The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021659	Serratia plymuthica S13, complete sequence	5467306	796959	874537	5467306	integrase,tail,plate,tRNA	Erwinia_phage(22.22%)	82	803676:803694	831042:831060
WP_006323649.1|796959_797721_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	3.5e-56
WP_006323650.1|797714_798341_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.1e-34
WP_006323651.1|798666_799653_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	7.9e-08
WP_004950287.1|799707_800706_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	9.4e-33
WP_144080255.1|800786_803342_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.4	2.6e-26
WP_020438448.1|803581_804865_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	27.8	5.3e-20
803676:803694	attL	GAGGCTTGCGTGTTACTTG	NA	NA	NA	NA
WP_020438449.1|804884_806102_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_020438450.1|806121_806745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080229.1|806991_807261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438452.1|807406_807799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071825592.1|808414_809731_+	serine/threonine protein kinase	NA	M1ICX0	Acanthocystis_turfacea_Chlorella_virus	26.9	4.2e-12
WP_187293377.1|809755_810454_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_020438455.1|810533_810869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438456.1|810899_811259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040211792.1|811273_811801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039695432.1|811990_812365_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.8	1.1e-05
WP_044033779.1|812634_813027_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_041417689.1|813146_813608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041417529.1|813609_814062_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_020438462.1|814108_815038_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	30.0	4.7e-10
WP_020438463.1|815078_815606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001543679.1|815892_816099_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_020438464.1|816095_816974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020438465.1|817141_818830_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.7	2.7e-24
WP_020438466.1|818885_819635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438467.1|819653_820106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438468.1|821153_822626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020438469.1|823042_823750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071825593.1|824637_825405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041417530.1|825580_827542_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_071825594.1|827538_828027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438473.1|828023_829247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438474.1|829830_830001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020438475.1|829997_830615_-	Fic family protein	NA	NA	NA	NA	NA
WP_006317708.1|831690_832008_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
831042:831060	attR	GAGGCTTGCGTGTTACTTG	NA	NA	NA	NA
WP_013811541.1|832019_833381_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_020438476.1|833429_834815_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_013811543.1|834814_835678_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_006323656.1|835830_836592_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_006323665.1|836626_838012_-	MFS transporter	NA	NA	NA	NA	NA
WP_006323667.1|838266_838755_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.4	2.6e-28
WP_004950320.1|838867_839932_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	6.4e-112
WP_004950322.1|840016_840523_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_020438477.1|840655_843283_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	3.8e-81
WP_004950328.1|843535_843721_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_004950329.1|845086_845653_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_037430245.1|845649_846078_+	DedA family protein	NA	NA	NA	NA	NA
WP_020438478.1|846160_847723_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004950350.1|847889_848405_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_004950356.1|848474_849764_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_006323686.1|849806_850598_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_006323687.1|850767_852129_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|852345_852594_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004950368.1|852612_853161_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_006323688.1|853213_853981_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004950372.1|854035_854392_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004950376.1|854554_854773_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	2.8e-22
WP_006323690.1|854861_855953_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	49.0	5.5e-103
WP_006323691.1|855949_856414_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	59.0	8.5e-45
WP_020438480.1|856430_858428_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	31.0	1.7e-17
WP_006323693.1|858420_858555_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	78.9	1.1e-10
WP_006323694.1|858575_858863_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	60.2	3.9e-24
WP_006323695.1|858926_859436_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.3e-65
WP_006323696.1|859449_860619_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.2	1.3e-182
WP_006323697.1|860760_861309_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.8	1.4e-33
WP_006323698.1|861305_862769_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	37.9	6.8e-64
WP_144080230.1|862805_863519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438483.1|863515_865588_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.4	4.8e-31
WP_006323701.1|865584_866193_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	55.4	1.9e-60
WP_006323702.1|866185_867094_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	78.5	3.3e-125
WP_006323703.1|867098_867449_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	65.5	1.9e-36
WP_006323704.1|867445_868081_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	58.8	5.0e-64
WP_006323705.1|868169_868634_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.3	4.8e-40
WP_020438484.1|868703_869216_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.7	1.4e-56
WP_041417532.1|869231_869417_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	2.4e-06
WP_037430256.1|869420_869624_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	2.8e-21
WP_020438485.1|869830_870025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438486.1|870355_870577_-	TraR/DksA C4-type zinc finger protein	NA	A0A0M4S5Q7	Salmonella_phage	52.9	3.4e-12
WP_006323711.1|870652_870961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006323712.1|871190_872087_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.7	5.4e-64
WP_004950379.1|872133_872898_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_006323715.1|873463_874537_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.3	2.6e-89
>prophage 2
NC_021659	Serratia plymuthica S13, complete sequence	5467306	2198440	2238441	5467306	protease,transposase,coat	Moraxella_phage(25.0%)	36	NA	NA
