The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	490341	541407	4915960	tRNA,tail,plate	Burkholderia_phage(37.5%)	51	NA	NA
WP_001285165.1|490341_491289_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|491304_491814_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|491945_493070_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|493041_493515_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|493541_494084_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063615.1|494088_494661_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.3	1.3e-10
WP_000451198.1|494665_495484_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001076449.1|495480_495738_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285626.1|495713_496268_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000973244.1|502307_502745_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|502901_503831_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069371.1|504099_505701_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857882.1|505732_507037_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|507138_508890_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|508853_509261_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|509271_510096_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095969.1|510399_514083_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.7e-26
WP_000956811.1|514349_515981_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421793.1|516070_516760_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|516831_516933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|516967_517507_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000954618.1|517553_518423_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|518419_518692_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_001068168.1|518754_519513_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000924651.1|519499_520363_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000472331.1|520379_521219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099738.1|521242_522721_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_001177098.1|523254_523770_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
WP_000368212.1|523779_525261_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_000359503.1|525263_525896_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951728.1|525888_527004_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_001093501.1|526994_527354_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632052.1|527517_529065_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_000703634.1|529064_529994_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|529990_530353_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_012512893.1|530428_530668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679396.1|530676_531399_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000818152.1|531408_532452_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_001269716.1|532439_532649_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271429.1|532648_533602_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262484.1|533601_535956_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_001185656.1|536052_536181_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|536140_536458_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907495.1|536509_537034_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729849.1|537033_538461_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000875314.1|538450_538648_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|538644_539100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|539259_539574_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|539586_540192_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|540194_540482_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|541059_541407_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	1842677	1879496	4915960	terminase,tail,portal,integrase,head,protease,lysis	Salmonella_phage(45.61%)	58	1842588:1842612	1879765:1879789
1842588:1842612	attL	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
WP_000533680.1|1842677_1843748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.6	3.0e-154
WP_001556007.1|1843725_1843944_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_001060559.1|1844120_1845095_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	44.0	5.2e-28
WP_000208026.1|1845164_1845398_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	91.1	6.0e-15
WP_000161224.1|1845401_1845620_-	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000065091.1|1845621_1846218_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	55.2	8.7e-42
WP_020924094.1|1846214_1846739_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	64.8	1.6e-39
WP_001214773.1|1846750_1846924_-	DUF2737 family protein	NA	A0A2H4FUQ1	Salmonella_phage	96.5	2.1e-25
WP_001111323.1|1846934_1847228_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
WP_001016182.1|1847243_1847792_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_024143555.1|1847800_1848280_-	hypothetical protein	NA	Q716E9	Shigella_phage	91.2	1.6e-86
WP_000168278.1|1848288_1848747_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
WP_001046987.1|1848747_1849455_-	recombinase	NA	B8K1D9	Salmonella_phage	96.2	6.7e-134
WP_000156731.1|1849584_1849773_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001670815.1|1849753_1849927_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_071825053.1|1850121_1851105_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	82.6	8.3e-74
WP_000246166.1|1851188_1851383_-	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_000219336.1|1851653_1851959_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
WP_000233126.1|1852326_1852695_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000428318.1|1852713_1853430_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1853536_1853731_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_001177653.1|1853839_1854118_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000220588.1|1854152_1854797_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000050079.1|1854783_1855626_+	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.0e-128
WP_000171135.1|1855628_1856474_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	73.6	2.1e-110
WP_000145948.1|1856470_1856761_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001036029.1|1856757_1857027_+	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_000796285.1|1857099_1857426_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
WP_000049638.1|1857422_1857623_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000344577.1|1857634_1857886_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	65.5	2.9e-23
WP_024135733.1|1857889_1858096_+	hypothetical protein	NA	I1TEG6	Salmonella_phage	98.5	2.7e-35
WP_000736889.1|1858110_1858548_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
WP_000679702.1|1858544_1858718_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113769.1|1858684_1858861_+	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	3.0e-27
WP_000566850.1|1858857_1859037_+	protein ninF	NA	I6R994	Salmonella_phage	94.9	1.1e-27
WP_001224087.1|1859011_1859620_+	protein ninG	NA	I6S604	Salmonella_phage	95.0	2.9e-93
WP_001028837.1|1859616_1860288_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	2.0e-127
WP_000512805.1|1860278_1860797_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	2.2e-94
WP_000286100.1|1861260_1861464_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001670814.1|1861441_1861939_+	lysozyme	NA	I6R0P2	Salmonella_phage	100.0	9.9e-92
WP_001670813.1|1862027_1862465_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.9	6.5e-71
WP_000191867.1|1862543_1863071_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.6	3.3e-45
WP_000807823.1|1863366_1863609_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.8	8.3e-36
WP_000542583.1|1863610_1863790_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	2.1e-23
WP_000190002.1|1863813_1864236_+	hypothetical protein	NA	Q716H4	Shigella_phage	99.3	3.6e-74
WP_000200777.1|1864232_1865648_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.2	3.2e-276
WP_001535486.1|1865649_1867848_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_000372591.1|1867938_1868832_+	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	84.2	2.6e-114
WP_000013269.1|1868850_1870104_+	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	98.3	1.0e-233
WP_001362792.1|1870145_1870334_+	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1870314_1870776_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122372.1|1870785_1872204_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.9e-274
WP_000774929.1|1872207_1872909_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	92.3	4.7e-71
WP_000627705.1|1872908_1873364_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	98.7	4.4e-86
WP_000964873.1|1873366_1874059_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_000246943.1|1874068_1875364_+	DNA injection protein	NA	Q716G3	Shigella_phage	84.0	2.1e-181
WP_001029850.1|1875363_1877355_+	hypothetical protein	NA	A0A1R3Y5Q1	Salmonella_virus	96.6	0.0e+00
