The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	929388	1041742	5129938	portal,head,terminase,plate,protease,transposase,tRNA,integrase,holin,tail,capsid	Enterobacteria_phage(41.84%)	132	1024787:1024802	1046661:1046676
WP_000520781.1|929388_929709_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|929739_932016_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|932700_932919_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|933203_933908_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|933949_935671_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001043561.1|935671_937438_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|937560_938526_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|939069_939564_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|939698_943805_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|943963_944575_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|944585_945929_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|946019_947312_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|947617_947758_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|947949_948210_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|948250_949360_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|949517_950702_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|950701_951214_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|951269_951644_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|951652_951808_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|951794_954602_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|954614_955103_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|955131_955731_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|955958_956744_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000972134.1|957311_957845_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|957847_959833_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|959835_960366_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|960358_961255_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|961258_961609_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|961605_962187_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|962183_962819_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|962811_963279_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_023363135.1|963302_965180_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.3	9.3e-300
WP_000780577.1|965318_965714_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|965710_966103_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|966099_966423_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|966425_966626_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|966625_967120_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|967221_968022_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|968066_969119_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|969142_969979_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|970133_971885_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|971884_972931_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|972945_973470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|974193_974691_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|974730_975573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|975656_975971_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|975975_976935_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|977011_979834_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|979840_980206_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|980202_980820_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|980831_981131_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|981127_981394_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|981390_981594_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|981617_982028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|982121_982235_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|982231_982474_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|982485_982764_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|982774_983125_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|983262_983454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|983460_983883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|983887_984409_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|984513_984855_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|984924_985917_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|986216_988661_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|988671_989289_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|989290_990154_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|990189_990816_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|991129_992278_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|992374_993115_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|993306_995589_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|995643_996501_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|996906_998667_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|998796_999489_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|999687_1000776_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1000846_1002130_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1002385_1002958_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|1003017_1003542_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1003541_1004156_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1004162_1004624_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|1004634_1005882_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|1005884_1006463_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1006455_1007559_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1007549_1007897_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1007951_1008548_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1008544_1009699_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|1009686_1009902_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1009898_1010783_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1010782_1013734_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1013809_1013968_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1013891_1014227_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1014324_1014606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|1014608_1015130_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|1015129_1016557_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|1016546_1016801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1016797_1017262_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1017261_1017708_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1017709_1018048_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1018057_1019011_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1019025_1020141_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1020355_1020814_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1020816_1021638_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1021618_1023115_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|1023114_1024647_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|1024706_1025252_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1024787:1024802	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1025251_1025563_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1025562_1025889_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1025885_1026536_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1026519_1027260_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1027262_1027613_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000080195.1|1027861_1029475_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1029505_1029856_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1029852_1030278_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000972294.1|1031000_1031405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1031403_1031619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1031809_1032574_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1032690_1033047_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1033140_1033329_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1033381_1033690_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1033700_1034621_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1034620_1034938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1034953_1036723_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1036733_1037900_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1037902_1038172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1038199_1038730_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1039018_1039291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1039300_1039597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1039611_1039827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1039823_1040507_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1040503_1040734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1040723_1040930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1040931_1041381_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1041352_1041742_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1046661:1046676	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	1253068	1298777	5129938	portal,head,terminase,tail,tRNA,integrase,holin,lysis,capsid	Enterobacteria_phage(56.0%)	58	1251386:1251400	1279980:1279994
