The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	8850	61004	2297851	protease,transposase	Staphylococcus_phage(21.05%)	41	NA	NA
WP_042513824.1|8850_10101_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|10179_10632_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003682303.1|10888_11182_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_035435868.1|11222_11948_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.4	5.6e-35
WP_003682305.1|11986_12223_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_035435870.1|12347_14381_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003685631.1|14380_14833_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003682308.1|14877_16281_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.3	2.7e-110
WP_021349470.1|16364_17540_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	1.7e-44
WP_003682310.1|17551_17884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513823.1|18123_19410_-|transposase	ISL3 family transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	20.6	2.5e-09
WP_014562466.1|19687_20686_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_003685635.1|21204_21912_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_014562047.1|21923_23783_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	2.2e-35
WP_003682313.1|23766_25065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562049.1|25066_25867_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_003682315.1|25881_26697_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	4.1e-34
WP_003682316.1|26771_28043_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
WP_021350198.1|28550_29030_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003685648.1|29244_29670_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562051.1|29675_30611_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350199.1|30990_32334_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_035436615.1|32346_34593_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_021349600.1|34739_35408_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_003682325.1|35794_35983_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_035436617.1|36136_37114_-	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	2.5e-14
WP_021349396.1|37168_38104_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003682328.1|38406_39399_-	D-2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	31.8	4.8e-37
WP_042513827.1|39414_40599_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682330.1|40947_41178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562056.1|41292_43386_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	5.1e-121
WP_012390672.1|43686_45147_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_042513826.1|45629_49367_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_021350353.1|49373_53387_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.4	3.3e-12
WP_012390675.1|53386_54250_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	4.3e-58
WP_042513825.1|54487_56113_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_021349442.1|56406_56763_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_021349443.1|56801_57917_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021349444.1|57909_58641_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	1.8e-25
WP_021349622.1|59222_60473_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_012390701.1|60551_61004_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
>prophage 2
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	90646	142301	2297851	holin,tRNA,transposase	Bacillus_phage(15.79%)	48	NA	NA
WP_042513899.1|90646_91945_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.1	6.2e-93
WP_048340462.1|92321_93572_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	3.6e-58
WP_021349476.1|93645_94074_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.4	9.6e-27
WP_021349475.1|94425_95439_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436592.1|95696_96950_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
WP_021349200.1|97417_98872_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_021349199.1|98875_99619_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	4.1e-33
WP_042513945.1|99939_101313_+	amino acid permease	NA	NA	NA	NA	NA
WP_107504371.1|103126_103216_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035437017.1|103682_105032_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.6	1.2e-123
WP_021349243.1|105571_106183_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_021349242.1|107349_108549_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_003685735.1|108782_109703_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021350222.1|109891_110629_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_021350223.1|110647_111583_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_024272049.1|111596_112430_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	3.9e-16
WP_012390706.1|112442_112643_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003685747.1|112658_113756_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_042513946.1|113789_114563_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003685751.1|114833_115976_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.4	5.7e-58
WP_021350226.1|116324_117326_+	LCP family protein	NA	NA	NA	NA	NA
WP_042513947.1|117325_118096_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_021349539.1|118112_118862_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_021349538.1|118882_119653_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_042513965.1|119715_120321_+	sugar transferase	NA	NA	NA	NA	NA
WP_053069254.1|120344_120617_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_053069255.1|120636_120996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349743.1|121090_121306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513949.1|121347_122706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340463.1|123281_124160_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003688751.1|124183_124471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_187326578.1|124576_124834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340464.1|124851_125655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513858.1|125657_126506_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042513859.1|126519_127557_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021349680.1|127567_128257_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_012391429.1|128558_129779_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_021349519.1|130178_131585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050755181.1|131947_132568_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|132555_133440_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014562705.1|133596_134784_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_042513974.1|135670_136540_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.8	6.2e-105
WP_042513975.1|136543_137125_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	44.3	2.5e-33
WP_042513976.1|137135_138167_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	40.0	1.4e-63
WP_021353578.1|138229_139087_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.8	8.6e-35
WP_021350347.1|139568_140075_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_031284839.1|140271_140961_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_042513977.1|141158_142301_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	5.0e-30
>prophage 3
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	145337	224250	2297851	transposase	Lactobacillus_phage(13.04%)	56	NA	NA
WP_042513978.1|145337_145790_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	1.2e-32
WP_048340465.1|145868_147119_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	4.8e-58
WP_021349289.1|147257_148472_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003682467.1|148606_148786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562095.1|148814_149855_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021349288.1|149942_151604_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_021349287.1|151890_152376_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.5	5.2e-21
WP_021349286.1|152359_153499_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003682477.1|153517_154813_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	8.2e-21
WP_024271756.1|155151_156192_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_021349284.1|156203_157754_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_021349283.1|157929_159036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162485004.1|159942_160110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080964965.1|160091_160331_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003682490.1|160828_161551_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.8	3.3e-35
WP_012390750.1|161553_161796_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003682494.1|161796_162477_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_042513863.1|162480_164706_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	2.2e-146
WP_003682498.1|164681_166145_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	4.1e-61
WP_021349278.1|166144_167182_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	40.4	1.2e-59
WP_021349277.1|167190_167772_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_024271755.1|167773_169309_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	5.8e-74
WP_024500642.1|169582_170836_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003682507.1|171075_171771_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_021349275.1|171895_173074_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_021349274.1|173186_174191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349273.1|174681_175053_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003686555.1|175066_175375_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003682512.1|175374_177306_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.7e-92
WP_024271753.1|177417_177852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682515.1|177899_178376_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_048340466.1|184223_185363_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_048340467.1|185409_186024_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.5	8.1e-19
WP_080964966.1|185960_186869_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_012391429.1|186944_188165_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_080965009.1|188650_190525_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003684235.1|190671_191658_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042513971.1|191982_193008_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_080650597.1|194279_194915_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_021350357.1|195040_195430_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_080964967.1|195532_195958_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015638518.1|196161_196818_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.5	9.3e-13
WP_021350363.1|199463_199658_+	CsbD family protein	NA	NA	NA	NA	NA
WP_042513969.1|200222_200678_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	4.7e-32
WP_021349435.1|202229_202814_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_080965010.1|204146_205985_-	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_042514054.1|206180_208043_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_021350376.1|208032_208824_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_021350377.1|208838_209717_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_003684282.1|209718_210645_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_024272103.1|210637_211399_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	8.0e-16
WP_003684280.1|211756_213061_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.2	1.1e-44
WP_080543059.1|213426_213726_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_021349153.1|215592_216432_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.8	1.1e-98
WP_021349533.1|222236_223208_+	2-hydroxyacid dehydrogenase family protein	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.3	5.4e-25
WP_042513864.1|223317_224250_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.1	9.4e-27
>prophage 4
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	251310	303973	2297851	tRNA,protease,transposase	Tupanvirus(12.5%)	44	NA	NA
WP_003686432.1|251310_253311_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	5.4e-88
WP_003683977.1|253314_254103_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012390795.1|254089_254659_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_021349691.1|254651_255539_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003683980.1|255818_256670_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_024271880.1|256847_257753_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_031274189.1|257755_258421_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.6	2.6e-15