WP_024143557.1|1877639_1879496_+|tail	tail protein	tail	S4TVJ1	Salmonella_phage	90.1	2.3e-274
1879765:1879789	attR	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
>prophage 3
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	2003985	2011299	4915960	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201748.1|2003985_2005104_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
WP_000125893.1|2005100_2007047_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|2007176_2007398_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2007721_2008042_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|2008072_2010349_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|2010562_2010760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670446.1|2010921_2011299_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
>prophage 4
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	2061650	2203965	4915960	holin,terminase,tail,portal,integrase,head,tRNA,protease,lysis	Salmonella_phage(51.4%)	167	2159587:2159646	2201453:2201530
WP_001154027.1|2061650_2062454_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2062446_2063769_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|2063749_2064454_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|2064453_2068920_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925875.1|2069264_2071112_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2071371_2071920_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2071947_2072595_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2072656_2073847_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|2074031_2075123_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117870.1|2075729_2077130_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762343.1|2077330_2077792_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|2077788_2078022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544853.1|2078108_2079323_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893197.1|2079568_2081002_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191406.1|2081082_2082285_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|2082479_2083772_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|2083816_2084065_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|2084105_2084345_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|2084387_2085545_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|2085507_2088393_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|2088519_2088819_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|2088840_2088999_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|2088991_2089252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|2089301_2089712_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|2089831_2090071_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|2090036_2090411_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|2090495_2091479_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|2091481_2092231_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|2092241_2092589_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|2092585_2092897_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|2092974_2093265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2093556_2093790_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|2093901_2094123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|2094205_2094808_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|2094807_2095014_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|2095016_2095628_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|2095624_2095771_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|2095760_2096558_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|2096624_2096942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2097115_2097241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|2097376_2097826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|2098186_2098873_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|2099148_2099478_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2099461_2099914_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2099931_2100411_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|2100618_2101152_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|2101108_2103247_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|2103243_2103450_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|2103476_2104994_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|2104917_2106999_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|2107089_2107413_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|2107405_2107705_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|2107685_2108252_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|2108248_2108650_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|2108661_2109411_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|2109456_2109855_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|2109851_2110181_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|2110260_2113248_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|2113244_2113577_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|2113675_2114173_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|2114289_2114823_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|2114912_2115608_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|2115617_2116355_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|2116252_2116957_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|2120417_2120660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|2120713_2123152_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|2123151_2123733_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|2124208_2125177_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|2125824_2126451_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|2126519_2126819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|2126803_2127490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2127760_2127952_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193770.1|2128378_2130991_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|2131198_2132209_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001670452.1|2132374_2132917_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224072.1|2132913_2134023_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2134121_2136230_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2136242_2138150_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|2138164_2139418_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|2139422_2141063_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2141059_2141623_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2141878_2142046_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2142145_2142664_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|2142732_2144493_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2144678_2145131_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|2145202_2146255_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2146611_2147121_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2147337_2147943_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|2147929_2150083_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2150101_2150548_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420513.1|2150671_2152726_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_000424187.1|2152761_2153220_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|2153314_2153977_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|2154147_2154564_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2154608_2154926_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140482.1|2154983_2156195_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859429.1|2156409_2156958_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|2156983_2157763_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2157811_2158093_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2158089_2158419_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2158505_2159165_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2159587:2159646	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_000533596.1|2159752_2160772_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000196402.1|2160772_2160997_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_024131616.1|2160962_2161160_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
WP_000916251.1|2161209_2161392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205292.1|2161394_2161949_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000158391.1|2161945_2164210_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_001192832.1|2164239_2164485_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000387662.1|2164492_2164816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000467661.1|2165500_2165965_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_001670726.1|2166063_2166297_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