WP_004943492.1|2198440_2199373_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020438902.1|2199391_2201881_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_006324878.1|2201888_2202653_-	molecular chaperone	NA	NA	NA	NA	NA
WP_020438903.1|2202676_2203225_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_006324879.1|2203230_2203734_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004943503.1|2203736_2204276_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_006324880.1|2204546_2205983_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_006324881.1|2206085_2208716_-	PqiB family protein	NA	NA	NA	NA	NA
WP_006324882.1|2208684_2209932_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_006324884.1|2210536_2211034_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004943519.1|2211129_2211840_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_004943522.1|2211859_2213905_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	9.8e-85
WP_004943526.1|2214565_2215444_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_041417722.1|2215491_2216886_-	MFS transporter	NA	NA	NA	NA	NA
WP_004943529.1|2217116_2217908_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_006324887.1|2218035_2219427_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004943534.1|2219609_2220158_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	36.1	3.7e-07
WP_004943536.1|2220607_2221273_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_004943539.1|2221336_2222629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004943543.1|2222824_2223385_+	YniB family protein	NA	NA	NA	NA	NA
WP_004943546.1|2223425_2224295_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_004943550.1|2224550_2225000_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006324890.1|2225037_2225898_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_006324891.1|2225897_2226758_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_013812621.1|2226757_2227648_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.5	5.5e-08
WP_006324893.1|2227644_2228589_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006324894.1|2228719_2229019_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_004943568.1|2229128_2229794_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	48.1	2.0e-07
WP_006324895.1|2230103_2230823_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004943573.1|2230825_2232607_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_006324896.1|2232619_2233957_+	cytochrome c	NA	NA	NA	NA	NA
WP_006324897.1|2234212_2235496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020438905.1|2235647_2236781_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172458735.1|2236819_2237497_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_020438906.1|2237643_2237868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020438907.1|2238153_2238441_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_021659	Serratia plymuthica S13, complete sequence	5467306	4858381	4920712	5467306	integrase,protease,head,tRNA,capsid,tail	uncultured_Caudovirales_phage(33.33%)	52	4910152:4910211	4920898:4920977
WP_004948605.1|4858381_4859722_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004948607.1|4859899_4860448_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004948609.1|4860478_4860778_-	barstar family protein	NA	NA	NA	NA	NA
WP_004948611.1|4860783_4861233_-	ribonuclease N1	NA	NA	NA	NA	NA
WP_020439863.1|4861486_4863454_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_020439864.1|4863453_4864389_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_004948617.1|4864396_4864600_-	AaeX family protein	NA	NA	NA	NA	NA
WP_004948619.1|4864908_4865820_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_037433696.1|4865782_4866160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020439866.1|4866368_4867310_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_020439867.1|4867672_4867957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187293384.1|4868306_4868807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080654427.1|4869037_4869586_-	DUF3916 domain-containing protein	NA	NA	NA	NA	NA
WP_020439870.1|4871708_4871927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037431823.1|4873612_4873903_-	barstar family protein	NA	NA	NA	NA	NA
WP_020439873.1|4873905_4883919_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.3	2.3e-30
WP_020439874.1|4883945_4885619_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004948634.1|4885887_4887333_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004948637.1|4887340_4888201_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_020439875.1|4888197_4892010_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_004948644.1|4892105_4893575_-	ribonuclease G	NA	NA	NA	NA	NA
WP_004948648.1|4893612_4894197_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004948651.1|4894205_4894694_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004948652.1|4894690_4895695_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004948655.1|4895789_4896833_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_020439876.1|4897245_4899177_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_020439877.1|4899484_4900462_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004948661.1|4900708_4901710_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_006328310.1|4901710_4902310_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004948665.1|4902551_4903004_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004948669.1|4903036_4903504_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004948672.1|4903514_4904864_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_020439878.1|4905017_4905260_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004948678.1|4905249_4906695_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_020439879.1|4906706_4907588_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004948687.1|4907779_4908514_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_004948691.1|4908884_4909850_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4909871_4910168_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
4910152:4910211	attL	AATACGGCATGAACTGATACTAGTCAGTCAGGTTGTTGAAAAAAGGCGCTTTATCTCATT	NA	NA	NA	NA
WP_020439880.1|4910339_4911023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041417783.1|4911659_4912286_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	53.8	3.1e-50
WP_020439882.1|4912651_4913005_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_020439883.1|4913014_4913353_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	44.7	4.2e-09
WP_020439884.1|4913363_4914407_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.2	3.4e-65
WP_020439885.1|4914956_4917044_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.9	3.3e-72
WP_020439886.1|4917040_4917391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020439887.1|4917383_4917578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020439888.1|4917570_4917756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020439889.1|4917748_4917928_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_187293375.1|4918057_4918228_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	45.5	1.7e-06
WP_041417660.1|4918398_4918614_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	80.0	1.3e-19
WP_020439891.1|4918748_4919492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020439892.1|4919488_4920712_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	66.3	6.1e-167
4920898:4920977	attR	AATACGGCATGAACTGATACTAGTCAGTCAGGTTGTTGAAAAAAGGCGCTTTATCTCATTTGATAAGCGCCTTTTTCTTT	NA	NA	NA	NA