WP_035437682.1|258420_259215_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_021349689.1|259439_260276_+	pur operon repressor	NA	NA	NA	NA	NA
WP_021349688.1|260291_261659_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.4	3.4e-33
WP_003683994.1|261734_262721_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.6	8.4e-42
WP_003683996.1|262830_263559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349687.1|263735_264557_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021349686.1|264568_265924_-	HD domain-containing protein	NA	A0A291ATA1	Pandoravirus	32.1	1.4e-26
WP_003686451.1|266038_266464_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003684002.1|266509_267097_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003684004.1|267263_268865_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	1.0e-145
WP_003684007.1|269075_270344_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003684008.1|270438_270684_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021349684.1|271415_272120_+	class A sortase	NA	NA	NA	NA	NA
WP_003684311.1|272239_272692_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	4.7e-32
WP_003684310.1|272770_274021_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_021349723.1|274206_274671_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003684020.1|274807_275365_+	LemA family protein	NA	NA	NA	NA	NA
WP_003686466.1|275375_276275_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_021349724.1|276449_277829_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012390801.1|277999_279478_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	37.8	9.6e-66
WP_003684028.1|279481_279841_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_021349725.1|279843_280965_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	3.2e-29
WP_015638559.1|280976_281330_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	2.3e-10
WP_003686479.1|281462_282098_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003684038.1|282285_282846_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_021349726.1|282863_286406_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|286402_286675_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|286763_287120_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003684046.1|287248_287755_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_042513839.1|287754_289104_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	4.0e-10
WP_003684053.1|289120_289669_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	8.0e-10
WP_003684055.1|289752_291921_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.8	5.6e-107
WP_012390806.1|291997_292879_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_021349728.1|292967_293969_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_021349729.1|293984_295478_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	2.8e-89
WP_042513854.1|301601_302888_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_107504382.1|303592_303973_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	60.3	2.1e-41
>prophage 5
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	398247	518730	2297851	holin,integrase,tRNA,transposase,protease	Streptococcus_phage(30.56%)	103	456015:456030	485072:485085
WP_003684067.1|398247_399600_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014562170.1|399792_401736_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.3	1.8e-59
WP_003682567.1|401902_402553_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003682569.1|402865_403147_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	43.0	2.6e-12
WP_003682571.1|403171_404803_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	1.1e-158
WP_024500711.1|404943_406782_+	APC family permease	NA	NA	NA	NA	NA
WP_003682576.1|406988_407255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349637.1|407451_408090_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.5	7.8e-41
WP_021349636.1|408153_409470_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	42.9	7.2e-81
WP_031284433.1|409466_410141_+	ComF family protein	NA	NA	NA	NA	NA
WP_003682582.1|410276_410822_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003682585.1|410992_413362_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_178958862.1|413421_414537_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_003682588.1|414593_414923_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003682589.1|414922_415276_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003682590.1|415290_416253_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_021349634.1|416245_417091_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003682592.1|417087_418101_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_021349633.1|418163_419075_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.1	3.9e-70
WP_012390859.1|419598_420378_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_021349632.1|420393_421572_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003682596.1|421596_422571_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_048340473.1|423195_424446_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	1.2e-56
WP_004563287.1|424670_425087_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_042514036.1|425147_425684_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042514037.1|425680_426568_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	2.6e-34
WP_003682598.1|426736_427678_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.4	5.3e-78
WP_003682600.1|427690_428509_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_021350351.1|428529_429456_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.7	6.4e-100
WP_004563284.1|429645_430674_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_014562182.1|430699_431641_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_031284843.1|431743_432544_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_154244359.1|432606_432768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562183.1|432830_434555_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.1	1.5e-195
WP_024500722.1|434769_435405_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_021350021.1|435410_435641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563280.1|435740_437756_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_021350022.1|437765_440627_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	1.2e-301
WP_012390871.1|440716_441802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350023.1|442020_442890_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	2.8e-09
WP_024271982.1|442911_443889_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.0	7.9e-93
WP_015638637.1|443906_444845_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	2.3e-49
WP_003682627.1|445644_446235_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
WP_021350007.1|448443_449043_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_015638639.1|449042_449624_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_021350006.1|449635_453328_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
451017:451030	attL	TCGTGATTGCCCAC	NA	NA	NA	NA
WP_021350005.1|453380_456941_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
456015:456030	attL	CACATCGCTGAGCATA	NA	NA	NA	NA
WP_021350004.1|456997_458077_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	40.6	6.3e-67
WP_042513843.1|458078_460448_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
458225:458240	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_021350321.1|460468_463003_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
458225:458240	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_173425571.1|463049_465122_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021350323.1|465150_466938_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_048340475.1|466961_467255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645712.1|467328_467865_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042513842.1|467861_468749_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.7e-33
WP_080965012.1|468766_469330_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.1	1.4e-09
WP_012390875.1|470155_471169_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682636.1|471250_472456_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|472561_473329_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|473445_474768_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_003682642.1|474961_476356_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562187.1|476444_477995_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_004563267.1|478057_478297_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014562188.1|478349_480743_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	6.5e-88
WP_003682651.1|480763_481237_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_024272014.1|481264_481846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350151.1|481986_482676_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	8.7e-46
WP_003682658.1|482709_483684_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_021350150.1|483692_484145_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_021350149.1|484144_484660_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021350148.1|484789_485329_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	35.6	3.4e-21
WP_003682662.1|485456_486353_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014562189.1|486364_487210_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_021350147.1|487199_488078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682665.1|488117_489476_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_021350146.1|489689_491510_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	1.2e-89
WP_004563258.1|491790_492102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513841.1|492111_493962_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.7	1.2e-25
WP_042513876.1|493992_494811_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021350141.1|495131_495746_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	48.5	1.2e-22
WP_003682672.1|496142_497171_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012390889.1|497291_498197_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_021350140.1|498293_499256_-	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_021350139.1|499342_500182_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	39.8	5.1e-48
WP_003682679.1|500344_500860_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_021350138.1|501093_502035_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003685816.1|502510_503494_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_021350137.1|503513_504317_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|504345_505266_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003682690.1|505266_505617_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_014562199.1|506233_506956_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	2.3e-36
WP_003682693.1|506955_508458_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	5.2e-35
WP_003682694.1|508660_509521_+	sugar transporter	NA	NA	NA	NA	NA
WP_048340476.1|509595_510132_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042513980.1|510128_511016_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	9.9e-34
WP_042514038.1|511127_511583_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	2.4e-31
WP_048340477.1|511656_512907_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_003685822.1|513430_513994_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_014562202.1|514009_515674_+	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	37.8	8.6e-47
WP_042513939.1|515811_517164_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003682700.1|517170_517368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682701.1|517528_518011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003682702.1|518028_518730_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	562879	586020	2297851	tRNA,head,transposase	Lactobacillus_phage(28.57%)	17	NA	NA
WP_021350213.1|562879_563200_+|head	head protein	head	Q6SED4	Lactobacillus_prophage	54.2	1.2e-26
WP_021350214.1|563312_563480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041812635.1|563467_564073_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_042513944.1|564402_566112_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003685978.1|566292_567441_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.3	2.0e-31
WP_021350270.1|567453_568674_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_024272067.1|569062_570358_+	GntP family permease	NA	NA	NA	NA	NA
