The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021838	Listeria monocytogenes, complete sequence	3034043	636	20159	3034043	terminase	Listeria_phage(88.89%)	33	NA	NA
WP_051149954.1|636_1983_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	93.8	1.4e-252
WP_003733717.1|1948_2674_-	helix-turn-helix domain-containing protein	NA	A0A0B5CTX0	Listeria_phage	68.5	4.4e-80
WP_003733718.1|2717_2945_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	2.4e-32
WP_003733719.1|3220_3655_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	76.4	1.8e-57
WP_003733720.1|3719_4217_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	49.3	1.8e-32
WP_003733721.1|4206_4389_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	1.1e-16
WP_003733722.1|4407_4890_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	73.1	8.5e-56
WP_003733723.1|4890_5145_-	hypothetical protein	NA	A0A059T5G2	Listeria_phage	92.8	3.4e-40
WP_003731837.1|5290_5899_-	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_117125109.1|6288_6531_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003731843.1|6668_6884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731842.1|6895_7063_-	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_023553762.1|7075_7606_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	85.2	2.5e-85
WP_003733626.1|7602_8523_-	hypothetical protein	NA	U5Q085	Bacillus_phage	59.7	2.3e-33
WP_003733627.1|8533_9445_-	recombinase RecT	NA	NA	NA	NA	NA
WP_023553765.1|9437_10949_-	ATPase	NA	A0A2I7SC81	Paenibacillus_phage	36.2	1.7e-73
WP_003733629.1|11181_11370_-	hypothetical protein	NA	Q9T175	Listeria_phage	80.6	1.2e-21
WP_003733630.1|11477_11693_-	hypothetical protein	NA	Q9T176	Listeria_phage	67.6	9.7e-20
WP_003733631.1|11689_12223_-	hypothetical protein	NA	Q9T177	Listeria_phage	87.6	5.5e-80
WP_003733633.1|12345_13125_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	98.1	2.1e-141
WP_003727749.1|13188_13431_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_003727748.1|13423_13585_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003727747.1|13616_13898_-	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	100.0	1.0e-40
WP_003733634.1|13894_14131_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003733635.1|14142_14337_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	93.8	6.9e-25
WP_003733636.1|14340_14592_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	97.6	1.9e-38
WP_003733637.1|14740_15223_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	78.0	1.9e-31
WP_003733638.1|15378_15546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003733640.1|15835_16558_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	97.9	2.8e-103
WP_003733641.1|16580_17186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749252.1|17198_17621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003733643.1|17836_18724_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	100.0	5.6e-162
WP_003733644.1|18800_20159_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	2.5e-254
>prophage 2
NC_021838	Listeria monocytogenes, complete sequence	3034043	164369	172211	3034043		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|164369_165341_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|165348_166317_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|166318_167194_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003731211.1|167301_169032_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.0	2.8e-173
WP_003741152.1|169073_170135_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003731209.1|170151_171135_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	1.5e-51
WP_003722610.1|171251_172211_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 3
NC_021838	Listeria monocytogenes, complete sequence	3034043	258669	325011	3034043	protease,tail,integrase,terminase,tRNA,holin	Listeria_phage(85.45%)	87	285901:285950	325099:325148
WP_003728400.1|258669_260340_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|260336_260786_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003726106.1|260863_261517_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_071661788.1|261551_261776_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003731604.1|261810_263133_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.4	1.9e-28
WP_003726109.1|263147_263984_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003723615.1|264301_264502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|264524_264848_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014930032.1|265001_266663_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|266797_267412_-	SdpI family protein	NA	NA	NA	NA	NA
WP_003726113.1|267435_268068_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003726114.1|268068_268593_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_003731606.1|268595_269594_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003731607.1|269690_269963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726117.1|270011_270923_-	cation transporter	NA	NA	NA	NA	NA
WP_003731608.1|271300_272128_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003731609.1|272242_273118_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003728392.1|273128_273422_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003733660.1|273371_273578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728390.1|273646_274315_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	6.5e-38
WP_003726476.1|274314_275403_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003731610.1|275481_276861_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	44.3	1.5e-57
WP_003731611.1|276857_277535_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.6	3.4e-58
WP_003726479.1|277581_278367_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003731613.1|278428_278905_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003728388.1|278904_281892_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003728387.1|282389_283232_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003728386.1|283281_284763_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003728385.1|284863_285751_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
