33.33%)	3	NA	NA
WP_000876084.1|3413518_3416365_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	7.1e-41
WP_001281271.1|3416482_3419119_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
WP_000705581.1|3419528_3420731_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.0	7.8e-58
>prophage 254
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3424171	3427954	4977480		Pseudomonas_phage(66.67%)	3	NA	NA
WP_001076490.1|3424171_3426457_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.6e-282
WP_000332026.1|3426569_3427700_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
WP_000533921.1|3427699_3427954_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
>prophage 255
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3441109	3442315	4977480		Oenococcus_phage(100.0%)	1	NA	NA
WP_001518659.1|3441109_3442315_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	4.6e-26
>prophage 256
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3445962	3450971	4977480		Tupanvirus(50.0%)	4	NA	NA
WP_020899038.1|3445962_3446568_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
WP_020899039.1|3446866_3448006_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.7e-31
WP_020899040.1|3448008_3448992_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.3e-34
WP_020899041.1|3448988_3450971_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
>prophage 257
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3463538	3476277	4977480		Bacillus_thuringiensis_phage(50.0%)	3	NA	NA
WP_000368560.1|3463538_3464540_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.8e-28
WP_020899045.1|3464580_3466395_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_020899046.1|3467100_3476277_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.9	3.9e-40
>prophage 258
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3495597	3498869	4977480		Salmonella_phage(50.0%)	3	NA	NA
WP_000813882.1|3495597_3496197_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012857.1|3496288_3498115_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_023888407.1|3498191_3498869_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
>prophage 259
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3509677	3510697	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000026949.1|3509677_3510697_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 260
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3514425	3515199	4977480		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293591.1|3514425_3515199_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 261
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3526628	3528146	4977480		Mollivirus(100.0%)	1	NA	NA
WP_000334205.1|3526628_3528146_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 262
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3534647	3535784	4977480		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699178.1|3534647_3535784_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 263
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3546442	3547528	4977480		Pandoravirus(100.0%)	1	NA	NA
WP_000918457.1|3546442_3547528_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 264
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3556708	3557650	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000377772.1|3556708_3557650_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
>prophage 265
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3566425	3567346	4977480		Morganella_phage(100.0%)	1	NA	NA
WP_000484431.1|3566425_3567346_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 266
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3588738	3598588	4977480		Lactobacillus_phage(25.0%)	9	NA	NA
WP_001109829.1|3588738_3589665_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.0e-09
WP_000765580.1|3589754_3590753_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001519708.1|3590749_3590968_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000433278.1|3590969_3592985_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.9	8.8e-147
WP_000983126.1|3593056_3594043_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000255008.1|3594274_3595036_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000036904.1|3595199_3596171_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
WP_000487600.1|3596554_3596812_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_020899063.1|3596860_3598588_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	29.4	9.6e-17
>prophage 267
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3604247	3613799	4977480		Streptococcus_phage(20.0%)	11	NA	NA
WP_020899066.1|3604247_3605159_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.0e-57
WP_000021076.1|3605226_3606324_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	7.0e-29
WP_000852705.1|3606313_3607189_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000881745.1|3607188_3608022_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290273.1|3608021_3609038_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517460.1|3609195_3609987_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000084583.1|3610224_3611124_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_000838968.1|3611218_3611794_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842940.1|3611855_3612305_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406008.1|3612291_3612717_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102880.1|3612929_3613799_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
>prophage 268
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3634408	3635359	4977480		Cyanophage(100.0%)	1	NA	NA
WP_001072443.1|3634408_3635359_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 269
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3653982	3654696	4977480		Synechococcus_phage(100.0%)	1	NA	NA
WP_001171630.1|3653982_3654696_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 270
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3658034	3659174	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706377.1|3658034_3659174_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
>prophage 271
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3664757	3670032	4977480		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_000132650.1|3664757_3665117_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_000100388.1|3665143_3665869_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198343.1|3665939_3667229_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.9e-63
WP_000706208.1|3667316_3667943_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024142985.1|3668356_3669394_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.2e-69
WP_001028589.1|3669393_3670032_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	9.6e-31
>prophage 272
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3676494	3676686	4977480		Escherichia_phage(100.0%)	1	NA	NA
WP_000075924.1|3676494_3676686_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 273
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3679975	3689239	4977480		Klosneuvirus(33.33%)	3	NA	NA
WP_000944174.1|3679975_3681442_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
WP_020899077.1|3681602_3682952_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
WP_024142986.1|3683113_3689239_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	26.8	9.3e-30
