The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007039	Pseudomonas cichorii JBC1 chromosome, complete genome	5986012	2078660	2088046	5986012	transposase,tRNA	uncultured_Caudovirales_phage(75.0%)	11	NA	NA
WP_025259501.1|2078660_2079941_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.4	5.3e-97
WP_025259502.1|2079941_2081336_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_025259503.1|2081375_2082371_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_025259504.1|2082478_2083480_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.7	2.2e-167
WP_025259505.1|2083476_2083812_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	79.3	4.0e-44
WP_025259506.1|2083808_2084108_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.6	5.0e-30
WP_025259507.1|2084107_2084470_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.7	1.6e-38
WP_025259508.1|2084471_2084864_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	83.1	9.6e-58
WP_025259509.1|2084966_2085638_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.5e-106
WP_162883720.1|2085967_2086111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117148206.1|2086896_2088046_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	63.7	3.0e-99
>prophage 2
NZ_CP007039	Pseudomonas cichorii JBC1 chromosome, complete genome	5986012	2977485	3010149	5986012	transposase,plate	Ralstonia_phage(33.33%)	25	NA	NA
WP_117148206.1|2977485_2978636_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	63.7	3.0e-99
WP_081741908.1|2979640_2979964_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_025258070.1|2979960_2980296_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_025258071.1|2980357_2981893_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.0	8.9e-123
WP_025260163.1|2982036_2982774_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025260164.1|2983694_2983904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025260166.1|2984345_2985182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025260167.1|2985184_2988463_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_025260168.1|2988479_2989502_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_025260169.1|2989507_2991544_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.9	1.7e-36
WP_025260170.1|2991565_2992573_-	serine/threonine protein kinase	NA	L7RCF3	Acanthamoeba_polyphaga_moumouvirus	28.4	5.4e-12
WP_025260171.1|2992569_2993298_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_025260172.1|2993297_2996825_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_025260173.1|2996838_2997714_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025260174.1|2997719_2999051_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025260175.1|2999053_2999554_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025260176.1|2999559_3000756_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_025260177.1|3000773_3000914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025260178.1|3001001_3002519_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_025260179.1|3002529_3005184_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.5	2.8e-92
WP_025260180.1|3005197_3006205_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025260181.1|3006168_3007956_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025260182.1|3008321_3009227_-	hypothetical protein	NA	A0A0M3VI89	Ralstonia_phage	44.3	6.4e-20
WP_025260183.1|3009230_3009731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025260184.1|3009741_3010149_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP007039	Pseudomonas cichorii JBC1 chromosome, complete genome	5986012	4179145	4229893	5986012	terminase,protease,integrase,holin,head,tail,capsid,portal,tRNA	Pseudomonas_phage(63.41%)	66	4187189:4187208	4228120:4228139
WP_025261055.1|4179145_4181128_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_025261056.1|4181358_4182027_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	8.0e-28
WP_025261057.1|4182028_4184509_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025261058.1|4184498_4185575_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_025261059.1|4185741_4186485_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_025261060.1|4186634_4187048_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
4187189:4187208	attL	TATGTGCGGATTAGCAGGTG	NA	NA	NA	NA
WP_162883711.1|4187412_4187772_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_025261062.1|4187911_4188460_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	72.9	6.2e-71
WP_025261063.1|4188518_4188884_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	47.8	5.5e-15
WP_025261064.1|4188880_4189225_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	55.6	6.8e-23
WP_025261065.1|4189224_4190010_-	hypothetical protein	NA	A0A059VJZ6	Pseudomonas_phage	38.0	3.5e-43