285901:285950	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_003731277.1|286374_286608_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|286639_286891_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003722518.1|286891_287341_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003733661.1|287365_287863_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722520.1|288137_288911_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003733663.1|288951_289797_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	94.7	2.7e-137
WP_003722522.1|289796_290078_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|290090_290456_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_023553771.1|290494_292660_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.3	0.0e+00
WP_003733727.1|292672_294241_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	3.1e-304
WP_023553773.1|294237_299028_-|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	88.4	0.0e+00
WP_077286899.1|299032_299344_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	97.8	3.4e-42
WP_003733698.1|299340_299772_-	hypothetical protein	NA	A8ATV7	Listeria_phage	97.9	4.0e-73
WP_003733697.1|299827_300517_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_003725064.1|300521_300893_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_003733696.1|300889_301207_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|301196_301562_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|301561_301915_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003723786.1|301915_302071_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003723787.1|302084_302957_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003733694.1|302979_303534_-	hypothetical protein	NA	A8ATU9	Listeria_phage	88.6	3.8e-84
WP_003733693.1|303628_304672_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.4	1.0e-194
WP_003733692.1|304676_306236_-	hypothetical protein	NA	A8ATU7	Listeria_phage	96.9	9.2e-293
WP_003725072.1|306250_307597_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	94.1	2.7e-253
WP_003733714.1|307562_308303_-	hypothetical protein	NA	A8ATU5	Listeria_phage	98.8	7.0e-134
WP_003725074.1|308342_308570_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	1.8e-32
WP_097529926.1|308854_309274_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	42.5	8.8e-17
WP_003733712.1|309562_309979_-	hypothetical protein	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	38.9	1.2e-10
WP_003733711.1|310093_310492_-	hypothetical protein	NA	A8AU00	Listeria_phage	78.8	1.0e-54
WP_110109835.1|310457_310598_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	50.0	5.7e-05
WP_003733709.1|310623_311106_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	76.2	1.7e-59
WP_003733708.1|311106_311319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733707.1|311323_311818_-	hypothetical protein	NA	A0A1S5SDR7	Streptococcus_phage	47.6	6.1e-33
WP_023553777.1|311840_312053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031674202.1|312158_312473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162007589.1|312489_312723_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	68.5	1.2e-15
WP_003733704.1|312742_313009_-	hypothetical protein	NA	R4IBL5	Listeria_phage	88.4	1.3e-34
WP_023553779.1|313005_313632_-	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	45.4	3.1e-34
WP_003731843.1|313628_313844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731842.1|313855_314023_-	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_023553782.1|314035_314566_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	86.4	3.5e-87
WP_003733679.1|314562_315477_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	84.9	8.4e-129
WP_003723965.1|315514_316426_-	recombinase RecT	NA	NA	NA	NA	NA
WP_003723967.1|316418_317930_-	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_003722564.1|318162_318351_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003733681.1|318453_318660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003733682.1|318649_319180_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	89.6	2.7e-79
WP_003733683.1|319303_320080_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733684.1|320143_320341_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_003722567.1|320342_320624_-	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733686.1|320649_320934_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003733687.1|320945_321140_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733688.1|321160_321370_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003724014.1|321535_321958_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003724015.1|321973_322399_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724016.1|322413_323121_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_003724017.1|323179_323785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724018.1|323847_325011_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	4.4e-50
325099:325148	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
>prophage 4
NC_021838	Listeria monocytogenes, complete sequence	3034043	740858	747385	3034043	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|740858_741311_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|741316_741652_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|741868_742297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|742308_742725_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|743004_743394_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|743406_743919_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|743966_744269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|744310_744715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|744701_746570_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003731179.1|746566_747385_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	5.5e-39
