The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	350	56067	4513140	transposase,tail,tRNA,terminase,capsid	Salmonella_phage(27.59%)	45	NA	NA
WP_025243820.1|350_2240_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_025243821.1|2257_2878_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_025243822.1|3509_3884_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_038467949.1|3892_4711_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|4760_5000_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_025243824.1|5057_5528_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_025243825.1|5541_6075_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_025243826.1|6087_7629_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_025243827.1|7679_8543_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_025243828.1|8569_9952_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_025243829.1|9972_10395_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_025243830.1|10512_11721_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	2.1e-47
WP_025243832.1|15924_17301_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.5	2.1e-27
WP_025243833.1|17449_19282_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	43.8	2.3e-125
WP_051419361.1|19676_20702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|20694_21618_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025243835.1|21678_22413_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	73.0	1.1e-102
WP_025243836.1|23135_23861_-	hypothetical protein	NA	A0A222YXY0	Escherichia_phage	37.8	9.6e-27
WP_025243837.1|24119_24791_-	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	37.5	6.6e-30
WP_025243838.1|25277_25736_+	DUF1640 domain-containing protein	NA	Q3LZN5	Bacteriophage	38.3	1.8e-15
WP_038467962.1|25843_26068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243839.1|26060_26984_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.3e-125
WP_025243842.1|28374_29583_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_071882099.1|29787_30150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148296964.1|30280_30970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243844.1|31017_31416_+	hypothetical protein	NA	B6SCV4	Bacteriophage	68.3	1.9e-40
WP_038469262.1|31402_32773_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.2	2.5e-137
WP_051419363.1|32773_34171_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	60.5	8.8e-162
WP_025243846.1|34199_34862_+|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	56.9	1.4e-64
WP_025243847.1|34865_36104_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	46.7	8.0e-90
WP_025243848.1|36100_36598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243849.1|37584_37986_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	68.2	1.6e-44
WP_025243850.1|38512_38902_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	78.3	9.3e-53
WP_038467966.1|38876_39440_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	58.9	3.8e-63
WP_025243852.1|39443_40922_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.7	9.7e-135
WP_025243853.1|41378_41786_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.6	1.1e-32
WP_025243857.1|43854_44433_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.5	5.8e-59
WP_025243858.1|44422_44722_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.7	2.8e-17
WP_025243860.1|46723_47473_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.6	2.7e-40
WP_071882101.1|49904_50330_+|tail	phage tail protein	tail	A0A0F6R6B6	Escherichia_coli_O157_typing_phage	40.3	7.1e-06
WP_025243862.1|50378_51491_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	35.0	7.8e-28
WP_025243863.1|51588_52539_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	75.5	1.5e-117
WP_025243864.1|52802_53336_-	hypothetical protein	NA	A0A0H4IQ68	Shigella_phage	63.7	5.0e-33
WP_025243865.1|53694_54618_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025243867.1|55548_56067_+	lysozyme	NA	H6WRZ4	Salmonella_phage	61.1	2.8e-57
>prophage 2
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	91442	188424	4513140	transposase,tail,protease,integrase	Escherichia_phage(34.78%)	82	84915:84933	104154:104172
84915:84933	attL	CATCCGATCACTGATTCCG	NA	NA	NA	NA
WP_025243904.1|91442_92366_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	3.3e-125
WP_071882103.1|92454_93057_+|integrase	site-specific integrase	integrase	A0A1I9KF78	Aeromonas_phage	47.9	2.7e-43
WP_025243906.1|93150_93714_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	80.0	2.4e-54
WP_025243907.1|93710_94289_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_025243908.1|94257_94809_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_025243909.1|94824_95550_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	5.4e-22
WP_025243910.1|97047_97335_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	37.5	3.3e-07
WP_025243911.1|97440_97920_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_025243912.1|98013_98886_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	6.6e-06
WP_025243913.1|98864_99137_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_025243914.1|99767_100310_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	37.0	6.7e-17
WP_071882104.1|103617_103914_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.1	5.8e-23
WP_025243921.1|105822_106572_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	1.0e-39
104154:104172	attR	CATCCGATCACTGATTCCG	NA	NA	NA	NA
WP_051419371.1|106726_107455_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	57.9	4.9e-63
WP_148296967.1|107373_108363_+	hypothetical protein	NA	F1BUK9	Cronobacter_phage	45.9	1.9e-78
WP_025243922.1|108359_108701_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	56.6	2.7e-24
WP_025243923.1|108678_109863_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	66.5	5.2e-147
WP_025243924.1|109855_110422_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	3.2e-62
WP_025243925.1|110421_111675_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	54.7	4.3e-99
WP_081742886.1|111661_111838_+	hypothetical protein	NA	Q37842	Escherichia_phage	57.4	1.6e-12
WP_025243926.1|111902_112826_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_148296968.1|113234_113681_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.8	2.8e-21
