The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	626420	741789	4365796	capsid,integrase,portal,terminase,bacteriocin,head,transposase	Acidithiobacillus_phage(23.08%)	109	638350:638366	686921:686937
WP_024078834.1|626420_626699_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	1.0e-13
WP_024078835.1|626914_627781_-	RNA polymerase sigma factor RpoH	NA	I1ZBD5	Salisaeta_icosahedral_phage	24.9	2.5e-05
WP_024078836.1|627918_628902_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	8.7e-07
WP_024078837.1|628950_629271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078838.1|629267_629738_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_024078840.1|630620_631826_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.0	1.4e-91
WP_024078844.1|633424_634666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078846.1|635354_635801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084027885.1|635937_637446_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_041633417.1|637854_638037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041633418.1|638205_639939_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	2.3e-26
638350:638366	attL	CAGGCGATGGGCGATGA	NA	NA	NA	NA
WP_158497719.1|640013_640733_-	metallophosphoesterase	NA	V9QL63	Rhizobium_phage	35.5	9.8e-24
WP_024078851.1|640922_641489_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_162472130.1|642419_642569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084028217.1|643199_643868_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_158497720.1|644180_645584_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_144084363.1|645533_646424_-	sugar transferase	NA	NA	NA	NA	NA
WP_024078856.1|646848_648048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078857.1|648078_648792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144084267.1|648875_649598_-	methyltransferase	NA	NA	NA	NA	NA
WP_024078859.1|649896_650565_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_084027889.1|650707_652150_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_158497721.1|652170_654399_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_024078862.1|654382_655039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078863.1|655032_656403_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_052588846.1|656399_657506_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	27.4	1.6e-25
WP_052588847.1|657681_659484_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	23.4	8.8e-05
WP_024078866.1|659474_660704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078867.1|660688_661957_+	membrane protein of unknown function	NA	NA	NA	NA	NA
WP_024078868.1|661953_664212_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_024078869.1|664359_664524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078870.1|664520_666437_+	asparagine synthetase B	NA	G8DDK6	Micromonas_pusilla_virus	27.0	1.7e-06
WP_024078871.1|666611_666911_+	PqqD family protein	NA	NA	NA	NA	NA
WP_024078872.1|666913_667834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078873.1|667830_668667_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024078875.1|668954_669389_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_024078876.1|669385_669988_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_106001305.1|671137_671900_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	2.2e-21
WP_158497722.1|672148_672871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497723.1|672792_673107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497724.1|673147_673315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078884.1|673392_673602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084027890.1|673865_674120_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_024078886.1|674475_674982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078887.1|675027_675570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078888.1|675808_676066_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024078889.1|676264_676507_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144084268.1|676686_678174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078891.1|678182_678488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078892.1|678860_680114_-|integrase	site-specific integrase	integrase	Q6EVM3	Oenoccocus_phage	25.9	3.1e-09
WP_024078893.1|680767_681679_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.1	4.4e-29
WP_024078894.1|681683_682874_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_024078895.1|683303_683846_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024078896.1|683856_686796_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	27.1	1.3e-24
WP_024078897.1|686800_689026_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.0	2.8e-29
686921:686937	attR	CAGGCGATGGGCGATGA	NA	NA	NA	NA
WP_024078898.1|689022_690222_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_024078899.1|690479_691097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078900.1|691523_692900_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_024078901.1|692989_693367_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	40.9	1.5e-15
WP_024078902.1|693363_694683_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	49.8	1.3e-119
WP_041633995.1|694679_695120_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	47.4	1.7e-23
WP_024078905.1|695466_695742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078906.1|695894_697388_+	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	25.0	2.5e-05
WP_024078907.1|697387_698278_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_024078908.1|698274_699177_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024078909.1|699381_699981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078910.1|699983_700421_-	hypothetical protein	NA	A0A2I7RXE2	Vibrio_phage	46.9	4.7e-29