>prophage 274
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3708478	3713727	4977480		Escherichia_phage(66.67%)	5	NA	NA
WP_000963846.1|3708478_3708910_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
WP_020899083.1|3709030_3709894_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_020899084.1|3709893_3710703_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_000077436.1|3710695_3711325_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.4	5.5e-63
WP_020899085.1|3711321_3713727_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.2	1.1e-140
>prophage 275
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3724532	3725816	4977480		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000133541.1|3724532_3725816_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 276
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3729118	3734610	4977480	tRNA	Lake_Baikal_phage(25.0%)	7	NA	NA
WP_000028952.1|3729118_3729442_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_000331704.1|3729470_3729857_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000775263.1|3729884_3731099_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_001241346.1|3731279_3731774_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940032.1|3731933_3732665_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3732783_3733587_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_020899089.1|3733731_3734610_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.4	4.6e-15
>prophage 277
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3742029	3743283	4977480		Aeromonas_phage(100.0%)	1	NA	NA
WP_000919178.1|3742029_3743283_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 278
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3750498	3760345	4977480		Bacillus_phage(50.0%)	6	NA	NA
WP_000856793.1|3750498_3751959_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3752007_3752346_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3752422_3753760_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|3753756_3754521_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3754522_3755953_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_020899094.1|3756457_3760345_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
>prophage 279
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3768929	3776775	4977480		Lactobacillus_phage(25.0%)	9	NA	NA
WP_001022463.1|3768929_3769856_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196291.1|3769893_3770154_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986043.1|3770265_3770646_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818969.1|3770645_3771377_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3771388_3772117_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102230.1|3772128_3773034_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3773030_3773711_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3773984_3774959_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3774975_3776775_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 280
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3782613	3788784	4977480	tRNA	uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_000219174.1|3782613_3783948_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000365859.1|3783965_3784865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188415.1|3784967_3785555_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3785616_3786000_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3786318_3787008_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997371.1|3787123_3788161_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|3788364_3788784_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
>prophage 281
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3794085	3795946	4977480		Burkholderia_virus(50.0%)	2	NA	NA
WP_000807818.1|3794085_3795387_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_000985653.1|3795490_3795946_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
>prophage 282
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3801943	3804517	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235092.1|3801943_3804517_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 283
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3811302	3814544	4977480		Escherichia_coli_O157_typing_phage(50.0%)	3	NA	NA
WP_001168062.1|3811302_3812373_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|3812812_3813331_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|3813323_3814544_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
>prophage 284
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3826312	3826795	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001518569.1|3826312_3826795_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 285
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3840354	3851869	4977480	transposase	Organic_Lake_phycodnavirus(25.0%)	6	NA	NA
WP_020899110.1|3840354_3842535_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_072102794.1|3842542_3843706_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_020899111.1|3844305_3845067_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	33.3	4.2e-09
WP_104758583.1|3845259_3846406_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	5.2e-144
WP_001221121.1|3847016_3848132_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_020899114.1|3848212_3851869_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
>prophage 286
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3872239	3876243	4977480		Klosneuvirus(50.0%)	4	NA	NA
WP_001095558.1|3872239_3873523_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	4.6e-32
WP_020899122.1|3873652_3875053_+	GABA permease	NA	NA	NA	NA	NA
WP_000126152.1|3875094_3875772_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522406.1|3875793_3876243_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 287
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3882941	3887996	4977480		Bacillus_phage(33.33%)	3	NA	NA
WP_001275402.1|3882941_3883352_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000777901.1|3885479_3886439_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
WP_000985529.1|3886793_3887996_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
>prophage 288
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3899832	3907338	4977480	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	7	NA	NA
WP_000271296.1|3899832_3900399_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_172704627.1|3900549_3900762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906486.1|3901791_3901977_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_020899127.1|3902211_3904842_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_020899128.1|3905077_3905578_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963150.1|3905694_3906756_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
WP_001528025.1|3906840_3907338_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	3.4e-31
>prophage 289
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3913245	3914211	4977480		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001278206.1|3913245_3914211_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	3.0e-36
>prophage 290
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3938125	3938947	4977480		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_020899135.1|3938125_3938947_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 291