WP_038468006.1|117314_117527_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	48.1	4.6e-06
WP_025243929.1|117825_118068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243930.1|118064_118493_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_025243834.1|119715_120639_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025243931.1|121026_121467_-	DUF1640 domain-containing protein	NA	Q3LZN5	Bacteriophage	94.5	2.4e-20
WP_081742887.1|121986_122157_+	hypothetical protein	NA	Q777W5	Enterobacteria_phage	54.4	8.5e-11
WP_025243932.1|122221_123145_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	9.7e-125
WP_051419373.1|123317_123518_-	hypothetical protein	NA	A0A1W6JNX1	Morganella_phage	62.3	1.9e-14
WP_025243933.1|123579_124503_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.3	2.8e-124
WP_025243936.1|126017_126359_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	73.2	1.7e-34
WP_025243937.1|126522_127446_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.1e-125
WP_025243939.1|128829_129753_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	7.4e-125
WP_025243940.1|129745_129898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243942.1|131004_131928_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	3.9e-126
WP_148296969.1|133449_134370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243945.1|134756_135680_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	5.3e-123
WP_025246990.1|135822_136809_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	4.5e-35
WP_038468016.1|136842_137793_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_025243946.1|138041_138851_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	8.8e-21
WP_025243947.1|138859_139642_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_025243948.1|139646_140168_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_025243949.1|140316_140952_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_025243950.1|140944_141253_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_025243951.1|141379_141634_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_025243952.1|141685_142945_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_025243953.1|143060_144122_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_025243954.1|144208_145579_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	9.6e-20
WP_025243955.1|145724_146129_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_025243956.1|146339_147479_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011410080.1|147690_148119_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011410081.1|148134_148527_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_025243957.1|148855_149497_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_025243958.1|149501_149981_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.7	4.0e-29
WP_025243959.1|150145_151564_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025243960.1|157963_160306_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.6	2.4e-39
WP_025243961.1|160537_161191_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_025243962.1|161187_161865_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_025243963.1|161898_162474_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_025243964.1|162483_163074_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.6	6.4e-13
WP_038468022.1|164830_165697_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_025243965.1|166212_166941_-	pirin family protein	NA	NA	NA	NA	NA
WP_025243966.1|167050_167941_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025243967.1|169222_169618_-	DoxX family protein	NA	NA	NA	NA	NA
WP_025243968.1|169844_170450_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025243969.1|170553_171237_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_025243973.1|173550_173838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243974.1|173834_174308_-	membrane protein	NA	NA	NA	NA	NA
WP_025243975.1|174313_174619_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_158382309.1|175047_175407_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_025243977.1|175433_176105_-	DedA family protein	NA	NA	NA	NA	NA
WP_025243978.1|176136_176511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243979.1|177679_178888_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.8e-46
WP_025243980.1|179182_179932_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	3.9e-39
WP_081742890.1|179943_181494_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.2	9.3e-104
WP_081742891.1|181587_181857_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	43.5	2.3e-10
WP_025243983.1|182019_182943_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025243985.1|183696_184620_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025243986.1|184722_185646_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.7e-124
WP_025243834.1|185863_186787_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_051419377.1|188178_188424_+	hypothetical protein	NA	Q5ZQW7	Pseudomonas_phage	44.9	1.1e-14
>prophage 3
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	208896	296667	4513140	transposase,tRNA,lysis,protease	Escherichia_phage(14.29%)	59	NA	NA
WP_025244007.1|208896_209826_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	50.7	4.8e-71
WP_025244008.1|209837_210128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148296976.1|210135_210327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244009.1|210316_210559_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	54.3	1.4e-14
WP_025244010.1|210619_211543_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.5e-125
WP_148296977.1|212045_212279_+	DNA adenine methylase	NA	Q9B025	Phage_GMSE-1	67.1	6.4e-25
WP_051419377.1|212934_213180_+	hypothetical protein	NA	Q5ZQW7	Pseudomonas_phage	44.9	1.1e-14
WP_051419381.1|213275_213596_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.7	8.3e-07
WP_025244013.1|213946_215131_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	26.6	3.6e-07
WP_025244014.1|215202_217308_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.0	2.3e-57
WP_011412093.1|217402_217873_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_025244015.1|217967_218342_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025244016.1|218475_218763_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_025244017.1|218778_219138_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_038469337.1|219145_219517_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	45.0	6.0e-17