WP_003682784.1|570370_571513_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	2.2e-38
WP_002816285.1|572337_572589_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_042513931.1|572642_573485_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	1.7e-155
WP_035436387.1|574234_575587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562233.1|578131_578743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350273.1|578894_579389_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_012390965.1|579694_582349_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	1.3e-158
WP_048340479.1|582457_583816_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021353998.1|583785_584763_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_042513972.1|584880_586020_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
>prophage 7
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	742210	820999	2297851	protease,bacteriocin,transposase,integrase	Paenibacillus_phage(22.22%)	82	748519:748535	754824:754840
WP_021349928.1|742210_743746_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.6	2.0e-45
WP_021349926.1|744203_745793_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	5.2e-102
WP_021349924.1|746781_747222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349923.1|747232_748222_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|748243_748690_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
748519:748535	attL	TCTGCGCCCATTCCGGC	NA	NA	NA	NA
WP_004563379.1|748790_749411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349922.1|750438_751569_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	47.3	1.7e-91
WP_021349921.1|751578_752040_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_162485005.1|752058_752418_-	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	55.0	3.1e-10
WP_021349919.1|752601_752844_+	DUF739 family protein	NA	NA	NA	NA	NA
WP_021349918.1|752901_753225_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_021349917.1|753349_753499_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_053069258.1|753852_754947_+	helix-turn-helix domain-containing protein	NA	X2CYF1	Lactobacillus_phage	29.2	2.6e-15
754824:754840	attR	GCCGGAATGGGCGCAGA	NA	NA	NA	NA
WP_042513910.1|755023_756244_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_021349883.1|756607_756988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349882.1|757000_757258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349880.1|757535_758810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349879.1|758810_759248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349877.1|759395_759617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349876.1|759643_760063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349875.1|760075_760573_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_021349874.1|760832_761603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349873.1|761711_761975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349871.1|762884_763175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349870.1|763190_763499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349869.1|764389_764896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349868.1|764918_765341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349867.1|765487_766336_+	RNA polymerase sigma factor RpoD/SigA	NA	F4YCU2	Synechococcus_phage	28.6	3.6e-17
WP_048340482.1|766346_768482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349864.1|768545_768734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349863.1|769043_769637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349862.1|769636_769852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349861.1|769851_770268_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003686706.1|770487_770682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686704.1|770671_771028_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_016370900.1|771095_772619_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_048340483.1|772699_773500_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.8	6.6e-37
WP_003688751.1|773523_773811_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340484.1|774135_774498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080964975.1|774514_775099_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_048340485.1|776024_777245_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	2.8e-95
WP_042513846.1|778043_778307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350153.1|779061_779376_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042513847.1|779455_780610_+	MFS transporter	NA	NA	NA	NA	NA
WP_024272015.1|780801_781692_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010890648.1|782015_782696_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_080964979.1|782798_783032_-|bacteriocin	secreted protein, bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003132846.1|784009_784564_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.6	3.6e-42
WP_042513848.1|784649_785018_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_042513849.1|785227_785494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350160.1|786486_786855_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_021350161.1|786932_787310_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042513850.1|787398_788079_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	85.0	1.0e-110
WP_042513851.1|788139_788451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023188827.1|789108_789735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035432693.1|789727_790888_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_012391429.1|791161_792382_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_003688751.1|792883_793171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003684067.1|793406_794759_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012391132.1|794864_795620_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_021349344.1|795666_795948_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_021349343.1|796138_796840_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_048340487.1|797709_798930_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	45.7	9.0e-94
WP_042514014.1|798960_799779_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.8	2.6e-36
WP_003688751.1|799802_800090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021350027.1|800631_801261_-	Fic family protein	NA	NA	NA	NA	NA
WP_021350028.1|801403_802153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350029.1|802173_804555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350030.1|804566_804779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350031.1|804910_805099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350032.1|805324_805747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485006.1|806117_809774_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021350037.1|809849_810059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042514006.1|810240_811947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350040.1|812085_813561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350041.1|813700_814099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350042.1|814313_814556_+	NrdH-redoxin	NA	NA	NA	NA	NA
WP_021350043.1|814573_815698_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_021350044.1|815816_818075_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_021350045.1|818087_818735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350046.1|818740_819118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350047.1|819199_820999_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	36.4	9.2e-87
>prophage 8
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	838682	954846	2297851	terminase,integrase,tRNA,transposase,protease	Lactobacillus_phage(42.37%)	120	842129:842188	918665:918731
WP_021350068.1|838682_839366_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021350071.1|840814_841210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340547.1|841574_842144_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	30.9	7.5e-19
842129:842188	attL	GGTTATGTCCGTATAATTGGTGTAAATTCTAAATAGGACTTTGTGAAATCTGAAAGGAAC	NA	NA	NA	NA
WP_048340489.1|842194_843415_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_080964983.1|843548_844457_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	3.7e-12
WP_048340492.1|845122_846481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391429.1|846599_847820_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_080965013.1|847994_848273_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_014562705.1|848331_849519_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_021350328.1|849769_850966_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021350327.1|850955_852578_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.3	7.4e-128
WP_021350326.1|852591_855759_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_048340493.1|855879_857067_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	4.4e-37
WP_021349307.1|857383_860104_+	AAA family ATPase	NA	A0A2K5B264	Erysipelothrix_phage	43.6	3.3e-205
WP_042514055.1|860232_860937_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	43.0	1.4e-38
WP_048340494.1|861898_863119_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_080964984.1|863198_863702_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.1	1.5e-31
WP_021349205.1|864802_866101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349204.1|866165_866477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349203.1|866826_867915_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	49.7	2.2e-83
WP_042514010.1|868113_869046_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.5e-27
WP_021349591.1|869146_869491_-	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	67.8	2.5e-25
WP_162485010.1|869512_870130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349588.1|870101_870413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514045.1|870598_870997_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	48.9	8.6e-30
WP_021349132.1|871583_871793_+	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	67.2	9.4e-20
WP_021349133.1|872002_872260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021349134.1|872421_872610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349135.1|872646_872853_+	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	57.6	9.0e-15
WP_021349136.1|872870_873359_+	siphovirus Gp157 family protein	NA	A0A0A1EL06	Lactobacillus_phage	41.4	1.0e-24
WP_042514046.1|873358_874033_+	AAA family ATPase	NA	Q9T0Y5	Lactobacillus_phage	59.3	1.4e-69
WP_021349137.1|874022_875372_+	DEAD/DEAH box helicase	NA	Q9T0Y3	Lactobacillus_phage	59.4	9.8e-150
WP_021349138.1|875391_875952_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	50.0	5.4e-46
WP_042514047.1|876017_878327_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	56.2	7.0e-257
WP_012390938.1|878609_878954_+	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	67.9	2.5e-41
WP_021349765.1|879093_879540_+	hypothetical protein	NA	E9LUN1	Lactobacillus_phage	78.4	1.1e-52
WP_042514048.1|879508_879868_+	hypothetical protein	NA	E9LUN2	Lactobacillus_phage	44.9	2.0e-17
WP_021349258.1|879864_880317_+	hypothetical protein	NA	U3PIU0	Lactobacillus_phage	31.3	1.6e-11
WP_048340496.1|880679_881348_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_080964986.1|881317_881590_+	DUF4868 domain-containing protein	NA	A0A1Q1PW39	Staphylococcus_phage	33.3	4.5e-06
WP_042514049.1|881595_882141_+	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	31.1	3.5e-13
WP_021349255.1|882213_882420_-	CsbD family protein	NA	NA	NA	NA	NA
WP_021349253.1|883006_883396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340498.1|883450_883750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340499.1|883746_883935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035426089.1|883964_884396_+|terminase	terminase small subunit	terminase	A0A0A1ENP4	Lactobacillus_phage	57.2	8.7e-36
WP_021349740.1|884382_884544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340500.1|884805_885684_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_003688751.1|885707_885995_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145998185.1|886215_886599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340501.1|886704_887637_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	4.2e-27
WP_021349591.1|887737_888082_-	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	67.8	2.5e-25
WP_162485010.1|888103_888721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349588.1|888692_889004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514045.1|889189_889588_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	48.9	8.6e-30
WP_021349132.1|890174_890384_+	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	67.2	9.4e-20