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3972450	3974139	4977480		Vibrio_phage(100.0%)	1	NA	NA
WP_000848101.1|3972450_3974139_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 292
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3979529	3985258	4977480		Escherichia_phage(50.0%)	5	NA	NA
WP_020899150.1|3979529_3980186_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	47.9	6.6e-51
WP_020899151.1|3980357_3980852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000445914.1|3980878_3981547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001537523.1|3982121_3982532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005802.1|3982690_3985258_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	4.3e-29
>prophage 293
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	3991224	4001651	4977480		Escherichia_phage(50.0%)	12	NA	NA
WP_000153636.1|3991224_3991863_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
WP_000912488.1|3991859_3993122_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
WP_020899155.1|3993115_3994039_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.3e-116
WP_000613179.1|3994235_3995000_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
WP_000423338.1|3995018_3995423_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001237180.1|3995593_3996187_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863168.1|3996186_3997614_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562964.1|3997624_3997861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081498.1|3997905_3998898_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272632.1|3998960_4000094_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_000253545.1|4000269_4000896_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
WP_001221537.1|4000889_4001651_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
>prophage 294
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4004761	4006793	4977480		Tupanvirus(50.0%)	2	NA	NA
WP_001173659.1|4004761_4005367_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	2.2e-29
WP_001092256.1|4005353_4006793_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	2.7e-33
>prophage 295
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4029234	4033060	4977480		Vibrio_phage(33.33%)	3	NA	NA
WP_001199963.1|4029234_4029906_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
WP_000036734.1|4030041_4031340_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_000210863.1|4031422_4033060_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
>prophage 296
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4045503	4050799	4977480		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_000046849.1|4045503_4046799_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.4e-36
WP_000186400.1|4046856_4049613_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
WP_020899171.1|4049656_4050799_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.3	7.0e-48
>prophage 297
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4058218	4059067	4977480		Vibrio_phage(100.0%)	1	NA	NA
WP_000100456.1|4058218_4059067_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 298
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4063994	4064750	4977480		Bacillus_phage(100.0%)	1	NA	NA
WP_001818022.1|4063994_4064750_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	8.5e-10
>prophage 299
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4076293	4092872	4977480	tRNA	environmental_halophage(16.67%)	10	NA	NA
WP_000991053.1|4076293_4077499_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
WP_000184199.1|4077498_4077942_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_023888686.1|4078241_4079129_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_020899174.1|4079180_4079987_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	4.2e-15
WP_000678626.1|4080096_4081194_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000011922.1|4081693_4082947_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	2.5e-14
WP_000588964.1|4083179_4084511_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_020899175.1|4084613_4086449_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	1.9e-18
WP_020899176.1|4086445_4089991_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	22.0	1.0e-09
WP_020899177.1|4089983_4092872_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.0	6.7e-63
>prophage 300
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4098354	4105309	4977480		Cronobacter_phage(33.33%)	6	NA	NA
WP_000816247.1|4098354_4099149_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
WP_000204645.1|4099155_4100031_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957888.1|4100246_4102493_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
WP_000564481.1|4102505_4103036_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001274930.1|4103718_4104414_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895635.1|4104595_4105309_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 301
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4116141	4118675	4977480		Aichi_virus(50.0%)	2	NA	NA
WP_000253650.1|4116141_4117560_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	3.5e-25
WP_000602497.1|4117913_4118675_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	4.5e-19
>prophage 302
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4133437	4143975	4977480	tRNA	Enterobacteria_phage(16.67%)	9	NA	NA
WP_001038500.1|4133437_4133974_-	porin family protein	NA	A5LH44	Enterobacteria_phage	30.2	9.6e-16
WP_023888953.1|4135137_4135944_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_000244328.1|4136228_4136987_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_020899188.1|4137251_4137797_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003339.1|4137872_4139390_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_010989230.1|4139399_4140498_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_020899189.1|4140602_4142336_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	6.2e-64
WP_000745614.1|4142341_4143055_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000434300.1|4143078_4143975_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	6.1e-31
>prophage 303
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4147960	4153664	4977480		Pandoravirus(50.0%)	3	NA	NA
WP_020899190.1|4147960_4149394_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.2	1.1e-31
WP_000819375.1|4149441_4150335_-	transporter	NA	NA	NA	NA	NA
WP_020899191.1|4150790_4153664_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	3.1e-262
>prophage 304
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4161932	4163165	4977480		Catovirus(100.0%)	1	NA	NA
WP_001151627.1|4161932_4163165_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 305
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4174340	4174997	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_020899194.1|4174340_4174997_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	2.5e-10
>prophage 306
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4182748	4184221	4977480		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_023253643.1|4182748_4184221_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.6e-47
>prophage 307
