The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	1100053	1192853	4580689	holin,tRNA,portal,tail,capsid,integrase,terminase,head,plate	Cronobacter_phage(67.5%)	80	1098906:1098954	1131174:1131222
1098906:1098954	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTC	NA	NA	NA	NA
WP_012532529.1|1100053_1101067_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
WP_000687097.1|1101066_1101639_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_023211710.1|1102021_1102525_+	phage protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000643374.1|1102534_1102762_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000022786.1|1103176_1103578_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057334.1|1103645_1103876_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_023211708.1|1103866_1104679_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.6	3.0e-122
WP_016504913.1|1104719_1104863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137729.1|1104989_1106741_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_000960960.1|1106853_1107072_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001552031.1|1107045_1107369_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_046598166.1|1107365_1108370_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.3	1.6e-160
WP_001151947.1|1108424_1110200_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000018798.1|1110360_1111161_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|1111222_1112245_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218536.1|1112248_1112950_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_000447487.1|1113010_1113499_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084220.1|1113495_1114002_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560074.1|1113998_1114706_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000220202.1|1114702_1115830_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000166742.1|1115826_1116282_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_001154425.1|1116291_1116585_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1116581_1116923_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376372.1|1116922_1117255_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000411339.1|1117401_1117659_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811085.1|1117846_1119817_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_001002797.1|1119813_1120143_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136924.1|1120139_1121324_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001001826.1|1121316_1121904_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000084304.1|1121913_1123941_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_000421117.1|1123958_1124486_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000267952.1|1124475_1125201_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000200793.1|1125172_1125718_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_011233142.1|1125720_1127421_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000136561.1|1128100_1129219_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001177838.1|1130843_1131092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342601.1|1131607_1132771_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1131174:1131222	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTC	NA	NA	NA	NA
WP_000196157.1|1132778_1134959_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533854.1|1134955_1136365_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023211703.1|1136429_1147904_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1148522_1149005_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1149153_1149630_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1149619_1149910_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1150075_1150414_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1150562_1152224_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1152309_1153188_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1153310_1153901_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000271804.1|1153941_1154547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127908301.1|1154676_1155963_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1155982_1156774_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460060.1|1156939_1158301_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1158552_1158801_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1158819_1159368_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469802.1|1159412_1160180_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1160220_1160568_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030993.1|1160724_1161945_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_001212373.1|1161937_1162456_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1162895_1163966_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225183.1|1163975_1165097_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210975.1|1165154_1166063_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200087.1|1166023_1167184_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1167283_1167331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1167434_1167773_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1168044_1168782_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1168913_1169894_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992634.1|1169890_1170622_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1170751_1173325_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_023211702.1|1179327_1180131_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_000648518.1|1180152_1181067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127560.1|1181171_1182347_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230970.1|1182478_1183279_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207237.1|1183356_1184127_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|1184182_1185550_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052769.1|1185621_1186377_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801242.1|1186411_1187134_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|1187130_1187598_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|1187661_1188393_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367632.1|1188923_1189967_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145239.1|1189977_1190973_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371505.1|1190969_1192853_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	1817461	1826991	4580689	protease,integrase	Dickeya_phage(16.67%)	8	1818712:1818726	1832187:1832201
WP_001201759.1|1817461_1818580_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125879.1|1818576_1820523_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1818712:1818726	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1820652_1820874_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1821197_1821518_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1821548_1823825_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000274276.1|1824323_1824854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117984.1|1826254_1826452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233091.1|1826613_1826991_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
1832187:1832201	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 3
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	1898265	1944703	4580689	holin,tail,capsid,lysis,integrase	Salmonella_phage(72.13%)	66	1885083:1885098	1923708:1923723
1885083:1885098	attL	TCGGCAATCAGTTTAT	NA	NA	NA	NA