WP_021349133.1|890593_890851_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021349134.1|891012_891201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349135.1|891237_891444_+	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	57.6	9.0e-15
WP_021349136.1|891461_891950_+	siphovirus Gp157 family protein	NA	A0A0A1EL06	Lactobacillus_phage	41.4	1.0e-24
WP_042514046.1|891949_892624_+	AAA family ATPase	NA	Q9T0Y5	Lactobacillus_phage	59.3	1.4e-69
WP_021349137.1|892613_893963_+	DEAD/DEAH box helicase	NA	Q9T0Y3	Lactobacillus_phage	59.4	9.8e-150
WP_021349138.1|893982_894543_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	50.0	5.4e-46
WP_042514047.1|894608_896918_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	56.2	7.0e-257
WP_012390938.1|897200_897545_+	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	67.9	2.5e-41
WP_021349765.1|897684_898131_+	hypothetical protein	NA	E9LUN1	Lactobacillus_phage	78.4	1.1e-52
WP_042514048.1|898099_898459_+	hypothetical protein	NA	E9LUN2	Lactobacillus_phage	44.9	2.0e-17
WP_021349258.1|898455_898908_+	hypothetical protein	NA	U3PIU0	Lactobacillus_phage	31.3	1.6e-11
WP_021349257.1|899270_900179_+	DUF4868 domain-containing protein	NA	A0A1Q1PW39	Staphylococcus_phage	24.4	2.5e-16
WP_042514049.1|900184_900730_+	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	31.1	3.5e-13
WP_021349255.1|900802_901009_-	CsbD family protein	NA	NA	NA	NA	NA
WP_021349253.1|901595_901985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349252.1|902039_902522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035426089.1|902551_902983_+|terminase	terminase small subunit	terminase	A0A0A1ENP4	Lactobacillus_phage	57.2	8.7e-36
WP_021349740.1|902969_903131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340500.1|903392_904271_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_003688751.1|904294_904582_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145998185.1|904802_905186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513837.1|905291_906224_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	5.5e-27
WP_021349246.1|906288_906963_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	31.1	6.6e-22
WP_035435948.1|907394_908774_+	MFS transporter	NA	NA	NA	NA	NA
WP_021349248.1|908770_909694_+	ferrochelatase	NA	NA	NA	NA	NA
WP_021353718.1|909920_910919_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	3.8e-50
WP_048340502.1|911009_912296_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_107760586.1|913493_914378_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050755181.1|914365_914986_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_021349514.1|915498_916686_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
WP_010625596.1|917352_917841_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_021349110.1|919330_920065_-	lactate utilization protein C	NA	NA	NA	NA	NA
918665:918731	attR	GGTTATGTCCGTATAATTGGTGTAAATTCTAAATAGGACTTTGTGAAATCTGAAAGGAACTTCATTA	NA	NA	NA	NA
WP_015638801.1|920057_921575_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003685238.1|921575_922382_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_021349108.1|922634_923804_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685235.1|924273_924900_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_012391088.1|925055_925307_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|925383_925611_+	YneF family protein	NA	NA	NA	NA	NA
WP_003685229.1|925678_926311_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035436535.1|926406_927159_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|927151_927442_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003681957.1|927595_928375_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003681955.1|928465_929344_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681954.1|929424_930150_+	UMP kinase	NA	NA	NA	NA	NA
WP_003681953.1|930149_930710_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_024271689.1|930842_931610_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
WP_003681950.1|931626_932415_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021349107.1|932436_933708_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015638806.1|933741_935463_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
WP_024500831.1|935602_939946_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_014562308.1|940068_941220_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.5e-21
WP_035436544.1|941232_941979_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003685208.1|941988_943191_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003685206.1|943217_944243_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_042513891.1|944487_945558_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_021349106.1|945550_948640_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003681934.1|948792_949272_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003685200.1|949291_950518_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_021349105.1|950554_950857_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003681928.1|950849_951173_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_021349104.1|951177_953505_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003685195.1|953517_953880_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_021349103.1|953949_954846_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	958078	1013750	2297851	transposase	Streptococcus_phage(21.74%)	48	NA	NA
WP_080964987.1|958078_958987_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	3.2e-11
WP_042513934.1|959139_959595_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_014562705.1|960064_961252_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_048340463.1|961383_962262_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003688751.1|962285_962573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021350231.1|964069_965407_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_021350232.1|965415_967110_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_021350233.1|967267_968254_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035437390.1|968409_969702_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.5	3.5e-80
WP_021350236.1|969682_970000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|970152_971325_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024271704.1|972989_973952_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_021349142.1|974342_974663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685171.1|976310_976664_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_021349145.1|976676_977258_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080964989.1|977358_978072_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	5.0e-28
WP_041812698.1|978550_978838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340505.1|978861_979740_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_086031844.1|979796_979916_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436004.1|979978_982246_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	1.1e-124
WP_048340506.1|982300_983233_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_021353998.1|983348_984326_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003681906.1|985178_985544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681905.1|985669_986716_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003681903.1|986726_987314_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014562323.1|987351_989208_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	9.3e-135
WP_003681899.1|989319_990480_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	4.8e-20
WP_021349426.1|992218_992536_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|992537_992858_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_021349425.1|992870_993956_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	2.9e-11
WP_021349424.1|994023_995856_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_021349423.1|996368_996881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349422.1|996916_997540_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	8.5e-08
WP_162485011.1|997631_998654_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015638841.1|998913_999987_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
WP_021349420.1|999998_1001174_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	1.1e-88
WP_003681857.1|1001313_1003065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349418.1|1003102_1003558_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349417.1|1003718_1004189_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_021349416.1|1004181_1005375_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	6.5e-97
WP_003681853.1|1005361_1005970_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
WP_021349415.1|1005969_1007028_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	1.3e-40
WP_021349414.1|1007437_1007923_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035436973.1|1007983_1009018_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	26.0	7.0e-07
WP_021349411.1|1009010_1009562_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024500857.1|1010505_1011678_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_041812577.1|1011968_1012421_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_048340507.1|1012499_1013750_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.8	7.6e-56
>prophage 10
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1068347	1191828	2297851	capsid,tRNA,transposase,integrase	Streptococcus_phage(12.5%)	115	1110287:1110302	1159475:1159490
WP_003681741.1|1068347_1069643_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436372.1|1069646_1071422_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021349548.1|1071963_1072647_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003684990.1|1072760_1072949_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003684989.1|1073013_1073463_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	34.3	7.0e-12
WP_014562357.1|1073610_1074594_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	9.2e-49
WP_003681726.1|1074593_1075067_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_035436369.1|1075044_1075443_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003681722.1|1075456_1076362_+	GTPase Era	NA	NA	NA	NA	NA
WP_003681720.1|1076474_1077293_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003681718.1|1077560_1078535_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_021349547.1|1078534_1080613_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_021349546.1|1080764_1082660_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	32.1	3.3e-42
WP_003681711.1|1082659_1083802_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.9e-37
WP_042513964.1|1084262_1085105_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
WP_012391066.1|1085158_1085410_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_021349446.1|1085705_1086266_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|1086277_1086463_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_003681703.1|1086490_1087033_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|1087047_1087299_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|1087310_1087451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513968.1|1087668_1088352_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.2	1.6e-31
WP_014562363.1|1088545_1089832_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683258.1|1090064_1090976_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_035437742.1|1091178_1092186_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003683256.1|1092198_1093557_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003683241.1|1094028_1095348_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003683238.1|1095372_1096086_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015638911.1|1096085_1097240_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003683233.1|1097242_1098178_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_021350307.1|1098170_1098950_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_021350308.1|1098974_1100159_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003683228.1|1100173_1101226_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003683224.1|1101361_1102702_+	ATPase	NA	NA	NA	NA	NA
WP_003683222.1|1102694_1103369_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_035437740.1|1103377_1104079_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_042513913.1|1104071_1104893_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003683215.1|1104912_1106154_+	peptidase T	NA	NA	NA	NA	NA
WP_003683213.1|1106225_1106453_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_035437734.1|1106543_1109843_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.2	2.2e-142