>prophage 5
NC_021838	Listeria monocytogenes, complete sequence	3034043	856318	864604	3034043		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003729814.1|856318_857611_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_003731571.1|857691_858405_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	3.9e-41
WP_003722248.1|858416_858662_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726212.1|858665_859349_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003731570.1|859341_861561_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003722245.1|861545_862973_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003726210.1|862991_864041_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003731569.1|864037_864604_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.5	2.8e-26
>prophage 6
NC_021838	Listeria monocytogenes, complete sequence	3034043	1355433	1414031	3034043	tRNA,protease	Streptococcus_phage(16.67%)	56	NA	NA
WP_003726416.1|1355433_1357140_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003726415.1|1357180_1358443_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003731335.1|1358456_1359599_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003727496.1|1359613_1360402_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003727497.1|1360415_1361174_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|1361404_1361962_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|1361961_1362690_-	UMP kinase	NA	NA	NA	NA	NA
WP_003727498.1|1362982_1363357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012681273.1|1363334_1364540_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003731336.1|1364529_1365834_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_003726669.1|1365843_1366350_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003726668.1|1366371_1367103_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726667.1|1367151_1367391_-	YneF family protein	NA	NA	NA	NA	NA
WP_003731337.1|1367611_1369606_-	transketolase	NA	NA	NA	NA	NA
WP_003727501.1|1369752_1369980_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003727502.1|1370073_1370403_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|1370558_1371173_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003726565.1|1371203_1371728_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003731338.1|1371761_1373057_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	1.3e-146
WP_003723435.1|1373200_1374535_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|1374605_1374974_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727505.1|1375175_1376402_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_012681271.1|1376394_1377618_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|1377728_1377962_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003726658.1|1378083_1379001_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|1379127_1380804_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726657.1|1381036_1381735_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	6.4e-12
WP_003727507.1|1381947_1383834_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_003731305.1|1383866_1385687_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003726814.1|1386314_1386782_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003727509.1|1386864_1389324_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003727510.1|1389320_1391288_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_003731304.1|1391468_1391876_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003726698.1|1392033_1392630_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003726697.1|1392671_1393544_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|1393546_1393858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727513.1|1393880_1394300_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|1394402_1395182_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003727514.1|1395202_1396612_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003724001.1|1396625_1397165_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003731303.1|1397185_1398088_-	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003731302.1|1398370_1399675_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003727517.1|1399737_1401816_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003727518.1|1402088_1402949_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727519.1|1403082_1403868_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003726396.1|1403864_1404728_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727520.1|1404737_1405280_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003731301.1|1405381_1405951_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003726393.1|1405985_1406552_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|1406670_1407930_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|1408114_1409398_-	trigger factor	NA	NA	NA	NA	NA
WP_003727521.1|1409512_1410451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727523.1|1411393_1411927_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003727524.1|1412050_1412266_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003723563.1|1412416_1412812_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727526.1|1412891_1414031_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NC_021838	Listeria monocytogenes, complete sequence	3034043	1439262	1481835	3034043	protease,tail,capsid,integrase,terminase,holin,portal	Listeria_phage(94.34%)	62	1437238:1437261	1481853:1481876
1437238:1437261	attL	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
WP_023553808.1|1439262_1439496_-	hypothetical protein	NA	A8ATC5	Listeria_phage	97.4	2.8e-36
WP_023553810.1|1439937_1440147_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	100.0	1.9e-28
WP_023553812.1|1440476_1440854_+	anti-CRISPR protein AcrIIA3	NA	A0A059T686	Listeria_phage	90.4	1.2e-60