WP_025244019.1|220532_221321_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_025244020.1|221642_221861_+|lysis	phi X174 lysis protein	lysis	NA	NA	NA	NA
WP_025244021.1|221910_222423_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_025244022.1|222516_222720_-	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_025244023.1|225200_225779_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_081742894.1|225667_227326_+	phosphoribulokinase	NA	A0A2K9L3Z8	Tupanvirus	30.4	3.6e-37
WP_011412109.1|228149_228782_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_025244026.1|231187_231937_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.9e-38
WP_025244027.1|233723_234947_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.8	3.6e-26
WP_038468034.1|235063_235645_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.9	2.5e-62
WP_081742895.1|235665_236382_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_025244030.1|236390_237599_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_071882110.1|237694_237862_-	YhfG family protein	NA	NA	NA	NA	NA
WP_025244031.1|239266_240451_+	MFS transporter TsgA	NA	NA	NA	NA	NA
WP_025244032.1|241724_241982_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_025244033.1|244826_245831_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025244034.1|245832_246534_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_025244035.1|246526_247207_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_025244036.1|247254_248067_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.8	3.8e-64
WP_025244037.1|248150_249188_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_025244038.1|249292_250378_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_025244039.1|250418_250940_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_025244041.1|253170_253707_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_025244042.1|253794_254124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244043.1|256898_257462_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_025244047.1|260158_260581_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_025244048.1|260613_261492_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_025244049.1|261687_263307_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.2	1.2e-133
WP_038468042.1|263479_264805_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.2e-12
WP_025244050.1|264801_265521_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_038468044.1|265791_266235_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_025244051.1|266386_268714_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_025244052.1|269471_269705_+	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_025244053.1|269781_272085_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_025244054.1|272094_272337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244055.1|274373_275084_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_025244056.1|275804_276380_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_038468050.1|276538_278653_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_025244058.1|278700_281097_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	44.8	6.0e-17
WP_025244059.1|281413_282172_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244060.1|282196_283045_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_025244061.1|283339_283663_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_025244062.1|287130_288054_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.3	9.7e-125
WP_025243834.1|295743_296667_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
>prophage 4
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	314768	471962	4513140	transposase,tRNA	Escherichia_phage(43.24%)	112	NA	NA
WP_025244073.1|314768_315989_+|transposase	ISL3-like element ISSoEn4 family transposase	transposase	NA	NA	NA	NA
WP_148296978.1|315993_316290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244074.1|316438_317152_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_025244075.1|317151_318063_-	tyrosine recombinase XerC	NA	A0A1B3B212	Gordonia_phage	30.0	3.9e-17
WP_025244076.1|318059_318764_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_025244077.1|318760_319585_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_025244078.1|319654_319876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244079.1|320016_322566_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_025244080.1|322854_323796_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_025244081.1|323792_324533_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_038468059.1|324541_325774_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_025244083.1|325777_327061_+	protoheme IX biogenesis protein HemY	NA	NA	NA	NA	NA
WP_025244084.1|327199_328051_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_025244085.1|329342_329600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244087.1|330858_331710_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_038468062.1|333205_333652_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_025244089.1|337035_337785_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	1.7e-39
WP_025244090.1|338013_339222_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	6.2e-47
WP_025244091.1|339395_340214_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_025244092.1|340233_340806_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.6	5.4e-09
WP_025244093.1|340795_341350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244094.1|341373_341847_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_081742896.1|343052_343586_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.5	2.9e-20
WP_025244097.1|343608_344565_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.4	3.8e-07
WP_025244098.1|345118_346357_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	4.1e-46
WP_025244099.1|346533_347274_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	1.2e-16
WP_081742897.1|347979_348204_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	48.6	4.6e-12