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4190048	4191203	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062140.1|4190048_4191203_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 308
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4208509	4209595	4977480		Geobacillus_virus(100.0%)	1	NA	NA
WP_000976289.1|4208509_4209595_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 309
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4214759	4272776	4977480	integrase,transposase	uncultured_Caudovirales_phage(20.83%)	55	4205451:4205465	4275923:4275937
4205451:4205465	attL	GCTGCTTTCGCCCAC	NA	NA	NA	NA
WP_006781417.1|4214759_4215761_-|integrase	site-specific integrase	integrase	M1TW19	Prochlorococcus_phage	21.4	4.9e-05
WP_006781415.1|4215818_4217462_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_006781413.1|4217528_4219037_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	31.1	7.0e-48
WP_006781411.1|4219165_4219849_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.1	7.9e-31
WP_006781409.1|4219957_4220890_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_006781408.1|4220995_4221982_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	4.9e-50
WP_006781405.1|4222063_4222411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781404.1|4222478_4223081_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_006781402.1|4223156_4223804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781400.1|4223888_4224254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154283625.1|4224716_4225085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899206.1|4225674_4226655_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_004388336.1|4227581_4228016_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_006785898.1|4228231_4229632_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|4229628_4230309_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|4230363_4231293_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|4231297_4231678_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_020899208.1|4231717_4232614_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|4232613_4234431_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|4234664_4235114_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|4235402_4236140_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000843497.1|4236173_4236371_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_129244003.1|4236411_4238883_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_002436620.1|4238980_4239421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574021.1|4239507_4242654_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001485328.1|4242664_4243957_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|4244070_4244424_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|4244452_4245838_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|4246027_4246708_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555738.1|4246700_4248176_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_006785880.1|4248425_4248857_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_006785879.1|4249005_4249356_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	1.0e-18
WP_006785878.1|4249522_4250155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464944.1|4250218_4251366_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	4.3e-146
WP_020899211.1|4251770_4252388_+	recombinase family protein	NA	NA	NA	NA	NA
WP_006786007.1|4252456_4253356_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_020899212.1|4254287_4254986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899213.1|4255046_4255592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006786005.1|4255744_4256779_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.2	8.9e-111
WP_023202697.1|4256828_4258103_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
WP_006786002.1|4258144_4258585_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_006786000.1|4258778_4259678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020899215.1|4259776_4260304_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
WP_006785998.1|4260300_4261533_+	MFS transporter	NA	NA	NA	NA	NA
WP_006785996.1|4261581_4261917_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202699.1|4261922_4262636_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
WP_006785993.1|4262692_4263121_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_006785992.1|4263170_4264454_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
WP_006785991.1|4264550_4264904_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785990.1|4265166_4265625_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_165612122.1|4265806_4268335_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	2.2e-134
WP_006785988.1|4268412_4268712_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_006785987.1|4268841_4270968_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023253092.1|4270967_4271945_-|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	33.1	7.4e-06
WP_020899217.1|4272260_4272776_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	47.9	5.4e-24
4275923:4275937	attR	GCTGCTTTCGCCCAC	NA	NA	NA	NA
>prophage 310
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4295592	4299890	4977480		Ralstonia_phage(33.33%)	4	NA	NA
WP_006785955.1|4295592_4296030_-	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	64.8	3.8e-47
WP_006785953.1|4296163_4296700_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	65.3	4.2e-56
WP_006785950.1|4296760_4297231_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_006777725.1|4297868_4299890_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	1.1e-40
>prophage 311
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4306165	4313958	4977480	integrase,transposase	Escherichia_phage(25.0%)	6	4308481:4308496	4318032:4318047
WP_006777718.1|4306165_4307536_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.3	7.4e-121
WP_006777717.1|4307528_4308404_-	ParA family protein	NA	NA	NA	NA	NA
4308481:4308496	attL	TTAACTTTCCGGCAAT	NA	NA	NA	NA
WP_020899226.1|4308696_4309956_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	3.9e-84
WP_109511055.1|4310213_4311469_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	3.4e-19
WP_020899229.1|4311936_4312818_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_020899230.1|4313742_4313958_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.4	7.0e-18
4318032:4318047	attR	ATTGCCGGAAAGTTAA	NA	NA	NA	NA
>prophage 312
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4332509	4332794	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_020899239.1|4332509_4332794_+	DUF4102 domain-containing protein	NA	Q9AZ40	Salmonella_phage	39.2	2.4e-10
>prophage 313
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4348738	4349617	4977480		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000089254.1|4348738_4349617_-	carbon-nitrogen hydrolase family protein	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.4	3.5e-07
>prophage 314
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4353016	4354489	4977480		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000437132.1|4353016_4354489_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	7.9e-44
>prophage 315
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4369916	4375055	4977480		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_020899252.1|4369916_4371560_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
