The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	1370939	1391361	4797171	tail,plate	Burkholderia_phage(45.0%)	25	NA	NA
WP_000587738.1|1370939_1371668_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_000084338.1|1372405_1372861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023785434.1|1372857_1373463_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_001747515.1|1373467_1375213_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.2e-51
WP_000359502.1|1375215_1375848_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951740.1|1375840_1376956_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.2	2.9e-99
WP_001093501.1|1376946_1377306_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632050.1|1377469_1379017_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_000703629.1|1379016_1379946_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_000593184.1|1379942_1380305_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000679392.1|1380632_1381355_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818151.1|1381364_1382408_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.3	8.5e-77
WP_001269716.1|1382395_1382605_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271418.1|1382604_1383558_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.9e-36
WP_001262488.1|1383557_1385912_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_001185654.1|1386008_1386137_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003644.1|1386096_1386414_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|1386465_1386990_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729845.1|1386989_1388417_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.6	2.8e-195
WP_000875314.1|1388406_1388604_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449437.1|1388600_1389056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|1389214_1389529_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270445.1|1389541_1390147_-	murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	61.0	5.9e-62
WP_001226439.1|1390149_1390437_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|1391013_1391361_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	1667270	1722792	4797171	tail,tRNA,transposase,integrase	Salmonella_phage(18.18%)	57	1693068:1693083	1709615:1709630
WP_000252549.1|1667270_1667717_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|1667791_1668178_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_000148570.1|1668254_1668716_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|1668728_1669664_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000249504.1|1669699_1669801_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
WP_001518160.1|1669780_1669921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666051.1|1669890_1670379_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000514438.1|1670565_1671969_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000237031.1|1672024_1673029_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428749.1|1673140_1674073_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410847.1|1674083_1675304_-	arginine deiminase	NA	NA	NA	NA	NA
WP_001527132.1|1675404_1675596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071591653.1|1675814_1676003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583453.1|1675979_1676432_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000103041.1|1676505_1677510_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002940.1|1677675_1678092_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
WP_000218447.1|1678103_1678916_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_000826193.1|1679160_1679649_-	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_001747736.1|1679756_1680260_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001066989.1|1680454_1681642_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416337.1|1681783_1684639_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	9.3e-142
WP_000190703.1|1684638_1685121_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|1685218_1686730_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_001541433.1|1686773_1686893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071590433.1|1686966_1687161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000584132.1|1687123_1688224_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001182242.1|1688223_1689306_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001244060.1|1689501_1690500_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001128356.1|1690563_1691883_-	fructuronate transporter	NA	NA	NA	NA	NA
WP_000998688.1|1691944_1692709_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000453362.1|1692733_1693765_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
1693068:1693083	attL	TTTTCTGCTTTCCAGC	NA	NA	NA	NA
WP_000896759.1|1693981_1694512_+	D-gluconate kinase	NA	NA	NA	NA	NA
WP_000152567.1|1694539_1695559_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.5	3.9e-42
WP_000772651.1|1696030_1697293_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.6	2.8e-66
WP_001066528.1|1697323_1697962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455466.1|1698332_1698563_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071591111.1|1698624_1699209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247004.1|1699201_1699561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027149.1|1699592_1699877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075576.1|1699873_1700257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211874.1|1700253_1702926_+	alkaline-shock protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_001066192.1|1703326_1704088_+	septation initiation protein	NA	NA	NA	NA	NA
WP_001185338.1|1704087_1704360_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	46.9	6.3e-08
WP_006501160.1|1704537_1704717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292737.1|1704736_1705048_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	66.0	2.4e-27
WP_001747644.1|1705062_1705182_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_001280979.1|1705174_1707808_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	31.3	5.8e-106
WP_000254751.1|1709109_1709358_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000016244.1|1709466_1709706_+	antitoxin	NA	NA	NA	NA	NA
1709615:1709630	attR	GCTGGAAAGCAGAAAA	NA	NA	NA	NA
WP_001199743.1|1709708_1710017_+	cytotoxin	NA	NA	NA	NA	NA
WP_000142420.1|1711697_1712624_-	recombinase	NA	NA	NA	NA	NA
WP_031602458.1|1714516_1714972_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_001748007.1|1716073_1716367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055457.1|1716898_1717867_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001052203.1|1717863_1719876_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000121182.1|1719875_1721264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031602459.1|1722093_1722792_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	1.1e-06