WP_003684953.1|1109981_1111403_+	pyruvate kinase	NA	NA	NA	NA	NA
1110287:1110302	attL	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_021349849.1|1111558_1112446_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
1110287:1110302	attL	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_015638921.1|1112438_1113317_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	29.1	6.4e-09
WP_003684947.1|1113297_1113681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683203.1|1113673_1114462_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.5	1.2e-11
WP_003683201.1|1114439_1115027_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	7.5e-14
WP_003683200.1|1115027_1115753_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021349848.1|1116024_1116603_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_031284577.1|1116802_1117867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683188.1|1117856_1119314_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
WP_003683187.1|1119374_1119929_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683185.1|1119952_1120633_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003683184.1|1120709_1121942_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_024500900.1|1122019_1123333_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003683180.1|1123556_1123832_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
WP_003684932.1|1123910_1125173_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003683175.1|1125286_1126144_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_021350295.1|1126309_1127512_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	3.4e-45
1126885:1126900	attR	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_015638927.1|1127524_1129411_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.9e-51
1126885:1126900	attR	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_003683168.1|1129476_1130436_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	9.1e-118
WP_003683166.1|1130447_1130951_+	dihydrofolate reductase	NA	A0A223LJP4	Erwinia_phage	37.8	5.6e-18
WP_003684928.1|1130930_1131560_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021350296.1|1131726_1132569_+	DegV family protein	NA	NA	NA	NA	NA
WP_003683161.1|1132702_1133881_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	8.7e-62
WP_003683159.1|1133950_1134577_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_003683158.1|1134707_1135625_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683157.1|1135628_1136222_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003683156.1|1136231_1136456_+	YozE family protein	NA	NA	NA	NA	NA
WP_014562705.1|1136925_1138113_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_003678461.1|1138606_1138966_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.3	8.1e-19
WP_003678459.1|1138952_1139315_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_012391429.1|1139360_1140581_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_042513852.1|1140732_1142463_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_012391429.1|1143804_1145025_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_003678450.1|1145342_1145711_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021349960.1|1145712_1146327_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003678446.1|1146351_1146906_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.3	6.0e-05
WP_021349958.1|1147339_1148560_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	38.9	3.8e-76
WP_021349957.1|1148679_1148931_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	43.3	4.5e-08
WP_035436401.1|1149019_1150279_+|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	26.6	4.1e-25
WP_014562383.1|1150415_1151288_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_024500903.1|1151280_1152051_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.2	1.4e-20
WP_015638933.1|1155320_1156163_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003683143.1|1156178_1157057_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003683142.1|1157124_1157736_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003683141.1|1157967_1159965_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	7.5e-122
WP_014562386.1|1159981_1162450_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.0	8.4e-99
WP_021349219.1|1162515_1163031_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003683133.1|1163141_1164074_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_015638938.1|1164267_1164660_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003683130.1|1164669_1165095_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003684903.1|1165247_1165757_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024271696.1|1165749_1166205_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023466126.1|1166361_1167720_+	cytosine permease	NA	NA	NA	NA	NA
WP_024500909.1|1167722_1168961_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_024500910.1|1169129_1170833_+	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_014562389.1|1170928_1171300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436395.1|1171314_1172661_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.1	3.1e-87
WP_021349896.1|1172657_1173338_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014562392.1|1173924_1175274_+	MFS transporter	NA	NA	NA	NA	NA
WP_035436393.1|1175400_1175604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683109.1|1175618_1175774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015638951.1|1175760_1176051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349899.1|1177892_1179119_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_021349900.1|1179118_1179883_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_035433279.1|1179935_1181414_-	amino acid permease	NA	NA	NA	NA	NA
WP_021349902.1|1181571_1182603_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_031284600.1|1183240_1183882_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021349904.1|1183995_1184562_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021349906.1|1185557_1186115_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003683069.1|1187957_1189025_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_014562398.1|1189036_1190173_+	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.3	2.0e-10
WP_003683065.1|1190372_1190513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683063.1|1190713_1190923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349962.1|1190931_1191828_+|capsid	phage capsid protein	capsid	U3PFU0	Lactobacillus_phage	46.8	2.3e-62
>prophage 11
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1202942	1262222	2297851	transposase,integrase	Lactobacillus_phage(23.53%)	49	1216548:1216565	1244321:1244338
WP_048340509.1|1202942_1204106_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	70.9	9.9e-159
WP_012391236.1|1205060_1206113_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	7.9e-14
WP_021350180.1|1206205_1207165_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003684840.1|1207180_1207810_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024500922.1|1207806_1208574_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.7e-22
WP_003683036.1|1208554_1209199_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003684836.1|1209349_1210252_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015638987.1|1210393_1210843_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683030.1|1210880_1211306_-	OsmC family protein	NA	NA	NA	NA	NA
WP_021350184.1|1211305_1211842_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349692.1|1215210_1215690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132356.1|1215693_1216128_-	MFS transporter	NA	NA	NA	NA	NA
1216548:1216565	attL	CCTTTTTAACGGCGTCGT	NA	NA	NA	NA
WP_021349347.1|1218469_1218898_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042513914.1|1219077_1220364_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_021349510.1|1220523_1221402_-	sugar transporter	NA	NA	NA	NA	NA
WP_021349509.1|1221593_1222601_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.3	5.2e-15
WP_012390893.1|1222658_1223546_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
WP_048340510.1|1224232_1225453_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.6e-95
WP_086031779.1|1225467_1226061_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_048340512.1|1226916_1227531_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	7.3e-28
WP_048340513.1|1227858_1228782_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
WP_021349264.1|1228908_1229529_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.3	3.0e-21
WP_021349263.1|1229825_1230605_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021349259.1|1232604_1232772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|1233017_1233305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349454.1|1235283_1235667_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003683002.1|1235701_1236523_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014562409.1|1236532_1237957_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.5	1.4e-69
WP_003683000.1|1238004_1239198_+	MFS transporter	NA	NA	NA	NA	NA
WP_024500926.1|1239428_1240499_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.0e-08
WP_014562411.1|1240720_1241863_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_012391259.1|1241875_1242787_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.8	5.4e-59
WP_003682996.1|1243128_1243395_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_021349455.1|1243404_1244748_+	PFL family protein	NA	NA	NA	NA	NA
1244321:1244338	attR	ACGACGCCGTTAAAAAGG	NA	NA	NA	NA
WP_003682993.1|1244938_1245871_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003682992.1|1245951_1246344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349457.1|1246565_1246766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682985.1|1247980_1248163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562416.1|1248910_1249828_-	EamA family transporter	NA	NA	NA	NA	NA
WP_021349460.1|1250070_1250655_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	63.2	1.1e-41
WP_021349461.1|1250761_1252615_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	62.5	3.0e-218
WP_014562419.1|1252740_1253667_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	42.9	7.3e-64
WP_021349463.1|1253763_1254621_+	patatin family protein	NA	NA	NA	NA	NA
WP_021349464.1|1254715_1255888_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014562422.1|1255897_1256998_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021349465.1|1257077_1257818_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	39.8	1.4e-46
WP_003682974.1|1258011_1258509_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	54.3	3.1e-45
WP_003682973.1|1258521_1259574_-	serine hydrolase	NA	NA	NA	NA	NA
WP_042513835.1|1260863_1262222_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1270376	1323419	2297851	transposase,integrase	Staphylococcus_phage(33.33%)	48	1320293:1320329	1328223:1328259
WP_173425567.1|1270376_1271363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	2.8e-45
WP_014562430.1|1271529_1272915_-	amino acid permease	NA	NA	NA	NA	NA
WP_003682956.1|1273189_1274152_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_042513919.1|1274468_1276247_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003682953.1|1276406_1277642_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003682951.1|1277645_1278326_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_021353998.1|1278481_1279459_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_024271972.1|1279496_1279934_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.2	1.2e-24
WP_024271971.1|1279939_1280482_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024271970.1|1280573_1281107_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003682943.1|1281255_1281528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349991.1|1281668_1282784_-	membrane protein	NA	NA	NA	NA	NA
WP_003682939.1|1283263_1284094_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021349990.1|1284288_1285662_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_021349989.1|1286029_1287214_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_035437463.1|1287389_1288721_-	guanine deaminase	NA	NA	NA	NA	NA
WP_021349988.1|1288842_1289994_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_021349987.1|1290250_1290400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138464718.1|1290412_1290724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349985.1|1290903_1291320_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.8	1.5e-13