WP_001262313.1|1898265_1899558_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1899602_1899851_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1899891_1900131_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1900136_1901018_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1901014_1902079_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1902156_1902837_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1902833_1903619_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1903624_1903921_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1904011_1904212_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1904500_1904905_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869364.1|1905034_1905271_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1905236_1905611_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1905695_1906679_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1906681_1907431_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1907441_1907789_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1907785_1908310_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1908309_1908783_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1908786_1909359_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|1910204_1910384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1910394_1910892_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1911076_1911316_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|1911650_1912253_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1912461_1913073_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1913069_1913216_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1913205_1914003_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_162096904.1|1914407_1914749_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_046597900.1|1914751_1915378_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	81.2	4.2e-95
WP_046597901.1|1915374_1915860_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	90.7	7.0e-74
WP_000381863.1|1916059_1916323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118125.1|1916392_1917022_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.5	9.3e-111
WP_023203961.1|1917024_1918647_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.6	0.0e+00
WP_000113509.1|1918646_1920116_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.4	5.8e-281
WP_149134875.1|1920000_1920738_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	98.0	1.2e-109
WP_046597884.1|1920752_1921985_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.8e-227
WP_000128060.1|1921989_1922487_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|1922498_1923440_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1923481_1923850_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
1923708:1923723	attR	ATAAACTGATTGCCGA	NA	NA	NA	NA
WP_001125675.1|1923815_1924223_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_046598304.1|1924219_1924774_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	4.1e-94
WP_001142488.1|1924760_1925150_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|1925124_1925688_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_046597885.1|1925691_1926837_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	4.5e-164
WP_046597886.1|1926848_1927289_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	7.8e-56
WP_046597887.1|1927292_1927745_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	77.2	6.5e-58
WP_046597888.1|1927922_1929875_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	52.5	2.7e-169
WP_046597889.1|1929874_1930525_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	61.1	8.0e-57
WP_000388505.1|1930528_1930831_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_046597890.1|1930833_1931865_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.1e-97
WP_046597891.1|1931861_1932203_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	50.5	3.8e-18
WP_052746205.1|1932209_1932527_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	48.4	2.8e-07
WP_077929530.1|1932642_1932807_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_046597892.1|1932879_1933440_+	hypothetical protein	NA	B6SCX2	Bacteriophage	56.1	3.2e-30
WP_046597893.1|1933511_1934258_+	phage-like protein	NA	A0A0P0ZDC0	Stx2-converting_phage	59.6	1.6e-69
WP_046597894.1|1934321_1935077_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	78.1	1.3e-103
WP_023223256.1|1935076_1935430_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	6.0e-59
WP_046597895.1|1935430_1936630_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	6.5e-214
WP_000049936.1|1936626_1937307_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	8.1e-129
WP_046598052.1|1937306_1938521_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	73.3	1.3e-73
WP_046593875.1|1938535_1939054_+|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	50.9	6.6e-46
WP_046593874.1|1939115_1939331_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	92.5	2.2e-27
WP_000364380.1|1939446_1939623_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_042949555.1|1939664_1939976_+	excisionase family DNA-binding protein	NA	F1C5B3	Cronobacter_phage	53.6	1.0e-06
WP_024142956.1|1939998_1940421_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	51.4	2.4e-30
WP_020898641.1|1940469_1941303_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	43.8	3.5e-57
WP_020898642.1|1941424_1941664_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	8.5e-33
WP_000193786.1|1942090_1944703_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 4
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	2121165	2129358	4580689		Escherichia_phage(42.86%)	8	NA	NA
WP_000444503.1|2121165_2122416_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000915986.1|2122874_2123999_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_011233074.1|2124945_2125359_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_011233073.1|2125375_2126104_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_000158843.1|2126295_2126838_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|2126985_2127363_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_011233072.1|2127435_2128245_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_000497451.1|2129118_2129358_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 5
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	2833260	2840488	4580689		Morganella_phage(33.33%)	7	NA	NA
WP_001157323.1|2833260_2834691_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377044.1|2834764_2835460_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001080667.1|2836501_2837680_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_024131163.1|2837940_2838129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2838139_2838352_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457650.1|2838797_2840066_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000394197.1|2840068_2840488_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	2930159	2937815	4580689		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000126347.1|2930159_2931473_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565907.1|2931499_2932579_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.7e-16
WP_000648782.1|2932583_2933357_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2933372_2934347_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|2934352_2934904_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857533.1|2934904_2935783_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_001023655.1|2935830_2936730_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000697846.1|2936729_2937815_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
>prophage 7
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	3016284	3025455	4580689	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195335.1|3016284_3018318_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703141.1|3018558_3019017_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_001265354.1|3019188_3019719_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3019775_3020243_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3020289_3021009_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_023211884.1|3021005_3022691_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.6	4.0e-278
WP_001240418.1|3022913_3023645_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3023704_3023812_+	protein YohO	NA	NA	NA	NA	NA
WP_000824856.1|3023792_3024524_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569167.1|3024507_3025455_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	3254734	3260765	4580689		Salmonella_virus(50.0%)	6	NA	NA
WP_000377775.1|3254734_3255676_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.5	2.7e-146
WP_001682026.1|3256918_3257308_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3257276_3257531_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400612.1|3257547_3259470_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.5	1.9e-300