>prophage 3
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	2762009	2771357	4797171	protease,integrase	Dickeya_phage(16.67%)	10	2763260:2763274	2776921:2776935
WP_001201750.1|2762009_2763128_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125885.1|2763124_2765071_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
2763260:2763274	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_071524039.1|2765051_2765246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447499.1|2765200_2765422_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2765745_2766066_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934057.1|2766096_2768373_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-164
WP_071591100.1|2768568_2768898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001747668.1|2768869_2769346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117984.1|2770620_2770818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001747671.1|2770979_2771357_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
2776921:2776935	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	3960712	3971219	4797171		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3960712_3962026_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565903.1|3962052_3963132_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648785.1|3963136_3963910_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018219.1|3963925_3964900_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973710.1|3964905_3965457_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.3e-52
WP_000857531.1|3965457_3966336_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023665.1|3966383_3967283_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	1.1e-29
WP_000697849.1|3967282_3968368_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.0e-101
WP_000981469.1|3968744_3969638_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111843.1|3969815_3971219_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 5
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	4047249	4056420	4797171	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|4047249_4049283_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703143.1|4049523_4049982_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_001197951.1|4050153_4050684_+	lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|4050740_4051208_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|4051254_4051974_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000272851.1|4051970_4053656_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	6.2e-279
WP_001240418.1|4053878_4054610_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|4054669_4054777_+	membrane protein	NA	NA	NA	NA	NA
WP_000824850.1|4054757_4055489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|4055472_4056420_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 6
NZ_CP011259	Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1, complete genome	4797171	4525881	4652330	4797171	capsid,portal,holin,tail,tRNA,terminase,head,integrase,plate	Salmonella_phage(48.19%)	124	4617604:4617650	4651537:4651583
WP_000083343.1|4525881_4526619_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000219174.1|4526749_4528084_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001747585.1|4528101_4529001_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|4529103_4529691_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
WP_000627811.1|4529752_4530136_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179975.1|4530454_4531144_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	50.0	2.1e-55
WP_000997368.1|4531259_4532297_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|4532500_4532920_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183644.1|4532992_4533673_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082651.1|4533726_4536387_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|4536501_4537857_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
WP_001264468.1|4537899_4538223_+	lipoprotein	NA	NA	NA	NA	NA
WP_000807814.1|4538219_4539521_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
WP_000985658.1|4539624_4540080_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_001235092.1|4546135_4548709_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|4548838_4549570_-	laccase domain-containing protein	NA	NA	NA	NA	NA
WP_000079130.1|4549566_4550547_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
WP_000197660.1|4550678_4551416_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|4551687_4552026_+	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
WP_001156921.1|4552183_4552570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777801.1|4552705_4554178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001747522.1|4555295_4556996_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_000200791.1|4556998_4557544_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267954.1|4557515_4558241_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_001215677.1|4558230_4558761_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000084303.1|4558763_4560776_-|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001001824.1|4560785_4561373_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_000136927.1|4561365_4562550_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001002797.1|4562546_4562876_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811100.1|4562872_4564840_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_000411500.1|4565027_4565285_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_001747519.1|4565271_4565505_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_000376378.1|4565431_4565764_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000175558.1|4565763_4566105_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|4566101_4566398_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|4566410_4566866_-	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_000220184.1|4566862_4567990_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000606933.1|4567986_4568691_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000080871.1|4568687_4569170_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000491223.1|4569166_4569619_-	hypothetical protein	NA	