1251386:1251400	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1253068_1254175_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1254228_1254690_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1254699_1255353_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1255524_1256775_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1256888_1258031_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1258020_1258257_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1258396_1258636_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1258619_1258946_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1258945_1259167_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1259265_1259547_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1259557_1259749_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1259721_1259904_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1259900_1260581_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1260577_1261363_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1261368_1261665_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1261740_1261947_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1262542_1263298_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1263336_1263567_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1263636_1264176_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|1264262_1265192_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|1265188_1265890_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1266139_1270405_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1270441_1271485_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1271834_1271936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1271932_1272388_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1272387_1272558_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1272550_1272841_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1272837_1273200_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1273196_1273337_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1273333_1274023_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1274344_1274650_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1274636_1275113_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1275329_1275512_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1275602_1275896_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1276376_1276703_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1276909_1277092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1277655_1278201_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1278175_1280101_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1279980:1279994	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1280097_1280304_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1280300_1281902_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1281882_1283202_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1283211_1283544_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1283599_1284625_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1284666_1285065_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1285076_1285430_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1285441_1286020_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1286016_1286412_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1286419_1287160_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1287175_1287598_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1287579_1288014_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1288006_1290568_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1290564_1290894_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1290893_1291592_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1291596_1292340_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1292276_1292879_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1292939_1296422_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1296480_1298502_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1298498_1298777_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 3
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	1436738	1509844	5129938	portal,head,terminase,protease,transposase,holin,integrase,capsid,tail	Enterobacteria_phage(22.81%)	80	1432912:1432926	1438822:1438836
1432912:1432926	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1436738_1437869_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1437846_1438095_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1438159_1440631_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1438822:1438836	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1440723_1440915_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1440911_1441100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1441665_1441884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1442043_1442199_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1442471_1443188_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1443237_1443453_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1443449_1443875_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1443897_1444860_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1444866_1445613_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1445634_1446405_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1446420_1446846_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1447020_1447686_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1447866_1448079_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1448246_1448519_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1448520_1449576_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1449576_1449957_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1449953_1450775_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1451001_1451199_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1451350_1452400_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1453201_1453333_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1453613_1453949_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1454209_1456063_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1456213_1456429_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1456433_1456778_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1456743_1457016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1457121_1457655_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1458209_1458296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1458517_1458703_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1458788_1459004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1459202_1459403_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1459444_1459810_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1460100_1460664_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1460660_1462322_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1462385_1464323_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1464367_1464589_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1464534_1467120_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1467116_1467443_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1467452_1467803_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1467799_1468246_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1468242_1468587_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1468653_1469370_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1469384_1469759_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_123011843.1|1469854_1470064_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	3.3e-33
WP_000608644.1|1472323_1473586_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|1473841_1474717_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|1474763_1475096_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000807937.1|1476592_1476934_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1476933_1477632_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_072048702.1|1477924_1478524_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.5	6.7e-119
WP_061089814.1|1478469_1479102_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1479444_1482918_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1483558_1485100_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1485114_1485861_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|1486329_1489155_+|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|1489156_1489690_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1489720_1490248_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|1490263_1491232_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|1491357_1491540_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1491738_1492407_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1492463_1492733_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|1493144_1493702_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1493698_1493974_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1494349_1495156_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1495155_1496349_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1496360_1497719_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_023149386.1|1497722_1499318_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1499317_1500880_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1500971_1501016_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1501153_1502035_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1502031_1502652_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1502679_1504575_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1504787_1505663_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|1505868_1506855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1506864_1507173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1507229_1507820_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1507816_1508575_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1508794_1509844_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2001013	2089259	5129938	portal,terminase,holin,plate,transposase,tRNA,integrase,capsid,tail	Escherichia_phage(22.73%)	103	2046710:2046769	2089321:2089445