WP_001526889.1|2166211_2166427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643782.1|2166361_2166808_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001195066.1|2166830_2167055_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_000063056.1|2167057_2168038_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_000074839.1|2168034_2169423_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000130738.1|2169460_2170141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918617.1|2170144_2170393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037052.1|2170385_2170988_+	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000180135.1|2170984_2171155_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001129735.1|2171154_2171493_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000474096.1|2171676_2171868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090037.1|2171936_2172533_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000717784.1|2172529_2172823_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000640103.1|2172819_2173398_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000658037.1|2173790_2173979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|2174181_2174484_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000951228.1|2174461_2175001_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_086374239.1|2175318_2175774_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_001118126.1|2176274_2176904_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_001130808.1|2176906_2178529_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_000113503.1|2178528_2179998_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_137911068.1|2179882_2180629_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000873181.1|2180632_2181865_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_000128057.1|2181869_2182367_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627463.1|2182378_2183320_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_001040693.1|2183361_2183751_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_001125672.1|2183716_2184124_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_000008738.1|2184120_2184675_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001121925.1|2184661_2185051_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_001670724.1|2185025_2185589_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001135539.1|2185592_2186738_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_000535992.1|2186750_2187194_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_000389049.1|2187197_2187650_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_024131618.1|2187661_2187838_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_000990866.1|2187827_2189837_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000353826.1|2189836_2190412_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000155111.1|2190411_2190714_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000081749.1|2190716_2191784_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000819157.1|2191780_2192113_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000931859.1|2192196_2192652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000301078.1|2192770_2193523_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_001270641.1|2193522_2193876_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_001197089.1|2193876_2195076_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_000049939.1|2195072_2195753_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001670454.1|2195752_2197285_+	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000421108.1|2197299_2197818_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_071786695.1|2198066_2198252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370530.1|2198314_2198923_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_000033280.1|2199032_2199425_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_127913510.1|2199622_2199868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2200050_2200248_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_000503667.1|2200290_2200938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670820.1|2200994_2201261_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
WP_000938182.1|2201649_2202330_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
2201453:2201530	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
WP_001123040.1|2202551_2203427_-	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_010989012.1|2203644_2203965_+	membrane protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
>prophage 5
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	3103414	3114064	4915960		Morganella_phage(25.0%)	12	NA	NA
WP_001157313.1|3103414_3104845_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377036.1|3104918_3105614_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_000107431.1|3105693_3106005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|3106654_3107851_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|3108108_3108297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3108307_3108520_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|3108974_3110243_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394197.1|3110245_3110665_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001529333.1|3110791_3110953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|3111433_3112231_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001670523.1|3112602_3112893_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_001219019.1|3113539_3114064_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 6
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	3207195	3217702	4915960		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|3207195_3208509_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|3208535_3209615_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|3209619_3210393_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|3210408_3211383_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|3211388_3211940_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|3211940_3212819_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|3212866_3213766_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|3213765_3214851_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|3215227_3216121_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|3216298_3217702_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	3286560	3295731	4915960	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|3286560_3288594_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3288834_3289293_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3289464_3289995_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3290051_3290519_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3290565_3291285_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3291281_3292967_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|3293189_3293921_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3293980_3294088_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3294068_3294800_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3294783_3295731_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	3709232	3810714	4915960	capsid,terminase,holin,tail,portal,tRNA,integrase,lysis,head,protease,transposase	Salmonella_phage(36.07%)	110	3735376:3735391	3805803:3805818
WP_000940030.1|3709232_3709964_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553474.1|3710082_3710886_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174939.1|3711030_3711909_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
WP_000985200.1|3712090_3713134_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3713137_3713956_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|3713966_3714980_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111025.1|3714980_3715967_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3715957_3716596_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982964.1|3716721_3717999_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3717993_3719133_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3719328_3720582_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|3720906_3722097_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3722278_3723823_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|3724183_3725515_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3725597_3727742_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3727797_3729258_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3729306_3729645_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3729721_3731059_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|3731055_3731820_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3731821_3733252_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970062.1|3733901_3737789_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