WP_081741948.1|4190024_4190969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399956.1|4191197_4194632_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	59.5	0.0e+00
WP_025261067.1|4194696_4195158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261068.1|4195209_4195827_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	62.2	3.0e-61
WP_074568818.1|4195875_4196223_-	hypothetical protein	NA	A0A1B0VMC6	Pseudomonas_phage	53.3	2.9e-21
WP_143008676.1|4196269_4196569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261071.1|4196599_4197412_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	80.5	1.7e-125
WP_025261072.1|4197414_4198164_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.1	5.3e-121
WP_025261073.1|4198160_4198499_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	48.2	1.1e-25
WP_025261074.1|4198498_4202071_-|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	44.8	1.4e-57
WP_025261075.1|4202089_4202293_-	hypothetical protein	NA	A0A2D1GNK2	Pseudomonas_phage	59.6	1.4e-07
WP_025261076.1|4202325_4202661_-	hypothetical protein	NA	A0A2D1GNT5	Pseudomonas_phage	55.8	9.2e-25
WP_025261077.1|4202672_4203170_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	79.4	4.8e-70
WP_025261078.1|4203216_4203603_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	87.5	8.6e-59
WP_025261079.1|4203595_4204174_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	63.9	3.1e-60
WP_025261080.1|4204177_4204357_-	hypothetical protein	NA	A0A2D1GNQ5	Pseudomonas_phage	55.6	3.5e-07
WP_025261081.1|4204365_4204692_-|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	66.0	1.3e-28
WP_025261082.1|4204691_4204988_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	71.7	4.3e-34
WP_025261083.1|4204988_4205330_-	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	44.8	2.6e-06
WP_025261084.1|4205383_4206586_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	59.7	6.9e-131
WP_025261085.1|4206582_4207224_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	77.8	1.4e-90
WP_025261086.1|4207210_4208425_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	75.2	3.5e-175
WP_038399958.1|4208427_4210116_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	81.1	5.2e-249
WP_025261088.1|4210112_4210607_-|terminase	terminase	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	44.5	4.8e-22
WP_025261089.1|4210764_4211103_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	49.5	2.9e-26
WP_025261090.1|4211253_4211640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261091.1|4211672_4211987_-|holin	phage holin, lambda family	holin	A0A1V0DYG4	Shewanella_phage	45.7	3.4e-13
WP_025261092.1|4212052_4212472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261093.1|4212900_4213452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261094.1|4213609_4213996_-	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	57.5	1.7e-35
WP_025261095.1|4213992_4214277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261096.1|4214269_4215610_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	48.5	3.3e-113
WP_025261097.1|4215670_4216456_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	53.9	9.0e-63
WP_025261098.1|4216460_4217369_-	helix-turn-helix domain-containing protein	NA	A0A1B0VME0	Pseudomonas_phage	63.8	1.4e-46
WP_025261099.1|4217372_4217603_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	51.3	3.2e-13
WP_025261100.1|4217599_4217977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261101.1|4217973_4218699_-	hypothetical protein	NA	A0A1W6JTB2	Pseudomonas_phage	51.1	1.6e-58
WP_025261102.1|4218695_4218983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261103.1|4218979_4219255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261104.1|4219251_4219494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143008675.1|4219490_4219811_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_074568817.1|4219943_4220237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025261106.1|4220343_4221078_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	45.0	2.2e-47
WP_025261107.1|4221558_4222113_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_025261108.1|4222330_4222582_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_025261109.1|4222678_4223053_+	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	54.4	2.8e-22
WP_025261110.1|4223124_4223433_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	66.0	5.5e-08
WP_143008674.1|4223419_4224043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399962.1|4224030_4224771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025261113.1|4224767_4225508_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	54.8	5.6e-75
WP_162883712.1|4225504_4225669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025261114.1|4225665_4225956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025261115.1|4225952_4226651_+	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	34.8	1.3e-25