WP_099156422.1|2001013_2002362_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|2002471_2003482_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2003490_2004102_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2004240_2004306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|2004376_2004979_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2004980_2005502_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2005536_2006277_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2006305_2006758_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2006750_2008523_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2008832_2009399_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2009395_2010214_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2010266_2010662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2010702_2011446_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2011442_2012414_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2012449_2014879_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2014903_2016004_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2016391_2017138_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2017151_2017718_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2017933_2019667_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2019719_2020112_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2020111_2022190_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2022182_2023331_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2023519_2024164_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2024174_2024564_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2024578_2025628_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2025630_2026491_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2026781_2028443_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2028587_2029091_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2029111_2031076_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2031080_2032007_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2032003_2032891_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2033017_2033596_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2033598_2033949_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2034728_2035157_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2035163_2036588_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2036562_2037363_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|2037529_2038519_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2038530_2040045_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2040114_2041104_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2041898_2042402_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2042479_2042731_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2042845_2042932_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2043195_2043519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2043690_2044188_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2044225_2044465_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2044655_2045867_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2045917_2046583_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2046710:2046769	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2047054_2047474_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2048688_2048913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|2049074_2049464_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2049499_2051140_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2051248_2051530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2051542_2052055_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|2052072_2053575_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2053571_2053961_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2053960_2055145_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2055137_2055764_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2055766_2056687_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2056683_2057025_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2057027_2057930_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2057910_2058447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2058443_2059124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2059155_2059536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2059532_2059952_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2059986_2061021_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2061079_2061409_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2061408_2062716_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2062715_2064290_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2064286_2064520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2064519_2066382_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2066368_2066935_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2067303_2067549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2067608_2067803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2067810_2068290_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2068289_2068562_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2068561_2068945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2069057_2069729_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2069728_2070022_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2070018_2070615_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2070692_2070872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2071023_2071665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2071908_2072142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2072540_2073029_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2073038_2073644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2074106_2074805_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2075992_2076916_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2077090_2077879_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2078560_2078785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2078781_2079093_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2079089_2079326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2079327_2079738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2079776_2081192_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2081181_2081937_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2081933_2082158_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2082197_2082674_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2082732_2082963_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2083061_2083475_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2084485_2084806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2084836_2087053_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2087049_2087619_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2087618_2087801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2088010_2088274_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2088242_2089259_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2089321:2089445	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2107503	2185636	5129938	portal,head,terminase,protease,transposase,holin,integrase,capsid,tail	Escherichia_phage(40.0%)	95	2142279:2142294	2208638:2208653
WP_001347174.1|2107503_2108028_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|2108184_2108982_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|2108991_2109543_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2109711_2110044_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2110387_2110702_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|2110916_2112575_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2112567_2113563_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|2113555_2114242_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|2114241_2115615_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2115633_2116077_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|2116073_2117201_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2117305_2117770_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2117774_2118779_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|2118775_2119189_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|2119191_2119557_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|2119556_2120294_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2120303_2120573_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|2120581_2121367_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|2121656_2122280_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2122323_2122566_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2122674_2122902_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|2123197_2124013_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|2124009_2125704_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2125874_2126057_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2126135_2127053_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2127225_2128146_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2128134_2128605_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|2128585_2130004_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|2130070_2130766_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|2130805_2131171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|2131736_2132852_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|2133444_2134296_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|2134403_2135762_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2135761_2136433_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2136565_2136979_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|2137087_2138092_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|2138092_2138728_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_102776447.1|2138811_2140160_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_001007778.1|2140420_2141071_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|2142154_2142442_-	hypothetical protein	NA	NA	NA	NA	NA