WP_038468070.1|348206_348521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|348600_349524_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244101.1|349516_350455_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025244102.1|350451_351162_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025244103.1|351195_351450_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A218MM99	uncultured_virus	38.6	5.9e-08
WP_025244104.1|352824_353565_-	lipopolysaccharide N-acetylmannosaminouronosyltransferase	NA	NA	NA	NA	NA
WP_081742900.1|353564_356024_-	O-antigen assembly polymerase	NA	NA	NA	NA	NA
WP_025244106.1|356020_357271_-	lipid III flippase WzxE	NA	NA	NA	NA	NA
WP_025244107.1|357272_358394_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	32.8	3.7e-17
WP_025244108.1|358380_359124_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_025244109.1|359101_359983_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	60.1	7.9e-100
WP_025244110.1|359997_361071_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.1	2.7e-86
WP_025244111.1|361067_362330_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HZW8	Acanthocystis_turfacea_Chlorella_virus	26.0	2.9e-18
WP_025244112.1|362334_363459_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	1.8e-24
WP_025244113.1|363565_364618_-	ECA polysaccharide chain length modulation protein	NA	NA	NA	NA	NA
WP_025244114.1|364637_365732_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_158382314.1|365766_365982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244115.1|366011_367271_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_025244116.1|367662_367989_-	thioredoxin TrxA	NA	A0A0A7CHH9	Dinoroseobacter_phage	31.7	6.0e-13
WP_025244117.1|368106_369375_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	5.9e-40
WP_025244118.1|369381_370881_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_025244119.1|370941_372969_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	35.8	1.8e-107
WP_025244120.1|373190_374669_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_025244121.1|374864_375752_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_025244122.1|378633_379572_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_025244123.1|379594_379852_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_025244124.1|379848_381342_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.4	4.5e-55
WP_011412204.1|381478_381580_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_025244125.1|382227_383436_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	2.4e-46
WP_025244127.1|385011_385935_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	7.4e-125
WP_158382316.1|386059_386287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243942.1|386313_387237_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	3.9e-126
WP_025244128.1|389621_390170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243865.1|390234_391158_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025244129.1|391595_392519_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025244130.1|392580_392829_-	flagellar hook-basal body protein FliE	NA	NA	NA	NA	NA
WP_025244131.1|393071_394769_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_025244132.1|394765_395755_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_025244133.1|395747_396461_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_025244134.1|396432_397809_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_025244135.1|397819_399502_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_025244136.1|399634_400123_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
WP_025244137.1|400128_401142_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_025244138.1|401134_401539_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_025244139.1|401539_401914_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_148297172.1|401925_402711_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_025244141.1|403005_403794_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_025244142.1|403843_404782_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_025244143.1|404839_406510_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_025244144.1|406618_407299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244145.1|407298_408396_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_051419390.1|408426_409107_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_025244147.1|409258_410041_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_025244148.1|410061_410820_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_025244149.1|410832_412056_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_025244150.1|412107_412929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244151.1|413369_414293_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_158382318.1|414384_414969_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_025244153.1|415013_415289_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_025244154.1|415327_415771_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_025244155.1|416160_418257_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_025244156.1|419595_420648_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_051419391.1|420644_421508_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_025243834.1|421551_422475_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244158.1|422706_423297_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_025244159.1|423308_423647_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_025244160.1|424346_425270_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025244161.1|427802_428726_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.0	3.4e-122
WP_025244163.1|429250_429976_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_162149695.1|433470_433950_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025244164.1|433960_434941_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.9e-14
WP_025244166.1|438090_439014_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.9	1.0e-126