WP_024078911.1|700484_702809_-	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	39.0	1.9e-121
WP_024078912.1|702805_703201_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	44.0	1.4e-24
WP_024078913.1|703271_703796_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_024078914.1|703788_704136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078915.1|704148_705483_-	radical SAM protein	NA	A0A0B5A4P9	Achromobacter_phage	36.7	9.2e-68
WP_024078916.1|705482_706274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078917.1|706284_707157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041633428.1|707167_707647_-	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	43.6	2.0e-17
WP_024078919.1|707671_710671_-	tape measure protein	NA	A0A0A8WJT6	Clostridium_phage	31.6	1.1e-07
WP_024078920.1|710674_710860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078921.1|710886_711402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078922.1|711404_712364_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	44.5	5.8e-64
WP_024078923.1|712382_712811_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	47.5	1.3e-28
WP_024078924.1|712861_713119_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_024078925.1|713115_713388_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_024078926.1|713394_714033_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	46.2	2.7e-41
WP_024078927.1|714029_714326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078928.1|714325_715348_-|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	57.5	3.5e-107
WP_024078929.1|715361_715751_-|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	59.7	2.9e-30
WP_024078930.1|715763_716990_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	50.5	8.7e-97
WP_024078931.1|717065_717326_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_024078932.1|717325_717730_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024078933.1|717710_719144_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	74.3	7.8e-198
WP_024078934.1|719146_719359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024078935.1|719364_721326_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	59.0	2.0e-212
WP_024078936.1|721291_721837_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	47.8	3.2e-35
WP_024078937.1|721935_722292_+	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	60.0	1.8e-31
WP_024078939.1|722905_723103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078941.1|723337_723547_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	56.5	2.3e-13
WP_024078942.1|723639_723804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024078943.1|723805_724015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041633429.1|724001_725270_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	52.1	3.6e-122
WP_024078945.1|725266_726787_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.5	5.5e-93
WP_158497725.1|727495_728290_+	putative Ig domain-containing protein	NA	NA	NA	NA	NA
WP_084027894.1|728301_729939_+	TolC family protein	NA	NA	NA	NA	NA
WP_158497726.1|730392_733350_+	DUF4347 domain-containing protein	NA	A0A1V0SEH2	Indivirus	32.2	4.5e-30
WP_144084269.1|733443_735099_+	TolC family protein	NA	NA	NA	NA	NA
WP_024078953.1|735095_735812_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024078956.1|737174_739274_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_024078957.1|739289_739619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084027896.1|739894_740341_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_144084247.1|740827_741789_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
>prophage 2
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	906752	914515	4365796		Acinetobacter_phage(50.0%)	7	NA	NA
WP_024079117.1|906752_907463_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	36.5	1.3e-07
WP_024079118.1|907577_908054_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_024079119.1|908056_908860_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	6.0e-62
WP_024079120.1|908861_909905_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.4	5.4e-63
WP_024079121.1|909904_910495_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	8.0e-56
WP_024079122.1|910574_911960_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.4	7.0e-10
WP_041633444.1|912127_914515_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	3.5e-110
>prophage 3
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	1088631	1098740	4365796	protease,tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_041634096.1|1088631_1089636_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	36.7	1.4e-20
WP_024079288.1|1089632_1090316_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_024079289.1|1090317_1091112_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.4	3.3e-36
WP_024079290.1|1091108_1091771_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	48.8	5.1e-43
WP_024079291.1|1091850_1092087_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	58.1	5.1e-06
WP_024079292.1|1092127_1092487_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_052589088.1|1092510_1093311_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	48.5	5.0e-53
WP_024079294.1|1093336_1094599_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.9	7.3e-107
WP_024079295.1|1094604_1095387_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	39.8	3.7e-40
WP_024079296.1|1095394_1096039_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.8	2.2e-30
WP_041633458.1|1096077_1097112_+	LysM peptidoglycan-binding domain-containing M23 family metallopeptidase	NA	A0A2D0WXW0	Clostridium_phage	37.5	4.6e-14
WP_024079298.1|1097344_1098199_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024079299.1|1098362_1098740_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	50.0	1.7e-14
>prophage 4