2142279:2142294	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|2142452_2143157_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|2143166_2143448_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|2143447_2145826_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|2145946_2146405_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|2146601_2147201_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|2147268_2150664_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|2150724_2151372_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|2151269_2152013_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|2152018_2152717_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|2152716_2153073_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|2153050_2156278_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_071590020.1|2156324_2156585_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|2156626_2157013_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|2157012_2157717_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|2157777_2158122_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|2158118_2158568_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|2158564_2158903_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2158911_2159229_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|2159305_2160523_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|2160537_2161137_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|2161129_2162356_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|2162503_2164261_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|2164260_2164743_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|2164890_2165241_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|2165766_2166060_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2166150_2166333_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|2166549_2167083_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|2167146_2167497_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|2167501_2167717_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2168024_2168213_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|2168472_2168808_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2169088_2169220_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|2170115_2170937_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|2170951_2171314_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|2171314_2172373_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|2172374_2172647_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2172814_2172970_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|2173228_2173447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224667.1|2174060_2174243_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000761442.1|2174336_2174750_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.6e-58
WP_001151210.1|2174750_2175173_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|2175213_2176176_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|2176198_2176624_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|2176607_2176889_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2176989_2177409_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2177674_2177830_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|2177989_2178208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|2178211_2178376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2178775_2178964_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|2178960_2179152_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|2179244_2181716_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|2181774_2181978_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2181977_2183003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|2183238_2184036_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|2184373_2185636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2208638:2208653	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 6
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2252525	2286286	5129938	transposase	Escherichia_phage(16.67%)	37	NA	NA
WP_001296203.1|2252525_2253722_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|2253845_2254124_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|2254217_2254820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|2255845_2256538_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|2256537_2257560_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|2257705_2257885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001296206.1|2259084_2260230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|2260760_2261018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|2261071_2261839_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|2261835_2262894_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|2262912_2263902_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|2263912_2266078_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|2266506_2266941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|2267158_2269543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|2269539_2270445_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|2270441_2271512_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|2271647_2272061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|2272175_2273717_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2273731_2274478_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2274926_2275337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2275557_2276376_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001542276.1|2276717_2277191_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2277206_2277683_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2277745_2277967_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2277985_2278630_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|2278645_2279014_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|2279102_2279477_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2279473_2279668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2279680_2279794_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032082634.1|2280082_2280256_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.2	1.1e-10
WP_001296208.1|2280282_2280465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2280565_2280895_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|2281066_2282125_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|2282322_2282796_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|2282914_2284081_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|2284289_2285717_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_023363206.1|2285827_2286286_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	3.2e-12
>prophage 7
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2309433	2315736	5129938		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2309433_2309976_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2309980_2310859_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2310916_2311816_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2311815_2312901_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2313273_2314167_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2314341_2315736_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2409912	2419357	5129938		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2409912_2411049_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2411045_2413049_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2413173_2413635_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2413675_2414146_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2414192_2414912_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2414908_2416594_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2416815_2417547_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2417606_2417714_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2417694_2418426_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2418430_2419357_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 9
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2657135	2669500	5129938	transposase,integrase	Enterobacteria_phage(44.44%)	13	2656957:2656976	2671085:2671104
2656957:2656976	attL	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_000926944.1|2657135_2658311_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|2658290_2659241_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|2659262_2660144_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000080195.1|2660697_2662311_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2662341_2662692_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2662688_2663114_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000239754.1|2663451_2663688_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000783295.1|2663942_2664215_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_000856856.1|2664497_2667185_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
WP_001063904.1|2667181_2667592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839713.1|2667584_2667821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111085.1|2667817_2668408_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
WP_000270796.1|2668495_2669500_-	oxidoreductase	NA	F1BUM2	Cronobacter_phage	48.3	1.1e-81
2671085:2671104	attR	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
>prophage 10
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	2886860	2976065	5129938	portal,lysis,terminase,protease,tRNA,tail	Enterobacteria_phage(52.54%)	95	NA	NA