3735376:3735391	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001667158.1|3737813_3738044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|3738044_3739589_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134572.1|3739639_3740191_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|3740215_3740851_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|3740854_3742216_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|3742226_3743120_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995694.1|3743235_3744084_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684023.1|3744122_3745040_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276364.1|3745061_3746258_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022472.1|3746373_3747300_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001196291.1|3747337_3747598_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986042.1|3747709_3748090_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|3748089_3748821_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3748832_3749561_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|3749572_3750478_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3750474_3751155_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3751428_3752403_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3752419_3754219_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|3754623_3756117_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|3756613_3756751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|3757463_3757628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|3758207_3758273_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|3758335_3758548_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|3758654_3758882_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|3758978_3759557_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|3759546_3760371_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|3760367_3762740_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|3762793_3763036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|3763074_3766437_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|3766498_3767146_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|3767043_3767781_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|3767787_3768486_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3768495_3768825_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|3768827_3771923_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|3771894_3772233_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|3772229_3772625_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|3772675_3773422_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|3773429_3773831_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|3773939_3775070_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|3775118_3775697_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|3775724_3776108_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|3776118_3776478_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|3776535_3777564_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|3777618_3777966_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|3777978_3779475_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|3779464_3781045_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|3781041_3781245_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|3781228_3783160_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|3783131_3783677_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|3783963_3784365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|3784600_3785053_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|3785070_3785523_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|3785506_3785836_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|3786111_3786798_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|3787012_3787201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|3787707_3788271_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|3788361_3788547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|3788543_3789221_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|3789217_3789358_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096562.1|3789354_3789966_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_001241017.1|3789968_3790175_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|3790174_3790777_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|3790811_3791060_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|3791176_3791410_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|3791652_3792285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|3792392_3793091_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|3793104_3793800_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|3793796_3794681_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|3794772_3795147_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|3795106_3795349_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|3795448_3795844_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|3795902_3796742_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|3796734_3797121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|3797120_3797783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|3798239_3798398_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|3798419_3798770_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017128.1|3798896_3801824_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_077248255.1|3801786_3802944_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|3802986_3803226_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|3803266_3803551_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007934.1|3803528_3804758_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_000589050.1|3805255_3805735_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|3805731_3806688_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
3805803:3805818	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|3806687_3807338_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3807369_3807945_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|3807941_3808106_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|3808105_3808285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989165.1|3808369_3809992_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083342.1|3809976_3810714_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 9
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	3815353	3905130	4915960	capsid,holin,terminase,tail,portal,tRNA,integrase,head	Cronobacter_phage(65.91%)	79	3869630:3869645	3909240:3909255
WP_000997365.1|3815353_3816391_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|3816594_3817014_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183641.1|3817086_3817767_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082646.1|3817820_3820481_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|3820595_3821951_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264478.1|3821995_3822319_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807818.1|3822315_3823617_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_000985653.1|3823720_3824176_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|3830250_3832824_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|3832953_3833685_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|3833681_3834662_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|3834793_3835531_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|3835802_3836141_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|3836244_3836292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|3836391_3837552_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000632386.1|3837512_3838421_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225194.1|3838478_3839600_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|3839609_3840680_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212380.1|3841119_3841638_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|3841630_3842851_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|3843007_3843355_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|3843395_3844163_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3844207_3844756_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3844774_3845023_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3845275_3846637_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3846802_3847594_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3847613_3848900_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001294020.1|3849020_3849626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3849660_3850251_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3850373_3851252_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|3851337_3852999_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3853147_3853486_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3853651_3853942_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3853931_3854408_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3854557_3855040_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237676.1|3855653_3866819_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533874.1|3866883_3868293_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196147.1|3868289_3870470_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