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	1500018	1551960	4365796	protease,transposase	uncultured_Mediterranean_phage(16.67%)	54	NA	NA
WP_024079702.1|1500018_1501173_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_024079703.1|1501169_1502036_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_024079704.1|1502032_1502233_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_052588889.1|1502301_1503768_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	4.9e-22
WP_024079706.1|1504014_1505928_-	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	3.0e-59
WP_084027972.1|1506217_1506394_-	YdcH family protein	NA	NA	NA	NA	NA
WP_041634194.1|1506528_1507098_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_024079709.1|1507257_1508352_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_024079710.1|1508450_1508657_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_024079711.1|1508694_1509873_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_024079712.1|1509881_1510613_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_041633513.1|1510732_1511248_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_041633514.1|1511252_1512332_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024079715.1|1512434_1512869_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024079716.1|1512976_1513708_+	DedA family protein	NA	NA	NA	NA	NA
WP_052588890.1|1513708_1514524_-	murein transglycosylase	NA	NA	NA	NA	NA
WP_024079718.1|1515093_1515723_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_144084247.1|1515910_1516871_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
WP_024079719.1|1516879_1517095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024079720.1|1517331_1518312_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024079721.1|1518386_1519646_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024079722.1|1519721_1519955_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_024079723.1|1520115_1520853_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_024079724.1|1520875_1521817_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024079725.1|1521989_1522415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024079726.1|1522566_1523001_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_024079727.1|1523000_1523273_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_024079728.1|1523289_1524228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024079729.1|1524229_1524796_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_024079730.1|1524950_1526162_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	35.7	7.1e-43
WP_024079731.1|1526227_1527388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024079732.1|1527415_1528909_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	41.1	2.1e-84
WP_041633516.1|1528908_1530018_+	alanine racemase	NA	NA	NA	NA	NA
WP_024079734.1|1530017_1530791_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041633517.1|1530793_1531567_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_041634199.1|1531663_1532404_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024079737.1|1532406_1534314_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_024079738.1|1534347_1535721_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_024079739.1|1535743_1536427_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024079740.1|1536447_1537908_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.2	1.0e-51
WP_024079741.1|1537904_1538621_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024079743.1|1538807_1540082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041634200.1|1540154_1541345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024079745.1|1541498_1542296_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024079746.1|1542292_1543258_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_024079747.1|1543254_1544034_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024079748.1|1544125_1544815_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	32.5	4.5e-10
WP_024079749.1|1544946_1545363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024079750.1|1545551_1546139_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.9	1.5e-22
WP_024079751.1|1546135_1547023_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_024079059.1|1547372_1548980_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	1.2e-106
WP_024078582.1|1549037_1549385_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.7	1.5e-30
WP_024079338.1|1549381_1549747_-	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	50.0	6.8e-05
WP_024079752.1|1550229_1551960_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.5	2.2e-08
>prophage 5
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2054513	2066466	4365796	integrase	uncultured_Mediterranean_phage(28.57%)	8	2053233:2053252	2063339:2063358
2053233:2053252	attL	CTAATTTGGTTGCGGGGGCA	NA	NA	NA	NA
WP_041633558.1|2054513_2057132_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.5	1.2e-47
WP_024080188.1|2057137_2057968_+	Zinc finger, SWIM-type	NA	NA	NA	NA	NA
WP_024080189.1|2058633_2059788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	34.2	3.7e-49
WP_024080190.1|2059926_2060178_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	59.0	3.1e-17
WP_041633559.1|2060170_2061265_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	54.9	1.6e-105
WP_084028022.1|2061278_2061677_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	36.4	2.0e-10
WP_084028024.1|2061673_2063230_+	DUF4143 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.7	1.0e-57
WP_084028026.1|2063553_2066466_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	38.0	5.0e-26
2063339:2063358	attR	CTAATTTGGTTGCGGGGGCA	NA	NA	NA	NA
>prophage 6
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2451163	2519031	4365796	transposase	Stx2-converting_phage(37.5%)	60	NA	NA
WP_024079059.1|2451163_2452771_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	1.2e-106