WP_000439335.1|4371866_4372361_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_000433048.1|4372638_4373154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936441.1|4373245_4373656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020899253.1|4373642_4374047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019032.1|4374170_4375055_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
>prophage 316
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4380996	4381824	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000013100.1|4380996_4381824_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 317
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4389859	4392031	4977480		Pseudomonas_phage(100.0%)	1	NA	NA
WP_020899261.1|4389859_4392031_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
>prophage 318
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4397868	4401568	4977480		Bacillus_virus(50.0%)	3	NA	NA
WP_020899263.1|4397868_4400127_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.8	5.2e-87
WP_000998810.1|4400237_4401104_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000731552.1|4401175_4401568_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
>prophage 319
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4404883	4406776	4977480		Bacillus_virus(100.0%)	1	NA	NA
WP_000195318.1|4404883_4406776_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 320
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4411176	4413017	4977480		Erwinia_phage(50.0%)	2	NA	NA
WP_000831528.1|4411176_4411848_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
WP_000442833.1|4411853_4413017_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
>prophage 321
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4418804	4420730	4977480	transposase	Stx2-converting_phage(50.0%)	2	NA	NA
WP_115400697.1|4418804_4420059_+|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	30.3	1.7e-18
WP_001076978.1|4420076_4420730_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 322
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4424779	4426213	4977480		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000867682.1|4424779_4426213_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 323
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4431441	4440448	4977480	tRNA	Sinorhizobium_phage(25.0%)	8	NA	NA
WP_000708449.1|4431441_4432683_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
WP_001281933.1|4432787_4433609_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|4433706_4434066_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272785.1|4434172_4434790_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264391.1|4435013_4436027_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|4436254_4436470_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|4436705_4438451_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|4438600_4440448_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 324
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4444957	4448287	4977480		Salmonella_phage(50.0%)	2	NA	NA
WP_000094645.1|4444957_4446478_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_072144991.1|4446907_4448287_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
>prophage 325
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4454474	4455443	4977480		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001098833.1|4454474_4455443_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 326
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4468638	4470933	4977480		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000867323.1|4468638_4470933_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	5.7e-158
>prophage 327
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4477085	4478231	4977480		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706464.1|4477085_4478231_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	3.5e-47
>prophage 328
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4488918	4495566	4977480		Streptococcus_phage(33.33%)	9	NA	NA
WP_000812288.1|4488918_4489782_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	9.6e-50
WP_020899279.1|4489845_4491888_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000057285.1|4491845_4492241_+	YraN family protein	NA	NA	NA	NA	NA
WP_000893481.1|4492262_4492853_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000643280.1|4492862_4493438_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_020899280.1|4493504_4494140_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020899281.1|4494269_4494788_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000380404.1|4494767_4495211_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000928379.1|4495248_4495566_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
>prophage 329
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4502702	4504592	4977480		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000807248.1|4502702_4504592_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 330
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4510127	4516784	4977480		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133064.1|4510127_4512806_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
WP_001031038.1|4512830_4514333_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000105461.1|4514360_4514813_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207646.1|4515440_4516784_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 331
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4520255	4523143	4977480	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764711.1|4520255_4521104_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
WP_001107481.1|4521208_4523143_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
>prophage 332
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4529865	4531356	4977480		Indivirus(50.0%)	2	NA	NA
WP_001047354.1|4529865_4530837_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
WP_000444167.1|4531068_4531356_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
>prophage 333
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4535465	4539055	4977480		Bacillus_virus(25.0%)	4	NA	NA
WP_000531566.1|4535465_4536278_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
WP_000922742.1|4536490_4537468_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.9	1.5e-06
WP_000018617.1|4537481_4538468_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_020899288.1|4538488_4539055_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	1.6e-53
>prophage 334
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4543329	4550376	4977480		Thermobifida_phage(33.33%)	7	NA	NA
WP_000243749.1|4543329_4544184_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000216797.1|4544180_4544453_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000602198.1|4544704_4545337_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000044651.1|4545411_4546140_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719811.1|4546136_4546790_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809813.1|4547016_4549353_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	2.7e-38
WP_001176887.1|4549446_4550376_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
>prophage 335
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4557142	4558246	4977480		Salmonella_phage(100.0%)	1	NA	NA