WP_024271969.1|1292070_1292499_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003688751.1|1292766_1293054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340463.1|1293077_1293956_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003682913.1|1294493_1295261_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_035437564.1|1296239_1297922_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_035437566.1|1298406_1300131_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_023465823.1|1300226_1300979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639076.1|1301161_1301722_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_107760586.1|1301954_1302839_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050755181.1|1302826_1303447_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_021349699.1|1303629_1304349_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035435887.1|1304874_1306794_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_021349211.1|1306964_1307678_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_021349212.1|1307688_1309350_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_080650636.1|1311317_1312535_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021350120.1|1312494_1312641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683569.1|1313155_1313488_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.9	3.0e-12
WP_004563102.1|1313484_1313850_-	CrcB family protein	NA	NA	NA	NA	NA
WP_004563103.1|1313973_1314366_+	VOC family protein	NA	NA	NA	NA	NA
WP_003683563.1|1314440_1314998_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021350119.1|1317055_1317754_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021350118.1|1318042_1318960_-	ROK family protein	NA	NA	NA	NA	NA
WP_021350117.1|1319031_1319307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350116.1|1319333_1319792_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
1320293:1320329	attL	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
WP_042513877.1|1320411_1321254_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.4	3.9e-64
WP_003688751.1|1321323_1321611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002816285.1|1322271_1322523_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_042513964.1|1322576_1323419_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
1328223:1328259	attR	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
>prophage 13
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1444113	1504083	2297851	tRNA,transposase	Bacillus_phage(33.33%)	49	NA	NA
WP_048340520.1|1444113_1445364_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	9.0e-57
WP_042513997.1|1445658_1446816_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	3.6e-36
WP_003617037.1|1446960_1447596_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003683319.1|1447787_1450292_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_035437492.1|1450293_1451376_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_046947974.1|1451405_1452281_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021350105.1|1452321_1452759_-	signal peptidase II	NA	NA	NA	NA	NA
WP_035437494.1|1452758_1453193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683308.1|1453205_1453607_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_004563210.1|1453762_1454365_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003683304.1|1454588_1455452_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012391396.1|1455665_1456355_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080650635.1|1456441_1457140_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|1457261_1457549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130343.1|1458434_1459283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340521.1|1459988_1461467_+	amidase	NA	NA	NA	NA	NA
WP_042513902.1|1462682_1463816_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683293.1|1463858_1464308_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021349973.1|1464311_1465493_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042513903.1|1465600_1467535_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	31.0	1.4e-64
WP_015639179.1|1468068_1468428_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_042513904.1|1468535_1469132_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_021349975.1|1469223_1469859_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	1.1e-23
WP_048340522.1|1469851_1472116_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004563221.1|1472222_1473134_-	EamA family transporter	NA	NA	NA	NA	NA
WP_021349976.1|1473256_1474276_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003683271.1|1474949_1475957_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003683269.1|1476056_1476785_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_004563225.1|1476876_1478172_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_004563226.1|1478198_1478717_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_021349664.1|1478767_1481608_-	3'-5' exoribonuclease	NA	A0A1X9I5C8	Streptococcus_phage	34.6	3.6e-61
WP_003683265.1|1481837_1482773_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_021349663.1|1482774_1483764_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_021349662.1|1483783_1484893_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_042513905.1|1484948_1486034_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004563232.1|1486190_1486988_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.5e-12
WP_035423839.1|1486998_1487880_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_021349661.1|1487875_1488811_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_042513906.1|1488782_1489646_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_031284457.1|1489982_1491356_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_012391417.1|1491484_1492291_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012391418.1|1492522_1493440_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_021349659.1|1493452_1496632_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_042513907.1|1496631_1497714_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	7.3e-55
WP_021349658.1|1497715_1499005_-	dihydroorotase	NA	NA	NA	NA	NA
WP_021349657.1|1499004_1499970_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.9	1.2e-24
WP_003688751.1|1500668_1500956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340523.1|1500979_1501858_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	2.6e-42
WP_012391547.1|1503204_1504083_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
>prophage 14
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1546319	1623411	2297851	terminase,integrase,capsid,tRNA,plate,head,tail,portal,transposase,protease	Lactobacillus_phage(57.14%)	89	1564475:1564493	1603788:1603806
WP_003683834.1|1546319_1547270_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
WP_021349886.1|1547292_1549710_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_024271946.1|1549685_1550912_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.5	1.2e-48
WP_003686267.1|1550982_1551267_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003683827.1|1551263_1551884_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.9	2.2e-11
WP_014562535.1|1552076_1552394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173425568.1|1552505_1553492_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.8e-44
WP_003686264.1|1553582_1555277_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003683822.1|1555294_1555744_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683820.1|1555757_1556573_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_042513954.1|1556582_1557458_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003683813.1|1557457_1557751_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_012391455.1|1557750_1559199_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	2.8e-33
WP_014562538.1|1559199_1560057_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.9	1.9e-37
WP_021349943.1|1560234_1560654_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003683803.1|1560653_1561094_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_024501048.1|1561184_1562261_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003683800.1|1562346_1562628_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003683798.1|1562651_1562975_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003683797.1|1562987_1563296_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012391458.1|1563459_1564101_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1564475:1564493	attL	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_021349944.1|1564686_1564845_-	hypothetical protein	NA	A0A0A7NU07	Lactobacillus_phage	80.8	3.4e-14
WP_173425569.1|1564900_1565551_-	Fic family protein	NA	NA	NA	NA	NA
WP_021349947.1|1565683_1566847_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	39.1	1.6e-39
WP_021349948.1|1566797_1567232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349949.1|1567231_1567543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349950.1|1567539_1567923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042513835.1|1568123_1569482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042514002.1|1569674_1570895_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.8e-94
WP_021350267.1|1571534_1571678_-	XkdX family protein	NA	NA	NA	NA	NA
WP_021350266.1|1571680_1572046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350265.1|1572060_1572483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053069261.1|1572587_1573460_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_042514001.1|1573472_1573904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350260.1|1573909_1574854_-	collagen-like protein	NA	A0A059PAH9	Leuconostoc_phage	49.1	4.2e-06
WP_107504383.1|1574869_1575502_-	collagen-like protein	NA	NA	NA	NA	NA
WP_021350258.1|1575669_1576932_-	hypothetical protein	NA	D2KRC0	Lactobacillus_phage	40.1	3.6e-45
WP_021350257.1|1576909_1578196_-|tail	phage tail protein	tail	A0A0M7RDS2	Lactobacillus_phage	33.2	3.0e-47
WP_042514000.1|1578209_1579046_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	39.2	2.9e-51
WP_042513999.1|1579109_1583300_-	transglycosylase SLT domain-containing protein	NA	E9LUR1	Lactobacillus_phage	29.7	2.1e-25
WP_042513993.1|1583504_1583834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349161.1|1583906_1584524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349162.1|1584535_1584907_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_024271708.1|1584906_1585344_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	49.7	8.3e-26
WP_031284135.1|1585336_1585705_-|head	phage head closure protein	head	B8R652	Lactobacillus_phage	44.1	3.7e-19
WP_021349164.1|1585676_1585979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031284136.1|1585999_1587766_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	53.5	1.4e-135
WP_042513992.1|1587698_1588919_-|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	49.0	5.6e-96
WP_021349166.1|1588918_1589101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053069263.1|1589115_1591017_-|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	63.9	7.3e-244
WP_031284139.1|1591016_1591478_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	51.7	6.9e-39
WP_042513990.1|1591676_1592183_-	hypothetical protein	NA	B8R694	Lactobacillus_phage	57.2	2.5e-42
WP_021349168.1|1592443_1592929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349170.1|1593107_1593560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349171.1|1593630_1594323_-	helix-turn-helix domain-containing protein	NA	Q8SDH3	Lactococcus_phage	41.9	3.3e-16
WP_021349172.1|1594336_1594858_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	54.3	2.3e-30
WP_021349173.1|1594857_1595706_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	85.1	6.3e-147
WP_080964997.1|1595698_1596727_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	79.3	6.1e-112
WP_021349175.1|1596696_1596906_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	76.8	2.2e-24
WP_173425570.1|1596942_1597107_-	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	79.6	3.1e-10
WP_016058055.1|1597246_1597573_-	hypothetical protein	NA	E9LUL9	Lactobacillus_phage	100.0	4.2e-59
WP_021349178.1|1597631_1597859_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_021349179.1|1597855_1598038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349180.1|1598050_1598833_-	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	67.3	4.8e-101
WP_021349181.1|1598833_1599073_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021349182.1|1599251_1599590_+	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	40.4	3.1e-12
WP_021349183.1|1599610_1600021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349184.1|1600042_1600570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349185.1|1600630_1601176_+	DUF5067 domain-containing protein	NA	H9A0K2	Staphylococcus_phage	34.2	4.0e-09
WP_021349186.1|1601450_1602443_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	26.9	1.2e-27
WP_021349187.1|1602698_1603787_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	97.8	2.4e-199