WP_023553814.1|1440885_1441236_+	AcrIIA2 family anti-CRISPR protein	NA	Q9T195	Listeria_phage	96.6	1.8e-55
WP_012581438.1|1441240_1441690_+	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	97.3	3.8e-74
WP_012951560.1|1441909_1442908_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_023553816.1|1443010_1443718_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	98.7	1.2e-130
WP_003723294.1|1443717_1443999_-|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_003733957.1|1443998_1444304_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_023553818.1|1444354_1445446_-	hypothetical protein	NA	A0A059T7R4	Listeria_phage	91.2	7.3e-188
WP_023553820.1|1445435_1447730_-|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.8	0.0e+00
WP_023553822.1|1447745_1449395_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_023553824.1|1449387_1454307_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.6	0.0e+00
WP_009931626.1|1454310_1454472_-	hypothetical protein	NA	A0A059T6F4	Listeria_phage	98.0	4.3e-20
WP_014929553.1|1454522_1454855_-	hypothetical protein	NA	A0A059T7R2	Listeria_phage	96.4	2.5e-51
WP_014929552.1|1454925_1455513_-|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
WP_009929557.1|1455533_1455917_-	hypothetical protein	NA	A0A059T681	Listeria_phage	97.6	9.4e-66
WP_009929555.1|1455913_1456315_-	hypothetical protein	NA	A8ATA2	Listeria_phage	94.7	4.9e-65
WP_009929554.1|1456311_1456677_-	hypothetical protein	NA	A0A059T6F2	Listeria_phage	98.3	7.1e-63
WP_023553826.1|1456660_1456960_-	hypothetical protein	NA	A0A059T7R0	Listeria_phage	99.0	1.2e-47
WP_023550473.1|1456969_1457140_-	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	98.2	1.8e-21
WP_023553829.1|1457146_1458298_-|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.2	1.8e-213
WP_009928004.1|1458324_1459041_-|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.4	5.5e-67
WP_009928005.1|1459037_1460168_-|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	95.5	4.6e-209
WP_009928006.1|1460218_1460608_+	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	4.8e-17
WP_023553831.1|1460617_1462261_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.2	0.0e+00
WP_031668694.1|1462257_1462614_-|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	96.0	1.0e-45
WP_003731652.1|1462662_1462977_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	3.2e-56
WP_003731654.1|1463566_1463992_-	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_003731655.1|1464004_1464232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731656.1|1464292_1464448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731657.1|1464476_1464746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023553835.1|1464742_1465282_-	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	76.0	8.6e-73
WP_003731659.1|1465728_1465941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951539.1|1465942_1466260_-	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_023553837.1|1466598_1468872_-	primase	NA	R4IBW2	Listeria_phage	95.5	0.0e+00
WP_023553839.1|1468894_1469380_-	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	98.8	1.1e-87
WP_031659492.1|1469404_1470661_-	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	94.5	6.0e-218
WP_023553843.1|1470724_1471414_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	98.3	4.8e-129
WP_003731665.1|1471433_1471913_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_023553845.1|1471916_1472294_-	hypothetical protein	NA	A8ATE8	Listeria_phage	66.9	2.7e-41
WP_023553848.1|1472290_1472464_-	hypothetical protein	NA	A8ATE7	Listeria_phage	98.2	4.0e-24
WP_003731670.1|1472797_1473064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1473053_1473284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731672.1|1473280_1473514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731705.1|1473968_1474241_-	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731704.1|1474237_1474567_-	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_014601509.1|1474567_1474777_-	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_014601510.1|1474773_1475175_-	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014929526.1|1475252_1475399_-	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_014601511.1|1475395_1475956_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	100.0	9.4e-107
WP_023553856.1|1475960_1476416_-	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	92.1	1.5e-81
WP_031644438.1|1476424_1476955_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	98.3	8.9e-99
WP_009931096.1|1477142_1477295_-	hypothetical protein	NA	A0A059T7S2	Listeria_phage	98.0	3.4e-19
WP_023553860.1|1477529_1477715_-	hypothetical protein	NA	A8ATD3	Listeria_phage	93.4	5.4e-27
WP_003730996.1|1477717_1477960_-	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730995.1|1477981_1478173_-	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730994.1|1478239_1478443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014601389.1|1478843_1479167_+	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	73.8	6.3e-39
WP_014601388.1|1479183_1479636_+	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	86.0	1.0e-74
WP_014930257.1|1479687_1480551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553862.1|1480680_1481835_+|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	95.3	3.0e-208
1481853:1481876	attR	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
>prophage 8
NC_021838	Listeria monocytogenes, complete sequence	3034043	1601953	1609375	3034043		Hokovirus(33.33%)	8	NA	NA
WP_012681222.1|1601953_1603510_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
WP_003724635.1|1603638_1604043_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003724634.1|1604102_1604411_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003727000.1|1604423_1605248_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003721509.1|1605259_1606750_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727001.1|1606958_1607972_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003727002.1|1607986_1608970_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003730941.1|1608991_1609375_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 9