WP_000083664.1|2886860_2887598_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2887729_2889064_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|2889096_2889978_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2890080_2890668_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2890723_2891107_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2891411_2892101_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997384.1|2892148_2893186_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2893392_2893812_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001296305.1|2893880_2894579_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082935.1|2894610_2897271_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001312028.1|2897384_2898740_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001467872.1|2898785_2899109_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852119.1|2899105_2900404_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001235102.1|2906190_2908764_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040156.1|2908893_2909625_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079111.1|2909621_2910602_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2910736_2911474_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2911743_2912085_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2912188_2912236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200140.1|2912334_2913495_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225212.1|2913537_2914659_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2914669_2915740_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2915949_2916315_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2916461_2916980_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969008.1|2916969_2918196_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589791.1|2918211_2918694_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2918770_2919118_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264790.1|2919159_2919927_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2919957_2920506_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2920524_2920773_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2920909_2922271_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189256.1|2922362_2923229_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2923249_2924536_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2924589_2925183_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2925305_2926184_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880939.1|2926269_2927931_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2928079_2928421_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2928482_2928773_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2928762_2929239_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2929370_2929853_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000429347.1|2930730_2931000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000461705.1|2931137_2931500_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_024190590.1|2931492_2932563_-	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_001597763.1|2932622_2932778_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	92.6	2.2e-05
WP_023363231.1|2932963_2933548_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	5.0e-103
WP_023363234.1|2933547_2936574_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.1e-67
WP_023363237.1|2936638_2937238_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.7e-109
WP_023363240.1|2937304_2940703_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.4	0.0e+00
WP_125271823.1|2940763_2941372_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	4.8e-104
WP_023363246.1|2941308_2942052_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_023363250.1|2942056_2942755_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	6.8e-131
WP_000447253.1|2942764_2943094_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_023363253.1|2943093_2946159_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_032164532.1|2946130_2946460_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.9e-55
WP_001300035.1|2946468_2946855_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211106.1|2946915_2947659_-|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_023363259.1|2947669_2948071_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	5.4e-72
WP_000677106.1|2948067_2948646_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_023363262.1|2948657_2948933_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	5.0e-45
WP_001097045.1|2948925_2949249_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_023363265.1|2949336_2951364_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_023363268.1|2951308_2952817_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	1.9e-287
WP_001072975.1|2952816_2953029_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023363271.1|2953025_2955128_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_023363274.1|2955127_2955622_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	4.9e-83
WP_001139681.1|2956297_2956450_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001300226.1|2956437_2956905_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_000992100.1|2956901_2957435_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193288.1|2957498_2957849_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000839596.1|2957853_2958069_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|2958136_2959189_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|2959339_2959543_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|2959766_2960192_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001547994.1|2960472_2961225_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_001439745.1|2961238_2962228_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_015967850.1|2962235_2963045_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
WP_000767124.1|2963064_2963454_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_023363277.1|2963450_2963777_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	3.5e-53
WP_000066917.1|2963773_2964427_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_023363280.1|2964426_2964915_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.0e-84
WP_000061525.1|2964917_2965736_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	1.2e-121
WP_000620696.1|2965732_2965957_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087357.1|2965953_2967105_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	97.4	1.1e-210
WP_000515841.1|2967101_2967653_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	4.9e-100
WP_023363283.1|2967645_2967906_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	6.0e-40
WP_001311077.1|2968003_2968696_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|2969418_2969781_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023277820.1|2969846_2970671_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_023363286.1|2970799_2971336_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_001596853.1|2971326_2971689_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_001331173.1|2971685_2971901_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|2971960_2972167_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001596854.1|2972127_2973294_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001596855.1|2973352_2975086_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023363292.1|2975165_2976065_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
>prophage 11
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	3044776	3051916	5129938		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3044776_3047338_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3047443_3048100_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|3048150_3048948_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|3049113_3050022_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3050018_3051281_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3051277_3051916_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 12
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	3303724	3365814	5129938	tRNA,transposase,integrase,protease	Staphylococcus_phage(33.33%)	53	3304933:3304950	3365211:3365228
WP_001296354.1|3303724_3304483_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3304912_3305833_-	agmatinase	NA	NA	NA	NA	NA
3304933:3304950	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3305968_3306700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3306845_3308822_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3308830_3308962_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3309097_3309313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3309616_3310771_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3311206_3312601_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3312677_3313175_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3313269_3313977_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3314056_3314788_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3314800_3315751_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3315787_3316423_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3316422_3316839_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3316953_3317934_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3317951_3318656_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3318673_3319240_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3319236_3319527_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3319534_3320128_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3320120_3321257_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3321571_3322558_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3322602_3323106_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3323105_3324407_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3324462_3325470_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3325586_3326633_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3326808_3327528_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3327548_3327689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3327711_3328038_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3328037_3328757_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3328917_3329970_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3329997_3330273_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3330337_3331417_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3331618_3332875_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3332923_3335059_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3335451_3336159_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3336537_3337803_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3338058_3339102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3340795_3341347_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|3343838_3344072_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|3344538_3344754_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|3344722_3345849_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|3345939_3346053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|3347886_3348147_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3348188_3348749_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3348788_3349217_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3349934_3351128_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3351263_3352988_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3352988_3353936_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3353935_3355678_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3355674_3356952_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3357033_3359235_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|3360178_3364066_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3364662_3365814_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3365211:3365228	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 13