WP_003683795.1|1604348_1604882_-	hypothetical protein	NA	NA	NA	NA	NA
1603788:1603806	attR	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_024271715.1|1604874_1605843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686245.1|1605835_1606729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686242.1|1607298_1608651_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_021349189.1|1608849_1609773_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_024271716.1|1609871_1610048_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003686239.1|1610227_1610647_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003686237.1|1610671_1611634_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003683770.1|1611651_1611888_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_021349191.1|1611884_1612550_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003683766.1|1612552_1613107_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003683763.1|1613330_1613480_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_021349192.1|1613622_1615707_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_035436218.1|1615909_1618537_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003683757.1|1618588_1619065_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012391468.1|1619137_1619788_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.1	5.0e-35
WP_003683754.1|1619920_1622359_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024501053.1|1622364_1623411_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.9	2.4e-26
>prophage 15
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1695381	1811783	2297851	protease,tRNA,transposase	Streptococcus_phage(16.13%)	104	NA	NA
WP_012390701.1|1695381_1695834_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_173425572.1|1695866_1696004_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015639280.1|1695993_1696512_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012391508.1|1696666_1697098_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012391509.1|1697309_1697813_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_021349266.1|1697966_1698827_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	66.7	8.2e-17
WP_042513917.1|1699235_1700306_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.2	1.5e-07
WP_035437347.1|1700514_1701852_-	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	29.0	8.5e-21
WP_012391513.1|1702003_1702876_-	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012391514.1|1702884_1703466_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_031284742.1|1703410_1705627_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.8	1.3e-247
WP_042513916.1|1705994_1706678_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003683590.1|1706700_1707522_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042513915.1|1707786_1708107_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_021350189.1|1708254_1708404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513914.1|1708836_1710123_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_024271872.1|1710124_1710280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350166.1|1716738_1716987_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_021350167.1|1717320_1718340_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003684207.1|1718341_1719367_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035431252.1|1719359_1720577_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021350168.1|1720792_1722523_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_004563061.1|1722524_1722791_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_051132377.1|1722920_1723163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350169.1|1723336_1725583_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_012391521.1|1725835_1726543_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003684192.1|1726669_1727245_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_021349806.1|1727237_1728665_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	1.3e-96
WP_003684189.1|1728829_1729423_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_021349807.1|1729578_1730298_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003684186.1|1730308_1731097_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	7.5e-25
WP_004563054.1|1731086_1731971_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024501089.1|1732049_1733294_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_015639300.1|1733602_1733746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349810.1|1733936_1734635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562576.1|1734647_1735508_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.6e-17
WP_003684176.1|1735494_1735872_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349811.1|1735981_1736914_-	dTDP-glucose 4,6-dehydratase	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	40.5	1.0e-57
WP_021349812.1|1736934_1738581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514042.1|1738610_1739600_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_042514043.1|1739627_1741379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340525.1|1741389_1743000_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.3	2.6e-32
WP_021349815.1|1742959_1744672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514010.1|1744857_1745790_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.5e-27
WP_021349116.1|1746498_1747464_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	34.5	1.3e-47
WP_042514009.1|1747448_1748993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514008.1|1748995_1750687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340526.1|1750754_1751633_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_024271831.1|1751656_1751944_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349529.1|1752169_1753138_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	28.9	1.5e-19
WP_107504377.1|1753816_1754698_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048340527.1|1754815_1756003_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.4e-37
WP_024271893.1|1756131_1756419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340528.1|1756442_1757321_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_021350366.1|1757463_1759125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350367.1|1759130_1760249_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021350368.1|1760248_1761181_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.0	5.8e-77
WP_076811603.1|1761270_1761834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080965018.1|1761976_1763698_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	43.0	2.3e-10
WP_162485012.1|1763990_1765607_-	KxYKxGKxW signal peptide domain-containing protein	NA	A0A059PAX1	Leuconostoc_phage	44.0	7.1e-22
WP_080965001.1|1766785_1768609_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	48.0	2.0e-28
WP_042513860.1|1768743_1769760_-	acyltransferase	NA	NA	NA	NA	NA
WP_021350389.1|1769787_1770828_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021350388.1|1770827_1772255_-	flippase	NA	NA	NA	NA	NA
WP_021350387.1|1772257_1773379_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	78.1	1.3e-171
WP_048340529.1|1773671_1774892_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.8e-94
WP_053069266.1|1775363_1776239_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_021350018.1|1776240_1777257_-	sugar transferase	NA	NA	NA	NA	NA
WP_021350017.1|1777222_1778434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350016.1|1778492_1779305_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_021350015.1|1779317_1779941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350014.1|1779951_1780713_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_003684130.1|1780724_1781378_-	sugar transferase	NA	NA	NA	NA	NA
WP_003684128.1|1782458_1782665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684127.1|1782700_1782916_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_014562591.1|1783096_1783993_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_162485013.1|1785482_1786064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042514012.1|1786344_1787595_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	1.8e-57
WP_012390701.1|1787673_1788126_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_021349826.1|1788830_1789688_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_012391556.1|1789800_1790247_+	flavodoxin	NA	NA	NA	NA	NA
WP_012391557.1|1790256_1790691_+	GtrA family protein	NA	NA	NA	NA	NA
WP_107504378.1|1790928_1791018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562594.1|1791345_1792665_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.1	1.7e-34
WP_003684114.1|1792677_1793688_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003684113.1|1793852_1794218_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003684112.1|1794311_1794881_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_021349825.1|1794881_1795784_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_024271933.1|1795948_1797457_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003684109.1|1797571_1798351_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003684108.1|1798493_1798847_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_024271931.1|1799388_1801014_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.3e-44
WP_004563019.1|1801183_1801651_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	9.2e-15
WP_021349823.1|1801731_1802295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349821.1|1802764_1804024_-	LCP family protein	NA	NA	NA	NA	NA
WP_003684094.1|1804246_1804795_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349818.1|1805690_1806167_+	MFS transporter	NA	NA	NA	NA	NA
WP_021349817.1|1806198_1806717_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.1e-31
WP_021350115.1|1806807_1807401_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004563006.1|1807418_1807640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684085.1|1807677_1808367_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	3.4e-34
WP_075667505.1|1809089_1809533_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024271999.1|1809674_1811213_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003684080.1|1811276_1811783_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1817062	1875580	2297851	holin,terminase,capsid,tRNA,head,tail,portal,transposase,protease	Erysipelothrix_phage(54.17%)	49	NA	NA
WP_080965019.1|1817062_1817533_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	29.4	1.3e-13
WP_080965002.1|1817697_1818606_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.1	9.2e-11
WP_003684067.1|1819168_1820521_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_003684065.1|1820902_1822273_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	1.1e-10
WP_014562705.1|1822528_1823716_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_003688751.1|1824381_1824669_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349147.1|1825665_1826316_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681670.1|1826340_1826622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681668.1|1826673_1826901_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_021349148.1|1826923_1828852_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	3.7e-94
WP_024501125.1|1829000_1829561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340531.1|1830342_1831563_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
WP_021349829.1|1831734_1833990_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.4	7.9e-213
WP_021349830.1|1834203_1834485_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	53.3	2.6e-20
WP_035435834.1|1834465_1835821_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.8	4.1e-156
WP_021349831.1|1835817_1836285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349832.1|1836431_1836809_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	54.7	5.7e-31
WP_021349833.1|1836929_1837472_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.1e-56
WP_021349834.1|1837471_1838698_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	3.0e-150
WP_021349835.1|1838770_1839391_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	43.6	6.5e-40
WP_021349836.1|1839393_1839600_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_080650631.1|1839700_1841263_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.5	5.5e-245
WP_021349838.1|1841291_1842557_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	62.3	5.5e-155
WP_003671987.1|1842553_1843225_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	4.4e-58
WP_021349839.1|1843243_1844422_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.1e-128