WP_025261116.1|4226893_4228084_+|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	54.8	8.4e-113
WP_025261117.1|4228120_4229893_+	N-acetylglutaminylglutamine amidotransferase	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	8.3e-32
4228120:4228139	attR	TATGTGCGGATTAGCAGGTG	NA	NA	NA	NA
>prophage 4
NZ_CP007039	Pseudomonas cichorii JBC1 chromosome, complete genome	5986012	5345019	5376619	5986012	plate,tail,tRNA	Pseudomonas_phage(59.26%)	39	NA	NA
WP_025262067.1|5345019_5346219_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025262068.1|5346421_5347840_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
WP_025262069.1|5347843_5348938_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_025262070.1|5348995_5349346_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	5.6e-25
WP_025262071.1|5349497_5350532_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_025262072.1|5350665_5351094_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_025262073.1|5351170_5352079_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_025262074.1|5352144_5352921_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025262075.1|5353011_5353350_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_025262076.1|5353486_5354134_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_025262077.1|5354192_5354987_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_025262078.1|5355227_5355650_-	OsmC family protein	NA	NA	NA	NA	NA
WP_025262079.1|5355860_5356505_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_025262080.1|5356517_5357213_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_025262081.1|5357223_5358060_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	57.3	3.6e-70
WP_025262082.1|5358056_5359106_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.7	2.2e-112
WP_025262083.1|5359114_5359723_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	1.5e-73
WP_038400061.1|5360151_5360661_-	lysozyme	NA	B5TK84	Pseudomonas_phage	50.3	5.5e-29
WP_025262086.1|5360657_5361203_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	70.2	5.4e-67
WP_051427755.1|5361269_5361860_-	hypothetical protein	NA	A0A2H4J924	uncultured_Caudovirales_phage	50.4	2.6e-22
WP_025262087.1|5361875_5363117_-	hypothetical protein	NA	B5TK79	Pseudomonas_phage	58.8	6.2e-18
WP_025262088.1|5363128_5363728_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	74.4	4.7e-88
WP_025262089.1|5363715_5364756_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	68.6	2.4e-127
WP_025262090.1|5364745_5365144_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	66.7	3.0e-46
WP_025262091.1|5365143_5365653_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	72.6	1.8e-64
WP_025262092.1|5365699_5366749_-	hypothetical protein	NA	B5TK72	Pseudomonas_phage	62.0	7.4e-121
WP_025262093.1|5366753_5368112_-	2-hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	45.1	7.4e-105
WP_025262094.1|5368095_5370261_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	37.5	1.1e-75
WP_025262095.1|5370391_5370688_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	75.0	2.8e-33
WP_025262096.1|5370684_5371032_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	72.2	3.1e-44
WP_025262097.1|5371092_5372589_-|tail	tail sheath protein	tail	B5TK67	Pseudomonas_phage	81.1	1.9e-234
WP_025262098.1|5372607_5372790_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	77.1	2.7e-15
WP_025262099.1|5372786_5373377_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	51.5	2.7e-51
WP_025262100.1|5373410_5373749_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	58.1	3.4e-19
WP_025262101.1|5373729_5374119_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	85.2	7.4e-42
WP_025262102.1|5374545_5375004_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.3	6.9e-23
WP_025262103.1|5375173_5375785_+	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	48.5	1.5e-49
WP_025262104.1|5375940_5376210_+	DUF1654 domain-containing protein	NA	A0A127KND4	Pseudomonas_phage	39.7	5.0e-05
WP_025262105.1|5376376_5376619_+	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	53.8	5.1e-17
>prophage 5
NZ_CP007039	Pseudomonas cichorii JBC1 chromosome, complete genome	5986012	5815694	5823548	5986012		Escherichia_phage(33.33%)	6	NA	NA
WP_025262491.1|5815694_5816807_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	51.1	6.7e-104
WP_025262492.1|5816812_5817691_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.6	6.1e-76
WP_025262493.1|5817878_5820791_-	aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	23.8	3.5e-19
WP_025262494.1|5821051_5822134_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	2.4e-98
WP_025262495.1|5822130_5823006_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.1	1.8e-104
WP_025262496.1|5823002_5823548_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.9	1.5e-53