WP_024080536.1|2452987_2453953_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_024080537.1|2453959_2454865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080538.1|2454893_2455874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041634407.1|2457499_2458264_+	magnetochrome domain-containing protein	NA	NA	NA	NA	NA
WP_041633585.1|2458247_2460179_+	MFS transporter	NA	NA	NA	NA	NA
WP_024080542.1|2460220_2461156_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_144084247.1|2461478_2462440_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
WP_024079338.1|2462643_2463009_+	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	50.0	6.8e-05
WP_024078582.1|2463005_2463353_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.7	1.5e-30
WP_024079059.1|2463410_2465018_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	1.2e-106
WP_041633586.1|2466157_2466406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080554.1|2470889_2471264_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_024080555.1|2471506_2472703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080556.1|2472861_2473095_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_052588954.1|2473261_2474224_+	cation transporter	NA	NA	NA	NA	NA
WP_024080558.1|2474253_2474607_+	CZB domain-containing protein	NA	NA	NA	NA	NA
WP_024080559.1|2474620_2474926_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_024080560.1|2474922_2475882_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_144084247.1|2476934_2477896_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
WP_024080564.1|2478164_2478389_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041633587.1|2478385_2478808_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_024080566.1|2478829_2479006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080569.1|2480746_2481361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080570.1|2481363_2481993_-	ParA family protein	NA	NA	NA	NA	NA
WP_052588956.1|2482148_2482463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080575.1|2485303_2486527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041633589.1|2486857_2487751_-	sphingosine kinase	NA	NA	NA	NA	NA
WP_084028067.1|2487792_2488287_-	magnetochrome domain-containing protein	NA	NA	NA	NA	NA
WP_024080578.1|2488342_2488885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080579.1|2488901_2489795_-	magnetosome biogenesis CDF transporter MamB	NA	NA	NA	NA	NA
WP_024080580.1|2489791_2490046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024080581.1|2490042_2490861_-	LemA family protein	NA	NA	NA	NA	NA
WP_041633591.1|2490911_2491577_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024080583.1|2491599_2492412_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024080584.1|2492439_2494338_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_024080585.1|2494378_2495692_-	ArsB/NhaD family transporter	NA	NA	NA	NA	NA
WP_024080586.1|2495692_2496649_-	magnetosome biogenesis CDF transporter MamM	NA	NA	NA	NA	NA
WP_024080587.1|2496697_2496934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080588.1|2496986_2498030_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_024080589.1|2498073_2499474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080590.1|2499489_2501808_-	magnetochrome domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	3.5e-14
WP_024080591.1|2501807_2502017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080592.1|2502054_2503350_-	MFS transporter	NA	NA	NA	NA	NA
WP_024080593.1|2503529_2504777_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_024080598.1|2506463_2506913_+	hemerythrin family protein	NA	NA	NA	NA	NA
WP_024080599.1|2506961_2508539_+	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_158497757.1|2508542_2508680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169733387.1|2509530_2509821_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_169733388.1|2509754_2510012_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_041633593.1|2510121_2510370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144084247.1|2510377_2511339_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
WP_084028071.1|2511439_2512300_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_024080602.1|2512595_2512973_-	magnetosome protein MamC	NA	NA	NA	NA	NA
WP_024080604.1|2514067_2514403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080605.1|2515327_2515807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080606.1|2515822_2516146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080607.1|2516321_2517365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080608.1|2517368_2518718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158497758.1|2518830_2519031_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2524460	2542842	4365796	protease,integrase,transposase	Morganella_phage(40.0%)	21	2525036:2525051	2548026:2548041
WP_024080617.1|2524460_2525768_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2525036:2525051	attL	CGCCGCCCTGGCCGAG	NA	NA	NA	NA
WP_106001317.1|2525973_2526727_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.6	3.8e-26
WP_052588958.1|2527459_2527753_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_024080622.1|2527992_2528883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080624.1|2528923_2529694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080625.1|2529747_2531007_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_011899488.1|2531496_2532696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899489.1|2532806_2533097_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_011899490.1|2533329_2533644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080627.1|2533743_2534052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899492.1|2534048_2534600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080628.1|2534602_2534968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080629.1|2535160_2535709_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011899495.1|2535799_2536096_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_011899496.1|2536092_2536503_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_024080630.1|2536606_2536864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899498.1|2536931_2538506_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	30.2	1.4e-51