WP_020899289.1|4557142_4558246_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 336
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4563037	4567072	4977480	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108071.1|4563037_4564528_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
WP_020899293.1|4564643_4565537_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000382926.1|4565671_4566463_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366112.1|4566571_4567072_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 337
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4571940	4573308	4977480	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_020899295.1|4571940_4573308_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	3.5e-22
>prophage 338
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4580308	4581538	4977480		Oenococcus_phage(100.0%)	1	NA	NA
WP_020899301.1|4580308_4581538_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.2e-56
>prophage 339
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4599993	4601037	4977480		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4599993_4601037_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 340
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4613122	4616480	4977480		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_000642611.1|4613122_4614007_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
WP_000620015.1|4614089_4614254_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001519073.1|4614404_4616480_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	8.3e-23
>prophage 341
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4630586	4634906	4977480	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_001063613.1|4630586_4631159_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_001129708.1|4631163_4631706_-	DNA topoisomerase	NA	NA	NA	NA	NA
WP_000460663.1|4631732_4632206_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_000124532.1|4632177_4633302_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114987.1|4633433_4633943_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_001285165.1|4633958_4634906_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
>prophage 342
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4654799	4660370	4977480		Tupanvirus(33.33%)	7	NA	NA
WP_000031748.1|4654799_4655984_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_000124693.1|4656055_4658170_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
WP_001138043.1|4658266_4658737_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4658832_4659207_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_020899309.1|4659332_4659620_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820705.1|4659627_4659984_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001268010.1|4659983_4660370_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.8e-19
>prophage 343
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4666330	4668238	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000634765.1|4666330_4668238_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	6.5e-75
>prophage 344
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4672824	4676821	4977480		environmental_Halophage(50.0%)	3	NA	NA
WP_000269312.1|4672824_4674912_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
WP_020899310.1|4674954_4676172_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000601880.1|4676257_4676821_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
>prophage 345
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4694493	4695330	4977480		Vibrio_phage(100.0%)	1	NA	NA
WP_000742132.1|4694493_4695330_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 346
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4712370	4716133	4977480		Bacillus_phage(66.67%)	3	NA	NA
WP_020899320.1|4712370_4713990_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.5	5.3e-142
WP_001253818.1|4714064_4715417_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
WP_001157751.1|4715413_4716133_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 347
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4722745	4723660	4977480	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000235946.1|4722745_4723660_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 348
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4729722	4732116	4977480		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_020899324.1|4729722_4732116_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 349
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4737144	4740246	4977480		Ralstonia_phage(50.0%)	2	NA	NA
WP_020899326.1|4737144_4738359_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	3.2e-136
WP_020899327.1|4738704_4740246_-	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.9	6.3e-28
>prophage 350
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4754483	4756931	4977480		Dickeya_phage(100.0%)	1	NA	NA
WP_020899335.1|4754483_4756931_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 351
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4778328	4780136	4977480		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073548.1|4778328_4779069_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
WP_000907838.1|4779065_4780136_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 352
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4783546	4785746	4977480		Streptococcus_phage(33.33%)	4	NA	NA
WP_023253621.1|4783546_4783915_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	28.9	1.1e-07
WP_001522145.1|4783911_4784133_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000416114.1|4784263_4784977_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
WP_000082080.1|4784978_4785746_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 353
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4791462	4803125	4977480		Dickeya_phage(28.57%)	12	NA	NA
WP_000159621.1|4791462_4792317_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
WP_001081705.1|4792562_4793618_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617729.1|4793610_4794279_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
WP_020899340.1|4794281_4795757_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000743275.1|4795882_4796479_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_000906759.1|4796468_4796738_+	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000042852.1|4796759_4797131_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_000964735.1|4797272_4797899_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
WP_020899341.1|4797979_4800178_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.3	7.7e-112
WP_000789682.1|4800377_4802021_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.5e-14
WP_001537663.1|4802044_4802290_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000187489.1|4802459_4803125_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	1.3e-57
>prophage 354
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4808498	4811240	4977480		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000202924.1|4808498_4811240_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 355
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4819484	4821527	4977480		Indivirus(100.0%)	1	NA	NA
WP_000184178.1|4819484_4821527_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 356
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4836241	4837141	4977480		Burkholderia_virus(100.0%)	1	NA	NA