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	4906087	4963463	5129938	transposase	Stx2-converting_phage(37.5%)	57	NA	NA
WP_000080195.1|4906087_4907701_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000107487.1|4907971_4908985_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998348.1|4908996_4910313_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4910340_4911261_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4911566_4912349_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|4912350_4912449_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_000527665.1|4913574_4913682_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|4913862_4914519_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296707.1|4914766_4916044_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001545177.1|4916106_4918104_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_000336726.1|4918258_4919077_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|4919112_4919415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|4920348_4920606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4921162_4921930_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4921930_4922887_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|4922883_4923882_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4923878_4924781_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|4924825_4927150_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068908.1|4927236_4928190_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4928186_4928708_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000823243.1|4930269_4931628_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4931866_4933252_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4933301_4933649_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4933645_4934026_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|4934380_4934815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270962.1|4934802_4935204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|4935463_4936033_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001547002.1|4936232_4936430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526287.1|4936762_4936912_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000211308.1|4937685_4937892_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000813435.1|4937987_4938590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250227.1|4939790_4940708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553935.1|4940792_4941665_+	GTPase family protein	NA	NA	NA	NA	NA
WP_021526504.1|4942037_4944884_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|4944954_4945113_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234738.1|4945267_4946086_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001350782.1|4946427_4946901_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|4946916_4947393_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4947455_4947677_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|4947839_4948208_+	antitoxin	NA	NA	NA	NA	NA
WP_000854759.1|4948297_4948675_+	toxin	NA	NA	NA	NA	NA
WP_000761690.1|4948671_4949160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|4949176_4949353_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_144079987.1|4949458_4949656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|4949670_4950096_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4950092_4950443_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4950473_4952087_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000107487.1|4952357_4953371_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998348.1|4953382_4954699_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4954726_4955647_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4955952_4956735_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|4956736_4956835_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_000527665.1|4957960_4958068_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|4958248_4958905_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296707.1|4959152_4960430_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001545177.1|4960492_4962490_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_000336726.1|4962644_4963463_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
>prophage 14
NC_022648	Escherichia coli JJ1886, complete sequence	5129938	4989653	4996473	5129938	transposase	Stx2-converting_phage(33.33%)	12	NA	NA
WP_001234738.1|4989653_4990472_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001350782.1|4990813_4991287_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|4991302_4991779_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4991841_4992063_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|4992225_4992594_+	antitoxin	NA	NA	NA	NA	NA
WP_000854759.1|4992683_4993061_+	toxin	NA	NA	NA	NA	NA
WP_000761690.1|4993057_4993546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|4993562_4993739_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_144079987.1|4993844_4994042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|4994056_4994482_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4994478_4994829_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4994859_4996473_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 1
NC_022651	Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence	110040	30	48598	110040	transposase,integrase,protease	Macacine_betaherpesvirus(19.05%)	50	5086:5100	30618:30632
WP_000080195.1|30_1644_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1674_2025_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2021_2447_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_031325939.1|2508_3660_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000151784.1|3693_4206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|4751_4970_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|4971_5277_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
5086:5100	attL	GCACGTCTGCTGTCA	NA	NA	NA	NA
WP_000016982.1|5277_6084_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|6857_7613_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|8200_9367_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|9366_10338_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_106426161.1|11135_12077_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|12490_13174_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|13174_13396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|13409_13844_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|15210_15513_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|15559_15982_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|15978_16170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|17198_17429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170728.1|17480_18842_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_012783964.1|18888_19452_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_032140903.1|19896_20088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290793.1|20315_20843_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
WP_000006004.1|20898_21132_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145469.1|21190_23149_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	4.7e-20
WP_000845901.1|23203_23638_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|23634_24354_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|24365_24554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|24633_24792_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001067855.1|25142_25847_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000616807.1|27893_28547_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|28639_28897_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|28829_29231_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|31249_31954_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
30618:30632	attR	GCACGTCTGCTGTCA	NA	NA	NA	NA
WP_001334766.1|32585_33416_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|33546_34101_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|34244_34949_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|35218_35776_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|35958_36819_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000130647.1|37844_38702_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|38694_38769_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|38993_39254_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766805.1|39493_40084_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001298565.1|40121_40331_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233838.1|40376_40838_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|41082_41295_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139321.1|41423_41984_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|42086_42947_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000205725.1|43005_43752_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_001067855.1|47893_48598_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