WP_024080155.1|2538820_2539291_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	42.1	1.9e-23
WP_011899500.1|2539297_2540575_+	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	42.9	2.2e-82
WP_011899501.1|2540738_2541647_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	5.8e-29
WP_024080631.1|2541651_2542842_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2548026:2548041	attR	CTCGGCCAGGGCGGCG	NA	NA	NA	NA
>prophage 8
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2620498	2658170	4365796	capsid,protease,terminase,portal,tail,head,tRNA	Acidithiobacillus_phage(35.71%)	37	NA	NA
WP_024080688.1|2620498_2620954_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_024080689.1|2620935_2621427_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024080690.1|2621559_2622543_+	cytochrome C peroxidase (cpp-like)	NA	NA	NA	NA	NA
WP_024080691.1|2622539_2624750_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_041634455.1|2624746_2625043_-	N(2)-fixation sustaining protein CowN	NA	NA	NA	NA	NA
WP_041634456.1|2625169_2625865_-	PAS domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_024080694.1|2625978_2626266_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024080695.1|2626265_2627738_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_024080696.1|2627737_2629189_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_144084381.1|2629679_2630033_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_024080699.1|2630096_2630741_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_024080700.1|2630740_2631742_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_024080701.1|2631791_2633450_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_024080702.1|2633819_2634437_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024080704.1|2634925_2635315_-	response regulator	NA	NA	NA	NA	NA
WP_041633605.1|2635304_2636363_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.9	6.7e-05
WP_052588967.1|2636355_2638500_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	9.4e-30
WP_024080708.1|2638688_2639846_+	GGDEF domain-containing protein	NA	A0A2D0WBV8	Bordetella_phage	37.9	1.9e-08
WP_158497759.1|2640209_2640995_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.2	1.8e-26
WP_084028281.1|2641133_2642939_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.4	1.7e-16
WP_024080711.1|2644284_2644452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008615258.1|2644577_2644823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008617245.1|2644917_2645322_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	43.3	3.2e-16
WP_041633606.1|2645352_2647281_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	59.8	2.9e-211
WP_024080713.1|2647283_2647493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080714.1|2647495_2648926_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	69.8	1.3e-189
WP_024080715.1|2648934_2650167_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	53.4	1.4e-99
WP_024080716.1|2650179_2650569_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	58.1	2.1e-28
WP_024080717.1|2650583_2651606_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	56.9	3.8e-106
WP_024080718.1|2651608_2651905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080719.1|2651910_2652639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080720.1|2652738_2653374_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	44.0	1.2e-36
WP_024080721.1|2653366_2653801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080722.1|2653823_2654783_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	41.3	1.1e-57
WP_041633608.1|2654794_2655319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080724.1|2655357_2655510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080725.1|2655608_2658170_+|tail	phage tail protein	tail	A0A2I7RV30	Vibrio_phage	36.5	1.2e-26
>prophage 9
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2697146	2757022	4365796	capsid,terminase,portal,head,transposase	Acidithiobacillus_phage(41.67%)	52	NA	NA
WP_024080762.1|2697146_2697551_-	hypothetical protein	NA	Q9JML1	Wolbachia_phage	41.4	9.4e-16
WP_158497764.1|2698770_2698944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144084306.1|2698978_2699287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080766.1|2699319_2699601_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	41.6	3.0e-13
WP_024080767.1|2699604_2699904_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	50.0	3.6e-20
WP_024080768.1|2699960_2701265_+	AAA family ATPase	NA	A0A0F6SJ43	Sinorhizobium_phage	38.3	4.1e-68
WP_024080769.1|2701261_2703769_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	37.4	1.1e-74
WP_024080772.1|2704263_2704731_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.5	3.0e-50
WP_024080773.1|2704727_2704919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080774.1|2704911_2705400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052588972.1|2706565_2707837_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	62.2	2.8e-146
WP_024080778.1|2707823_2708039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080779.1|2708041_2708206_-	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	56.5	2.7e-06
WP_041633614.1|2708298_2708508_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	63.8	6.3e-16
WP_024080781.1|2708568_2708832_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_144084307.1|2708840_2709032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080782.1|2709007_2709586_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	38.2	2.5e-14