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_001177276.1|4569717_4570416_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_001176503.1|4570427_4571456_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_000273112.1|4571490_4572480_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001151938.1|4572537_4574322_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000746494.1|4574318_4575338_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_000088096.1|4575337_4575661_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000994501.1|4575688_4578346_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000922120.1|4578384_4578603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|4578605_4579175_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000645096.1|4579184_4579517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661531.1|4579542_4579881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185337.1|4579978_4580284_+	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000615542.1|4580323_4581343_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000200080.1|4581653_4582814_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210991.1|4582774_4583683_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|4583740_4584862_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|4584871_4585942_-	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4586381_4586900_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_001030981.1|4586892_4588113_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|4588269_4588617_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|4588657_4589425_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|4589469_4590018_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|4590036_4590285_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|4590537_4591899_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|4592064_4592856_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001519447.1|4592920_4594162_+	membrane protein	NA	NA	NA	NA	NA
WP_001294018.1|4594282_4594888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|4594922_4595513_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|4595636_4596515_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880958.1|4596600_4598262_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|4598410_4598749_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|4598914_4599205_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|4599194_4599671_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_001518569.1|4599820_4600303_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237691.1|4600917_4612392_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533865.1|4612456_4613866_+	TolC family type I secretion outer membrane protein	NA	NA	NA	NA	NA
WP_000196133.1|4613862_4616043_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_072101449.1|4616050_4617214_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
4617604:4617650	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_000980498.1|4617765_4617984_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001102264.1|4618052_4619153_-	late control protein D	NA	E5G6Q3	Salmonella_phage	95.4	3.4e-193
WP_000980408.1|4619149_4619635_-|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	99.2	1.3e-67
WP_001282774.1|4619631_4622439_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.4	0.0e+00
WP_000763316.1|4622431_4622551_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280962.1|4622565_4622868_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_001207647.1|4622922_4623438_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_000046109.1|4623447_4624620_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_000680168.1|4624750_4625278_-|tail	tail protein	tail	NA	NA	NA	NA
WP_001274653.1|4625280_4627047_-|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_001086806.1|4627043_4627649_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	8.3e-117
WP_000268275.1|4627641_4628550_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.3	3.2e-157
WP_000177401.1|4628536_4628896_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_000993746.1|4628892_4629471_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	8.8e-108
WP_001099507.1|4629550_4630996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343945.1|4631007_4631457_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.1	2.5e-65
WP_001039963.1|4631449_4631881_-|tail	tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	5.6e-75
WP_001177678.1|4631843_4632047_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	97.0	3.4e-30
WP_001747966.1|4631976_4632402_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	8.5e-68
WP_000731036.1|4632401_4632779_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001069919.1|4632783_4633293_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000171565.1|4633273_4633489_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868193.1|4633492_4633696_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.9e-33
WP_000673523.1|4633695_4634160_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059168.1|4634253_4634904_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730758.1|4634907_4635969_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000216226.1|4635985_4636819_-|capsid	phage capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	1.3e-120
WP_001098457.1|4636961_4638728_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.0	0.0e+00
WP_000520367.1|4638727_4639756_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	92.9	4.9e-178
WP_000059520.1|4639802_4641467_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_000698373.1|4641705_4642083_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	3.4e-28
WP_014344394.1|4642060_4643170_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_001217560.1|4643275_4643509_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.2e-31
WP_001154443.1|4643520_4643709_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_000301162.1|4644032_4646276_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
WP_000104120.1|4646266_4647124_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|4647120_4647348_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|4647347_4647581_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|4647648_4647990_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|4648209_4648668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957776.1|4648615_4648849_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	4.7e-12
WP_000460862.1|4648856_4649366_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000102104.1|4649401_4649641_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052560.1|4649757_4650390_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_001536726.1|4650393_4651419_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_001650427.1|4651748_4652330_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	55.8	1.5e-51
4651537:4651583	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