3869630:3869645	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000342601.1|3870477_3871641_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001177838.1|3872156_3872405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|3874030_3875149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024131633.1|3875830_3877531_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	3.7e-223
WP_000200789.1|3877533_3878079_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267955.1|3878050_3878776_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
WP_072209005.1|3878765_3879224_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.2	1.6e-75
WP_000084299.1|3879332_3881438_-|tail	tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
WP_001001823.1|3881447_3882035_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136921.1|3882027_3883212_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3883208_3883538_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811087.1|3883534_3885505_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
WP_000411339.1|3885692_3885950_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001270303.1|3885936_3886125_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000376370.1|3886096_3886429_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|3886428_3886770_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3886766_3887060_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3887069_3887525_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3887521_3888649_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560083.1|3888645_3889353_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000084220.1|3889349_3889856_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447489.1|3889852_3890341_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.0e-64
WP_001218537.1|3890401_3891103_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|3891106_3892129_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018802.1|3892190_3892994_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_001151940.1|3893154_3894930_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038205.1|3894926_3895988_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
WP_001669965.1|3895984_3896308_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960961.1|3896281_3896500_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
WP_000171003.1|3896612_3898634_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
WP_000279398.1|3898630_3899464_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
WP_000985848.1|3899453_3899783_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
WP_000057335.1|3899773_3900004_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3900071_3900473_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996734.1|3900472_3900898_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3900887_3901115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460879.1|3901124_3901628_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
WP_000204908.1|3901665_3901869_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
WP_001047672.1|3902014_3902581_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
WP_000290918.1|3902580_3903591_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
WP_000124716.1|3903936_3905130_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.6e-106
3909240:3909255	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 10
NC_021902	Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome	4915960	4671958	4737739	4915960	capsid,holin,terminase,tail,portal,integrase,plate,lysis,head,protease	Salmonella_phage(42.22%)	79	4701814:4701860	4732793:4732839
WP_000208240.1|4671958_4672489_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4672498_4673830_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4673896_4674826_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4674918_4675404_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4675625_4675865_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4676263_4677109_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4677129_4678638_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4678749_4679760_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4679856_4680603_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4680708_4681137_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4681237_4681834_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4681946_4682714_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4682805_4683570_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4683579_4683870_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4683952_4684828_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4684856_4685879_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4685907_4686909_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4686905_4687949_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4687942_4689478_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4689733_4690693_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4690779_4692372_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4692385_4692736_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|4692825_4692957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|4693234_4693957_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4694019_4695060_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4695069_4696029_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4696039_4697374_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4697636_4698392_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4698492_4699482_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4699685_4700648_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4700832_4701735_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4701814:4701860	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4702021_4702438_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4702472_4702691_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4702768_4703938_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4703934_4704420_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4704431_4706873_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4706865_4707021_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4707017_4707353_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4707415_4707934_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4707949_4709137_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4709271_4709841_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4709840_4711583_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4711593_4712124_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4712116_4713025_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4713031_4713379_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4713375_4714017_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|4714093_4715470_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4715474_4715942_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4715934_4716402_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_072209008.1|4716364_4716610_-|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	5.5e-27
WP_000849743.1|4716509_4716923_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|4716919_4717429_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|4717412_4717634_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4717624_4717828_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4717827_4718328_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4718425_4719184_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4719187_4720348_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4720379_4721243_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4721407_4723177_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4723176_4724214_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4724734_4724926_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4724924_4725356_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4725489_4726530_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4726526_4726724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4726902_4729179_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4729168_4729444_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4729440_4729665_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4729966_4730191_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4730254_4730755_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4730924_4731197_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4731333_4731627_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4731696_4732677_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_020924309.1|4732861_4733362_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4732793:4732839	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4733512_4734211_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4734207_4735581_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4735628_4735832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4735952_4736348_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077906285.1|4736359_4737112_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4737118_4737739_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