WP_024080783.1|2709680_2709860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024080784.1|2709902_2710268_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	50.4	8.5e-24
WP_024080785.1|2710365_2710917_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	46.1	6.8e-33
WP_041633615.1|2710897_2712865_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	58.8	6.5e-211
WP_024080787.1|2712867_2713077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080788.1|2713079_2714510_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	70.4	2.7e-190
WP_024080789.1|2714518_2715751_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	52.4	2.7e-98
WP_024080790.1|2715762_2716152_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	58.9	1.4e-29
WP_024080791.1|2716166_2717189_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	56.9	1.1e-105
WP_024080792.1|2717191_2717488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080793.1|2717484_2718117_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	46.7	7.8e-41
WP_158497766.1|2718335_2721152_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041634478.1|2721575_2722013_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	46.2	1.4e-28
WP_024080798.1|2722015_2722615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084028088.1|2722935_2724003_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024080800.1|2724336_2725068_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024080801.1|2725064_2725334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080803.1|2727096_2727858_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_052588974.1|2727880_2733502_+	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_024080806.1|2738213_2739524_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024080807.1|2739526_2741632_+	Peptidase, M50 family protein	NA	NA	NA	NA	NA
WP_041633618.1|2741667_2741982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080809.1|2742543_2742981_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_024080811.1|2743355_2744849_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	6.4e-17
WP_024080813.1|2745173_2745635_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024080815.1|2745931_2746333_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	43.3	3.2e-16
WP_041634487.1|2749391_2750303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024080821.1|2750417_2750594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041633621.1|2752038_2752353_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041633622.1|2752503_2752743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497768.1|2753188_2753329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052588975.1|2753458_2753797_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024079338.1|2754647_2755013_+	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	50.0	6.8e-05
WP_024078582.1|2755009_2755357_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.7	1.5e-30
WP_024079059.1|2755414_2757022_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	1.2e-106
>prophage 10
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	2982956	2993966	4365796	tRNA	Prochlorococcus_phage(12.5%)	12	NA	NA
WP_024081047.1|2982956_2983865_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.7	4.7e-07
WP_024081048.1|2983867_2984380_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	47.9	8.8e-27
WP_024081049.1|2984466_2986149_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_024081050.1|2986237_2986669_-	DsrE family protein	NA	NA	NA	NA	NA
WP_024081051.1|2986655_2987456_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	37.7	1.8e-10
WP_024081052.1|2987563_2988505_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	54.5	1.1e-80
WP_024081053.1|2988558_2989014_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024081054.1|2989025_2989478_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	54.4	4.4e-30
WP_041634555.1|2989474_2990680_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	8.7e-41
WP_024081056.1|2990751_2992284_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	27.5	2.3e-30
WP_024081057.1|2992283_2993045_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_024081058.1|2993129_2993966_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	31.6	3.9e-24
>prophage 11
NC_023065	Magnetospirillum gryphiswaldense MSR-1 v2, complete genome	4365796	3150894	3160806	4365796	transposase	Acidithiobacillus_phage(60.0%)	14	NA	NA
WP_144084247.1|3150894_3151856_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.7e-10
WP_169733391.1|3152444_3152891_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	50.0	2.0e-11
WP_024081221.1|3152957_3153167_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	59.4	5.0e-13
WP_024081222.1|3153259_3153466_+	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	63.6	7.6e-06
WP_041634605.1|3153468_3153684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024081224.1|3153775_3154048_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_024081225.1|3154053_3154377_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144084317.1|3154383_3154848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052589001.1|3154940_3156236_-	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	59.1	1.0e-140
WP_041634608.1|3156180_3157563_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	57.3	6.9e-151
WP_084028118.1|3157791_3158367_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.3e-10
WP_024081231.1|3158618_3159068_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	39.9	1.9e-17
WP_024081232.1|3159064_3160408_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	51.1	8.9e-119
WP_024081233.1|3160404_3160806_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	41.7	4.2e-16