WP_025244167.1|439119_439425_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025244168.1|440249_441173_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244169.1|446757_447198_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_158382320.1|453137_453305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244173.1|453591_453819_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_025244174.1|455438_458483_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_081742906.1|460442_461921_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025243834.1|461964_462888_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025243926.1|463223_464147_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_025244151.1|464429_465353_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_025244178.1|466414_466879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244030.1|469729_470938_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025243865.1|471038_471962_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
>prophage 5
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	537415	673784	4513140	head,holin,transposase,tail,tRNA,terminase	Edwardsiella_phage(16.67%)	90	NA	NA
WP_025243983.1|537415_538339_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025244219.1|538513_539062_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_025244221.1|539299_539566_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	52.3	1.1e-17
WP_025244222.1|539690_540194_-	DNA starvation/stationary phase protection protein Dps	NA	A0A2K9VDB4	Lactobacillus_phage	25.8	2.6e-07
WP_025244223.1|541810_542329_+	outer membrane protein OmpX	NA	A0A291AWV3	Escherichia_phage	36.0	2.0e-18
WP_025244224.1|542921_544517_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.2	6.1e-58
WP_025244225.1|547867_548824_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_025244226.1|552343_553264_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_025244227.1|553273_553981_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025244228.1|554018_554768_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.9e-38
WP_025244230.1|556733_557564_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_025244231.1|557789_558926_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_081742908.1|558940_559306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081742909.1|561424_562615_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.8	1.4e-91
WP_148296981.1|566194_566536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244238.1|566818_567007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244239.1|568739_569219_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_025244240.1|569680_570790_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_025244241.1|570916_572053_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	7.2e-29
WP_051419989.1|572112_573027_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_025244243.1|573023_573869_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_148296982.1|573939_574239_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_051419418.1|574211_574436_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_025244246.1|576527_577736_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.1e-46
WP_081742910.1|577796_578612_-|tail	tail fiber protein	tail	H9C0Y2	Aeromonas_phage	40.0	9.8e-20
WP_025244248.1|578638_579277_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	48.6	8.4e-51
WP_025244249.1|579273_580518_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.1	1.1e-102
WP_025244250.1|580514_580871_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	46.5	1.7e-21
WP_038468135.1|580880_581555_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	39.7	9.2e-32
WP_025244252.1|581556_582402_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.5	1.2e-33
WP_025244253.1|582699_583494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244254.1|583490_585338_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	45.6	2.9e-19
WP_025244255.1|585337_585505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244256.1|585950_586391_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	37.4	4.9e-18
WP_025244257.1|587854_588406_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	30.2	5.1e-12
WP_025244258.1|588390_588756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244259.1|588700_589330_-	hypothetical protein	NA	A0A2H4P6T2	Pseudomonas_phage	33.7	7.5e-12
WP_025244260.1|589331_589613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244261.1|590056_590401_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	38.7	5.6e-09
WP_025244262.1|591438_591921_-	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	46.3	5.0e-24
WP_025244263.1|591922_593227_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	38.0	9.1e-60
WP_025244264.1|593230_593914_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	47.8	2.5e-53
WP_051419420.1|593954_595424_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.7	1.3e-102
WP_051419990.1|595465_596713_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J196	uncultured_Caudovirales_phage	70.4	9.6e-168
WP_071882296.1|596714_597290_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	57.7	6.2e-53
WP_025244267.1|597295_597496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244269.1|597954_598341_-	hypothetical protein	NA	B6SD43	Bacteriophage	68.8	1.9e-37
WP_025244270.1|598867_599059_-|holin	holin	holin	B6SD41	Bacteriophage	72.4	3.3e-19
WP_148296984.1|599131_599638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244272.1|600045_601254_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.1	6.5e-44
WP_025244273.1|601479_601848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244274.1|602175_602937_+	antirepressor	NA	B6SD63	Bacteriophage	64.7	2.3e-87
WP_025244277.1|605844_606102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244278.1|606094_606403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244279.1|606386_606587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244281.1|607265_608189_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	1.1e-125
WP_025244282.1|608267_608816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244283.1|609038_609407_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_025244284.1|610376_611312_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_038468147.1|612537_613443_-	solute-binding protein	NA	NA	NA	NA	NA
WP_081742913.1|614544_616341_-	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_025244286.1|618032_618527_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025244287.1|618571_619006_-	DoxX family protein	NA	NA	NA	NA	NA