NC_021838	Listeria monocytogenes, complete sequence	3034043	3015185	3030470	3034043	holin,tail	Listeria_phage(94.12%)	17	NA	NA
WP_003733517.1|3015185_3015617_+	hypothetical protein	NA	A8ATJ2	Listeria_phage	81.7	4.1e-25
WP_003733518.1|3015613_3016114_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	71.8	1.4e-64
WP_012951560.1|3016319_3017318_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003733520.1|3017420_3018266_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	92.6	1.9e-135
WP_003733521.1|3018265_3018532_-|holin	phage holin	holin	A0A059T684	Listeria_phage	93.1	9.8e-38
WP_003733522.1|3018531_3018834_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	92.1	7.7e-39
WP_014601493.1|3018884_3021050_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.5	0.0e+00
WP_003733727.1|3021062_3022631_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	3.1e-304
WP_023553906.1|3022627_3027427_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	90.2	0.0e+00
WP_077286899.1|3027431_3027743_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	97.8	3.4e-42
WP_003733698.1|3027739_3028171_-	hypothetical protein	NA	A8ATV7	Listeria_phage	97.9	4.0e-73
WP_003733697.1|3028226_3028916_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_003725064.1|3028920_3029292_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_003733696.1|3029288_3029606_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|3029595_3029961_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|3029960_3030314_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003723786.1|3030314_3030470_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
>prophage 1
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	0	3664	57557		Marinitoga_camini_virus(50.0%)	5	NA	NA
WP_012952173.1|254_599_-	TnpV protein	NA	NA	NA	NA	NA
WP_003728485.1|1311_1710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|1883_2219_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_003728487.1|2255_2786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728488.1|2899_3664_-	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
>prophage 2
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	8339	11011	57557	transposase	Lactococcus_phage(66.67%)	3	NA	NA
WP_003728496.1|8339_9566_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
WP_013315180.1|9576_10332_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	2.4e-81
WP_023553716.1|10423_11011_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.5e-33
>prophage 3
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	14448	24054	57557	transposase,protease	Enterococcus_phage(16.67%)	11	NA	NA
WP_003728501.1|14448_15423_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
WP_003728502.1|15400_15697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728503.1|15747_17028_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003728504.1|17015_17360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728505.1|17564_18299_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013315188.1|18473_19814_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
WP_003728507.1|20089_22204_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
WP_003728509.1|22631_22868_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
WP_003731679.1|22830_23109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728510.1|23228_23456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728511.1|23445_24054_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
>prophage 4
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	27383	44475	57557	transposase	Lactobacillus_phage(27.27%)	19	NA	NA
WP_003728514.1|27383_27638_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
WP_115914824.1|27634_28522_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.1	7.3e-69
WP_003731678.1|28611_29328_-	AP2 domain-containing protein	NA	O03945	Lactobacillus_phage	31.0	3.8e-20
WP_003728517.1|29343_30066_-	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003728518.1|30069_30495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728519.1|30495_30744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728520.1|30865_31354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003769263.1|31512_31890_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	55.1	2.2e-14
WP_003731676.1|31908_32571_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003728462.1|32570_32897_-	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003728463.1|33027_33279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728464.1|33339_33582_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728465.1|33575_33917_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728466.1|34109_36245_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728467.1|36244_36604_-	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728468.1|36883_37438_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728469.1|37441_40357_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728471.1|41539_43636_-	copper-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	31.0	1.1e-70
WP_003728472.1|43911_44475_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
>prophage 5
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	48267	50912	57557	transposase	Streptococcus_phage(100.0%)	2	NA	NA
WP_043993356.1|48267_48909_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
WP_003728476.1|49028_50912_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
>prophage 6
NC_021828	Listeria monocytogenes plasmid unnamed, complete sequence	57557	54124	56793	57557	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
WP_003728481.1|54124_55489_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
WP_002389568.1|56112_56793_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