WP_106417236.1|3260459_3260603_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3260618_3260765_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 9
NZ_CP019185	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 chromosome, complete genome	4580689	3929086	4012024	4580689	transposase,protease,holin,tRNA,portal,tail,capsid,integrase,terminase,head,plate	Enterobacteria_phage(80.39%)	94	3966429:3966445	4018783:4018799
WP_000218449.1|3929086_3929899_-|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_000002940.1|3929910_3930327_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000103041.1|3930492_3931497_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000583456.1|3931571_3932024_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000410839.1|3932698_3933919_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000428752.1|3933929_3934862_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000237031.1|3934973_3935978_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514427.1|3936033_3937434_+	YfcC family protein	NA	NA	NA	NA	NA
WP_000666051.1|3937620_3938109_+	arginine repressor	NA	NA	NA	NA	NA
WP_000249504.1|3938199_3938301_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013055.1|3938336_3939272_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000148563.1|3939284_3939746_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047544.1|3939822_3940209_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000252555.1|3940283_3940730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_113771961.1|3943694_3943793_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181303.1|3943937_3944885_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
WP_000048813.1|3945022_3946441_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000155064.1|3946490_3948143_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187826.1|3948551_3950690_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.2e-266
WP_001009172.1|3950906_3951371_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	56.5	7.9e-51
WP_000220578.1|3951374_3951659_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	8.6e-32
WP_000212724.1|3951648_3951891_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
WP_001212144.1|3951968_3953882_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_000779266.1|3953898_3954639_-	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_001139183.1|3954635_3955754_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_000459927.1|3955737_3956871_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_000392131.1|3956929_3957574_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_000478578.1|3957585_3958362_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_000975187.1|3958384_3958687_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_000435389.1|3958686_3959049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255103.1|3959059_3959398_-	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_001232231.1|3959675_3960062_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000852994.1|3960159_3961512_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_023211864.1|3961607_3962159_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219824.1|3962265_3963657_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853764.1|3963831_3964830_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
WP_000055079.1|3965056_3965587_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_000977193.1|3965996_3967160_+	metallo-dependent hydrolase	NA	NA	NA	NA	NA
3966429:3966445	attL	GCGCTGTTTCGCCAGTA	NA	NA	NA	NA
WP_000203131.1|3967156_3968365_+	MFS transporter	NA	NA	NA	NA	NA
WP_024146873.1|3968500_3969496_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	99.7	5.3e-193
WP_021580386.1|3969562_3969862_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	100.0	1.2e-44
WP_001158283.1|3969970_3970396_+	regulatory protein	NA	A0A0A7NPS5	Enterobacteria_phage	100.0	9.1e-78
WP_023210417.1|3970433_3970784_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	95.7	1.1e-57
WP_023210418.1|3970794_3971073_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.1e-34
WP_000514277.1|3971084_3971327_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_023210419.1|3971323_3971437_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	4.3e-11
WP_023210420.1|3971529_3971940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985718.1|3971962_3972166_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	97.0	1.5e-30
WP_023210421.1|3972162_3972408_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	93.8	6.9e-38
WP_023210422.1|3972404_3972719_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.7	5.2e-38
WP_023210423.1|3972758_3973244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077910974.1|3973469_3974087_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	50.6	6.9e-10
WP_023210424.1|3974083_3974449_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_023210425.1|3974455_3977278_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.5	0.0e+00
WP_023210426.1|3977354_3978314_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	4.6e-178
WP_012907691.1|3978318_3978630_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.9e-48
WP_031609932.1|3978720_3979224_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_046593830.1|3979930_3980977_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_000613768.1|3980976_3982728_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|3982882_3983719_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|3983742_3984795_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632332.1|3984840_3985641_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063103.1|3985742_3986237_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000865513.1|3986236_3986437_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_000104350.1|3986439_3986763_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3986759_3987152_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780546.1|3987148_3987556_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	6.1e-63
WP_023210427.1|3987693_3988161_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356343.1|3988153_3988789_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271928.1|3988785_3989367_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.5e-102
WP_000213447.1|3989363_3989714_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_023210428.1|3989717_3990614_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	2.5e-154
WP_023210429.1|3990606_3991137_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	97.5	1.1e-91
WP_023210430.1|3991139_3993077_+|tail	bacteriophage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	82.4	1.0e-160
WP_023211037.1|3993083_3993491_+|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	83.5	3.4e-58
WP_023211704.1|3993698_3994421_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_023210925.1|3994634_3994883_+	Hin recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	97.6	3.5e-37
WP_023210436.1|3994918_3995407_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	4.0e-85
WP_023210435.1|3995419_3998227_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.0	0.0e+00
WP_000763327.1|3998213_3998342_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|3998377_3998743_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3998797_3999310_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005390.1|3999309_4000494_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
WP_023210434.1|4000651_4001761_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	6.3e-195
WP_000488106.1|4001803_4002064_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|4002254_4002395_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_024146876.1|4002546_4002828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219167.1|4003127_4003472_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060832.1|4003474_4007254_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001120232.1|4007250_4008984_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000051467.1|4009196_4009835_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000934974.1|4010024_4011368_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_138082281.1|4011336_4011609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|4011565_4012024_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
4018783:4018799	attR	GCGCTGTTTCGCCAGTA	NA	NA	NA	NA