WP_025244288.1|619141_619645_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_025244289.1|619902_620544_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	51.9	8.7e-32
WP_025244290.1|623453_624356_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025244291.1|626285_627674_-	amino acid permease	NA	NA	NA	NA	NA
WP_025244292.1|628536_629745_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244293.1|629987_630740_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.2	1.1e-38
WP_025244294.1|630751_632302_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	6.7e-102
WP_025244295.1|632635_633502_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081742915.1|634119_634596_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_158382326.1|637429_638125_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038468156.1|638271_638901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244300.1|639393_639918_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	42.9	2.0e-26
WP_025244301.1|639928_641137_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_025244304.1|644568_644994_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_025244305.1|644997_645717_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_025244306.1|647693_648356_+	DedA family protein	NA	NA	NA	NA	NA
WP_025244307.1|651238_651973_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_025244308.1|652129_654403_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	4.4e-86
WP_025244309.1|654675_654990_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_038468165.1|656986_657745_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	59.8	3.5e-88
WP_025244312.1|658577_659786_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.8e-46
WP_025244313.1|664155_665817_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	37.4	2.8e-82
WP_025244314.1|666319_667558_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244315.1|667575_668718_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_025244316.1|668734_669538_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_025244317.1|669867_671913_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_025244318.1|672113_673784_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	82.8	6.4e-276
>prophage 6
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	711780	762674	4513140	transposase	uncultured_virus(26.67%)	35	NA	NA
WP_025244348.1|711780_712989_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.8e-46
WP_051419429.1|713189_713891_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	62.1	4.4e-85
WP_051419434.1|715109_715592_-	hypothetical protein	NA	K7PLZ2	Enterobacterial_phage	52.9	2.3e-37
WP_025244350.1|715575_715809_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025243939.1|716881_717805_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	7.4e-125
WP_081742918.1|717797_717959_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_025244352.1|717972_718404_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_025244354.1|720026_720776_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	3.5e-40
WP_025244355.1|722419_723325_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	80.6	1.5e-133
WP_025244359.1|726434_727010_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_025244360.1|727052_728771_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_025244362.1|729537_730758_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025244363.1|732691_733147_+	FxsA family protein	NA	NA	NA	NA	NA
WP_025244364.1|733367_733661_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	2.8e-09
WP_025244365.1|733706_735353_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.7	3.5e-186
WP_025244366.1|735554_735911_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_025244367.1|736166_737195_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_025244368.1|737236_737806_+	elongation factor P	NA	NA	NA	NA	NA
WP_148296986.1|739430_740597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244371.1|740699_741908_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.5e-45
WP_025244373.1|742598_743522_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.6	1.3e-121
WP_025244374.1|743845_745066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882124.1|745086_745329_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_025244375.1|746412_747336_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	4.8e-124
WP_038469547.1|747989_748352_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_025244377.1|748829_749894_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	1.2e-89
WP_025244378.1|749914_751036_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_025244379.1|751086_752244_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_038468194.1|752555_752855_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_025244380.1|753090_753822_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_025244381.1|753953_754934_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_025244382.1|754930_755662_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_025244383.1|755793_758367_+	ATP-dependent chaperone ClpB	NA	A0A0A8J958	Klebsiella_phage	37.4	6.2e-121
WP_081742923.1|761175_761469_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	38.8	2.8e-09
WP_025244388.1|761465_762674_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	2.1e-47
>prophage 7
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	777182	868936	4513140	transposase,integrase	Escherichia_phage(28.0%)	58	789481:789517	822126:822162
WP_025244400.1|777182_778106_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.0	2.2e-121
WP_038468198.1|778441_779473_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025244151.1|781183_782107_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_025244404.1|783914_785465_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	5.1e-102
WP_025244405.1|785476_786226_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.0e-39
WP_148296987.1|786263_787148_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_025244406.1|787385_787790_+	sugar isomerase	NA	NA	NA	NA	NA
WP_025244407.1|789198_789492_+	hypothetical protein	NA	NA	NA	NA	NA
789481:789517	attL	CCGCTTTGTTGAATAAATCCGAAATTTGTGACGACTT	NA	NA	NA	NA