WP_000358045.1|4836241_4837141_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 357
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4865813	4867807	4977480		Bacillus_virus(50.0%)	2	NA	NA
WP_000103558.1|4865813_4866827_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
WP_001196509.1|4866823_4867807_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
>prophage 358
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4885942	4892284	4977480		Escherichia_phage(33.33%)	6	NA	NA
WP_020899362.1|4885942_4888276_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	2.6e-73
WP_000747548.1|4888428_4889091_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_020899363.1|4889320_4890295_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.7	1.6e-16
WP_000190524.1|4890344_4891055_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000455790.1|4891493_4891784_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|4892071_4892284_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 359
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4895559	4895751	4977480	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_001541099.1|4895559_4895751_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
>prophage 360
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4900020	4901016	4977480		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182571.1|4900020_4901016_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.4	9.1e-12
>prophage 361
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4927462	4929313	4977480		Tupanvirus(100.0%)	1	NA	NA
WP_000582390.1|4927462_4929313_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	2.2e-11
>prophage 362
NC_021818	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050, complete sequence	4977480	4953129	4962628	4977480		Rhizobium_phage(16.67%)	9	NA	NA
WP_001273795.1|4953129_4953381_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_001156179.1|4953466_4953898_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116576.1|4954144_4955689_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214125.1|4955698_4956982_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_001135519.1|4956985_4957948_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000798195.1|4957934_4958969_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
WP_000645990.1|4959261_4960287_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_020899380.1|4960296_4961493_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.4e-35
WP_000587771.1|4961695_4962628_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
>prophage 1
NC_021819	Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 plasmid unnamed, complete sequence	122863	34	60367	122863	transposase,protease	Escherichia_phage(19.05%)	60	NA	NA
WP_020833780.1|34_529_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_020833781.1|573_879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833783.1|1363_1639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|1779_1977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833785.1|2964_3222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143017.1|3656_4553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|4555_5071_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|5285_6713_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|6773_6941_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_020833787.1|6963_8283_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|8295_8499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|8562_9768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193208.1|9764_10583_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572379.1|10790_10958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019951.1|11051_11324_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|11446_12562_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|12819_13254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572376.1|13471_14818_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.3e-18
WP_072196614.1|14856_15825_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|16013_17633_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|17709_18186_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572371.1|18398_19748_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	2.9e-08
WP_001572368.1|19723_20392_-	response regulator	NA	W8CYM9	Bacillus_phage	31.9	2.7e-23
WP_077909719.1|20585_21611_-	ExeA family protein	NA	NA	NA	NA	NA
WP_001572363.1|22503_23208_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_001572362.1|23361_24384_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|25429_25759_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|25739_26021_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000019445.1|26298_27279_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_011784790.1|27682_28435_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_020833790.1|28510_30727_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_019677799.1|30749_31223_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_020833791.1|31277_31658_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_020833792.1|31734_33051_-	ferric reductase-like transmembrane domain-containing protein	NA	NA	NA	NA	NA
WP_020833793.1|33219_33885_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	2.3e-27
WP_011786649.1|33874_35200_+	sensor histidine kinase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020833794.1|35190_36330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020833795.1|36546_37128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909722.1|37236_37365_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_020833797.1|39058_39877_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	9.8e-20
WP_011784780.1|39873_40737_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020833798.1|40747_41578_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011783502.1|41587_42598_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	27.5	2.7e-19
WP_011783503.1|42591_43452_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071882548.1|43366_44059_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	38.3	4.0e-22
WP_020833799.1|44811_45567_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	6.0e-56
WP_042846898.1|45579_47121_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.4	1.5e-130
WP_020833802.1|47755_48658_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_020833803.1|48821_50420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071685143.1|50419_50914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|51083_51290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833804.1|51350_52676_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024143021.1|52680_52974_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049827791.1|53374_54727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165590718.1|54808_56048_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	77.7	3.5e-130
WP_000323025.1|56168_56456_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|56455_56695_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000167917.1|56957_57881_-	cation transporter	NA	NA	NA	NA	NA
WP_001515348.1|58080_58653_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_003030308.1|59128_60367_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
