The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	1625239	1634410	4572929	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1625239_1626187_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1626170_1626902_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1626882_1626990_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1627049_1627781_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023207585.1|1628003_1629689_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
WP_000598637.1|1629685_1630405_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1630451_1630919_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023137005.1|1630975_1631506_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1631677_1632136_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_023137006.1|1632376_1634410_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	1701636	1707942	4572929		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023207415.1|1701636_1703040_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
WP_000981469.1|1703217_1704111_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_023207414.1|1704487_1705573_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.1e-102
WP_001023664.1|1705572_1706472_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_001645078.1|1706519_1707398_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.0e-107
WP_001645077.1|1707402_1707942_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.5	2.9e-52
>prophage 3
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	1799409	1806678	4572929		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1799409_1799829_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023207907.1|1799831_1801100_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	9.9e-229
WP_000208509.1|1801554_1801767_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1801777_1801966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207908.1|1802226_1803438_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.6	2.4e-107
WP_076018265.1|1804087_1804387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207910.1|1804478_1805174_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	3.6e-07
WP_001642793.1|1805247_1806678_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	1845176	1882409	4572929	integrase,capsid,holin,plate,lysis,head,tail,terminase,portal	Enterobacteria_phage(67.74%)	51	1844869:1844924	1882487:1882542
1844869:1844924	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCAT	NA	NA	NA	NA
WP_023207917.1|1845176_1845317_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	60.0	6.8e-06
WP_023207918.1|1845474_1845723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024146651.1|1845723_1845996_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_076018266.1|1846041_1847172_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.2	7.4e-151
WP_023207922.1|1847330_1848518_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	82.0	2.2e-185
WP_000115856.1|1848518_1849031_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_023207923.1|1849073_1849430_+|tail	putative tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_024144912.1|1849429_1849594_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.5e-15
WP_023207924.1|1849580_1852526_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	48.6	1.4e-233
WP_023207925.1|1852539_1853028_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	78.9	3.3e-71
WP_023207926.1|1853047_1853422_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	36.6	3.1e-13
WP_023207927.1|1853533_1854205_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	62.0	2.5e-77
WP_023207928.1|1854218_1856210_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	50.2	2.4e-173
WP_023207929.1|1856215_1856743_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	1.4e-56
WP_023207930.1|1856735_1857632_-|plate	baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.2e-106
WP_000127183.1|1857618_1857987_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	2.9e-40
WP_023207931.1|1857983_1858574_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	69.4	1.7e-69
WP_023207932.1|1858570_1859206_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	60.3	2.0e-65
WP_076018267.1|1859202_1859679_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.0	8.4e-40
WP_023207934.1|1859665_1860157_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.8	9.3e-34
WP_023207935.1|1860163_1860607_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	4.8e-45
WP_001624330.1|1860603_1860981_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_023207936.1|1860971_1861172_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	78.5	4.8e-21
WP_001624329.1|1861171_1861666_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	59.5	3.8e-51
WP_023207937.1|1861767_1862598_-|terminase	terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	65.8	4.8e-91
WP_023207938.1|1862644_1863730_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.1	2.2e-136
WP_023207939.1|1863753_1864590_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	5.7e-100
WP_023207940.1|1864746_1866501_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.2	3.2e-262
WP_023207941.1|1866500_1867550_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.9	4.3e-153
WP_023207942.1|1868018_1868396_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_023207943.1|1868399_1869020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207945.1|1869431_1869851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078048689.1|1869843_1872228_-	replication protein	NA	A0A0M4RTM8	Salmonella_phage	48.3	4.2e-172
WP_023207948.1|1873358_1873898_-	hypothetical protein	NA	A0A2I7RQG9	Vibrio_phage	41.8	1.4e-06
WP_023207949.1|1873894_1874827_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	48.4	3.3e-64
WP_023170325.1|1874823_1875102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207950.1|1875098_1875632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|1875619_1875877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001624305.1|1875873_1876314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207952.1|1876389_1876581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207953.1|1876577_1876754_-	LapA family protein	NA	NA	NA	NA	NA
WP_023207954.1|1876758_1877001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207955.1|1877070_1877949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207956.1|1878066_1878249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207957.1|1878245_1878656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207958.1|1878909_1879113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207959.1|1879109_1879316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207960.1|1879393_1879777_+	helix-turn-helix domain-containing protein	NA	Q6QID2	Burkholderia_phage	55.5	1.4e-21
WP_023207961.1|1879799_1880471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207962.1|1880487_1881387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207963.1|1881383_1882409_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	60.3	5.4e-108
1882487:1882542	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCAT	NA	NA	NA	NA
>prophage 5
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	2130335	2136997	4572929		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2130335_2131142_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2131143_2132136_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2132135_2133026_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001605114.1|2133848_2134571_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_001096568.1|2135041_2135224_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
WP_071786811.1|2135473_2135614_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	2.5e-08
WP_001605118.1|2135652_2135952_+	putative pertussis-like toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
WP_000727928.1|2135878_2136304_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2136682_2136997_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	2604682	2612958	4572929		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2604682_2604922_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023208248.1|2605132_2605297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2605794_2606604_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2606676_2607054_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158845.1|2607201_2607744_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2607927_2608656_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275698.1|2608672_2609086_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_023196912.1|2610136_2611261_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444508.1|2611707_2612958_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 7
NZ_CP019192	Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 chromosome, complete genome	4572929	3417105	3422932	4572929		Enterobacteria_phage(100.0%)	9	NA	NA
WP_023208153.1|3417105_3419439_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_023208154.1|3419453_3419774_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023208155.1|3419770_3419998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304952.1|3419994_3420546_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.5e-35
WP_023208157.1|3420542_3420809_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.3e-31
WP_162272376.1|3420913_3421051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023208158.1|3421369_3422107_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	7.6e-80
WP_023208159.1|3422103_3422349_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	2.2e-31
WP_023208160.1|3422365_3422932_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	61.6	1.1e-54