WP_148297175.1|791599_791926_+	hypothetical protein	NA	Q2A088	Sodalis_phage	43.5	5.3e-09
WP_158382328.1|792467_793136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244410.1|793288_794443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244411.1|797465_798674_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_148297176.1|798862_798991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148296989.1|799131_799587_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	46.0	9.9e-22
WP_025244413.1|802229_803153_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	3.3e-125
WP_025244414.1|803431_803788_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	79.6	1.7e-13
WP_025244416.1|805435_806986_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	1.5e-101
WP_071882127.1|807877_808717_+|integrase	site-specific integrase	integrase	K7PHK0	Enterobacteria_phage	46.8	2.1e-57
WP_025244030.1|808624_809833_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244418.1|810129_810531_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_162149696.1|811794_812022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244419.1|812186_812645_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025244420.1|812873_814334_+	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_025244421.1|814425_815574_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_025244425.1|819967_820621_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_025244426.1|821228_822137_+	MFS transporter	NA	NA	NA	NA	NA
WP_025244427.1|822182_823106_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.1e-125
822126:822162	attR	CCGCTTTGTTGAATAAATCCGAAATTTGTGACGACTT	NA	NA	NA	NA
WP_025244429.1|825539_826064_+	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_025244430.1|826173_826365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244431.1|826674_827028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025244432.1|827087_827318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244433.1|827956_828907_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.0	1.5e-99
WP_025244434.1|829409_829934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468223.1|829973_830294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148296990.1|831666_832407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051419473.1|834341_835256_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	25.1	6.2e-07
WP_025244436.1|838082_838832_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.7e-39
WP_025244438.1|839664_840873_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	2.6e-45
WP_025244439.1|841524_842778_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.5	8.2e-26
WP_025244440.1|843868_844972_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.4	3.8e-99
WP_025244441.1|845701_847018_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_025244442.1|848755_849358_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_025243834.1|850402_851326_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_148296991.1|851371_852106_-	hypothetical protein	NA	A0A193GZ54	Enterobacter_phage	34.2	5.3e-25
WP_025244443.1|852223_853147_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_081742926.1|856136_856373_-	hypothetical protein	NA	I6RSM4	Salmonella_phage	71.4	5.7e-13
WP_025244445.1|856372_856798_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	47.8	2.5e-27
WP_148296992.1|856824_857268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244446.1|857250_858471_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_081742927.1|859680_861228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743098.1|861237_861519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244449.1|862769_863162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244450.1|863139_863652_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081743099.1|863767_864403_-	EamA family transporter	NA	NA	NA	NA	NA
WP_025244452.1|865733_866063_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_025244453.1|866106_866670_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_025244454.1|866768_867641_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_025244151.1|868012_868936_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
>prophage 8
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	872735	943812	4513140	transposase,tRNA,protease	Acidithiobacillus_phage(22.73%)	59	NA	NA
WP_025244457.1|872735_873944_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	6.2e-47
WP_025244458.1|874877_875627_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	27.9	2.9e-18
WP_081742930.1|875638_877189_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	4.6e-103
WP_025244461.1|878522_879758_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.1e-46
WP_025244462.1|879985_880237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244464.1|880669_881311_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025244465.1|881387_881984_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_025244466.1|882112_882571_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	4.3e-49
WP_025244467.1|882548_883763_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	1.4e-41
WP_025244468.1|884797_885040_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_011412018.1|885051_885219_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_025244469.1|885321_886131_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	28.2	6.1e-22
WP_025244470.1|886182_886665_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.4	3.6e-22
WP_025244471.1|886661_887441_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_025244473.1|888904_890032_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_081742931.1|891623_893162_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.8	9.9e-98
WP_025244475.1|893173_893923_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.8	2.1e-40
WP_038469605.1|894364_895339_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025244477.1|895391_896495_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_148296993.1|897475_898681_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_025244479.1|898658_899567_-	sugar glycosyltransferase	NA	NA	NA	NA	NA