WP_003671991.1|1844438_1844717_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021349840.1|1844716_1845100_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_021349841.1|1845086_1845497_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	1.7e-41
WP_035437374.1|1845965_1846199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437377.1|1846234_1847896_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.1	5.5e-102
WP_035437379.1|1847888_1849466_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	48.9	1.1e-131
WP_162485015.1|1849796_1851380_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_080965003.1|1855570_1855891_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_162485016.1|1855871_1856720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349527.1|1857282_1858659_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	52.0	6.7e-130
WP_021816445.1|1858767_1859781_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_021349526.1|1859793_1861218_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_021349525.1|1861231_1862695_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_021349524.1|1862694_1863015_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_021349523.1|1863189_1864302_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_021349522.1|1864304_1866344_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	1.4e-99
WP_014562612.1|1866345_1868616_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	4.8e-133
WP_003681628.1|1868793_1869966_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003681626.1|1869967_1870555_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003681625.1|1870570_1871185_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	51.7	2.9e-32
WP_003681624.1|1871579_1872353_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_004562969.1|1873844_1874240_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004562968.1|1874253_1874697_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003681620.1|1874803_1875580_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	1993966	2029268	2297851	transposase	Lactobacillus_phage(16.67%)	30	NA	NA
WP_012390893.1|1993966_1994854_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
WP_048340205.1|1994850_1995387_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003681394.1|1995614_1996091_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_021350081.1|1996151_1997267_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.9	2.7e-73
WP_021350080.1|1997645_1998656_-	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_003681382.1|1998849_1999446_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	43.4	5.3e-23
WP_004562874.1|1999464_1999986_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021350079.1|2000282_2001803_+	LytTR family transcriptional regulator	NA	O64031	Bacillus_phage	25.3	1.4e-32
WP_012391656.1|2001799_2002258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350078.1|2002728_2003151_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051295774.1|2003427_2004162_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_015639467.1|2004162_2005179_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_003681368.1|2005181_2005610_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003681367.1|2005581_2006970_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_024501182.1|2006956_2007706_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_023466086.1|2007718_2008930_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_003681364.1|2009021_2010191_-	MFS transporter	NA	NA	NA	NA	NA
WP_042513979.1|2010265_2010721_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	3.6e-32
WP_048340533.1|2010794_2012045_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_021349311.1|2012775_2014107_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-21
WP_003681362.1|2014260_2014575_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.6	1.4e-14
WP_021349622.1|2015624_2016875_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_042514011.1|2016953_2017406_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	9.5e-33
WP_021350096.1|2017594_2017843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350097.1|2018210_2019563_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.5	1.8e-18
WP_003681354.1|2019543_2020998_-	amino acid permease	NA	NA	NA	NA	NA
WP_021350100.1|2021921_2022752_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004562848.1|2023388_2024771_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_015639484.1|2024770_2026060_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_048340534.1|2028047_2029268_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.1e-94
>prophage 18
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	2067549	2118571	2297851	transposase	Streptococcus_phage(14.29%)	43	NA	NA
WP_042513972.1|2067549_2068689_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_024271725.1|2069909_2072612_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_024271724.1|2072650_2073187_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681275.1|2073412_2074456_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_015639517.1|2074708_2075626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350176.1|2075637_2076117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681269.1|2076217_2076667_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003681268.1|2076707_2077292_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	29.9	5.9e-11
WP_003685361.1|2077291_2077708_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003681266.1|2077808_2079197_+	amino acid permease	NA	NA	NA	NA	NA
WP_021350179.1|2079683_2082080_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_048340535.1|2082272_2083316_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	39.5	4.1e-55
WP_042513950.1|2083462_2084821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042513949.1|2085110_2086469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349769.1|2086814_2087270_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	6.2e-32
WP_024501211.1|2087384_2088296_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003681263.1|2088317_2088956_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_021349770.1|2089274_2091011_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003681260.1|2091240_2092191_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	52.7	2.9e-92
WP_021349771.1|2092200_2093121_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	30.9	3.0e-25
WP_003681258.1|2093131_2095297_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	57.6	4.7e-239
WP_003681257.1|2095293_2095755_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_015639530.1|2096108_2096708_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_021349773.1|2096700_2096844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024271900.1|2097062_2098136_-	phosphoesterase	NA	NA	NA	NA	NA
WP_021349775.1|2098225_2099770_-	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	26.6	1.2e-39
WP_012391709.1|2100329_2101322_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021349776.1|2101321_2102221_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003681249.1|2102213_2102975_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.9	2.2e-10
WP_003681248.1|2103230_2103566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349777.1|2103638_2104853_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.8	1.0e-28
WP_031284549.1|2106692_2107568_-	ROK family protein	NA	NA	NA	NA	NA
WP_021353730.1|2107587_2108940_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003681238.1|2109110_2110094_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015639536.1|2110077_2110962_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003681233.1|2111081_2112002_-	ribokinase	NA	NA	NA	NA	NA
WP_003681231.1|2112286_2112607_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	41.6	3.2e-19
WP_021350174.1|2112581_2113391_-	TerC family protein	NA	S5MAL1	Bacillus_phage	44.0	3.4e-41
WP_107504381.1|2113447_2114335_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003681225.1|2114424_2115345_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_021350172.1|2115566_2116898_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.5	1.4e-28
WP_050755181.1|2117078_2117699_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|2117686_2118571_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP011536	Lactobacillus fermentum 3872 chromosome, complete genome	2297851	2150756	2224343	2297851	tRNA,transposase	Paenibacillus_phage(22.22%)	56	NA	NA
WP_080965008.1|2150756_2151665_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_014562701.1|2151964_2152975_-	nickel transporter NixA	NA	NA	NA	NA	NA
WP_021349213.1|2153003_2153831_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_012391743.1|2153855_2154566_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_012391744.1|2154567_2155932_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_012391745.1|2155931_2156690_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
WP_012391746.1|2156697_2157981_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_023466300.1|2158221_2158893_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562706.1|2163431_2165153_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003681137.1|2165340_2166669_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003681135.1|2166683_2167079_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_021349696.1|2167102_2168020_-	ribokinase	NA	NA	NA	NA	NA
WP_021349649.1|2168264_2169224_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042514002.1|2169290_2170511_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.8e-94
WP_012391752.1|2170666_2171320_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003685477.1|2171333_2172350_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003685479.1|2172383_2173331_+	ribokinase	NA	NA	NA	NA	NA
WP_014562709.1|2173390_2174815_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014562710.1|2175012_2176017_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350294.1|2176570_2178076_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_042513835.1|2178866_2180225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562712.1|2180816_2183216_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012391758.1|2183421_2184219_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003685491.1|2184225_2184954_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|2185097_2185598_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003681114.1|2185601_2186345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349122.1|2186404_2187841_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_014562716.1|2188076_2188889_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|2189154_2189670_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003685499.1|2189679_2190207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|2190355_2191741_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|2191827_2192292_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021349399.1|2192536_2192968_-	VOC family protein	NA	NA	NA	NA	NA
WP_021349400.1|2193160_2194330_+	MFS transporter	NA	NA	NA	NA	NA
WP_024501234.1|2194701_2196183_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	3.1e-72
WP_012391767.1|2196367_2197807_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_021350129.1|2198061_2198535_-	universal stress protein	NA	NA	NA	NA	NA
WP_021350128.1|2198696_2199152_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350127.1|2199310_2200078_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	5.6e-17
WP_024501235.1|2200094_2201096_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350126.1|2201367_2203176_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014562721.1|2203178_2204471_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_021350125.1|2204718_2205390_+	membrane protein	NA	NA	NA	NA	NA
WP_023467458.1|2207045_2208725_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004562986.1|2209307_2209967_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_042513953.1|2211426_2212647_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_042513951.1|2214260_2215679_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_021349480.1|2215679_2216834_+	C40 family peptidase	NA	Q4Z9E1	Staphylococcus_phage	40.9	1.7e-14
WP_019875121.1|2216847_2217465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349292.1|2217451_2217820_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_021349293.1|2217820_2218291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349294.1|2218292_2219843_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_021349295.1|2219857_2220232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031284216.1|2220255_2221095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513950.1|2221336_2222695_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042513949.1|2222984_2224343_+|transposase	transposase	transposase	NA	NA	NA	NA