WP_025244480.1|900746_901721_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_038468248.1|901732_902770_-	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_025244481.1|902801_903722_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.2	5.6e-32
WP_025244482.1|904754_905972_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051419486.1|907223_908462_-	murein hydrolase activator EnvC	NA	A0A0K2CNY2	Brevibacillus_phage	35.4	1.2e-08
WP_025244484.1|908706_909138_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_025244485.1|909165_909414_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	2.2e-15
WP_025244486.1|909481_909952_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_038468251.1|909954_910971_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_025244488.1|911009_911825_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_025244489.1|911831_912293_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_025244490.1|912490_913864_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.7	1.5e-17
WP_025244491.1|913860_914559_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	2.4e-06
WP_025244492.1|914708_915197_+	universal stress protein	NA	NA	NA	NA	NA
WP_025244493.1|915524_915953_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_148296994.1|915942_916533_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	33.1	1.4e-15
WP_025244495.1|917378_917573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148296995.1|917957_918086_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_025243834.1|918133_919057_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_081742932.1|919096_919324_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	6.9e-16
WP_025244496.1|919282_919579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244497.1|920539_920938_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_025244498.1|921430_922393_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_025244499.1|922597_923590_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025244500.1|923707_924475_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_025244502.1|925220_925967_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_025244503.1|926349_927534_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	27.7	1.7e-17
WP_025244504.1|930121_930985_-	aquaporin	NA	NA	NA	NA	NA
WP_025244505.1|931503_931743_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_025244506.1|933462_934794_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	28.2	2.3e-42
WP_025244507.1|934805_935336_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_025244508.1|935423_936260_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_148297178.1|936350_936671_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_148297177.1|936820_936964_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025244510.1|937148_939344_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_025244511.1|939548_939764_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_025244512.1|941500_942250_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	3.5e-40
WP_081742933.1|942261_943812_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	9.3e-104
>prophage 9
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	951981	1018399	4513140	transposase,tRNA,protease	Escherichia_phage(28.57%)	48	NA	NA
WP_025244427.1|951981_952905_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.1e-125
WP_025244517.1|952969_953239_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_025244518.1|956771_957314_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.0	2.2e-15
WP_025243926.1|957709_958633_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_025244519.1|958907_959486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244520.1|959520_959730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244521.1|963043_963424_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_025244522.1|963444_964299_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_025244523.1|964310_965102_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_148296996.1|965190_965664_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	66.0	1.7e-53
WP_148296997.1|965715_966045_-|transposase	transposase	transposase	A0A1B0VFY5	Salmonella_phage	72.5	3.8e-39
WP_025244524.1|966389_966896_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_025244525.1|966895_968308_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	36.8	4.2e-26
WP_038468272.1|968386_969259_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_025244526.1|969341_969797_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_025244527.1|969992_970700_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_081742934.1|972147_972315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244530.1|972404_974909_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_025244532.1|975925_976405_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_025243834.1|980625_981549_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_071882133.1|981596_982235_-	MFS transporter	NA	NA	NA	NA	NA
WP_081742936.1|982192_982939_-	MFS transporter	NA	NA	NA	NA	NA
WP_025244536.1|982978_983902_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_038468275.1|984202_984955_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_071882134.1|985082_986381_-	MFS transporter	NA	NA	NA	NA	NA
WP_025244537.1|986690_988241_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	5.1e-102
WP_025244538.1|988252_989002_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	1.0e-39
WP_025244539.1|990266_990488_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148296998.1|990520_990817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468285.1|990821_992039_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_081742937.1|992087_993293_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	2.4e-46
WP_025244541.1|993603_994200_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	50.8	4.7e-48
WP_025244542.1|994349_994568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468289.1|994712_994907_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	71.7	2.0e-19
WP_025244543.1|995242_996451_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_051419496.1|997167_997467_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	67.7	4.2e-37
WP_071882137.1|997476_997755_+	hypothetical protein	NA	Q777W5	Enterobacteria_phage	47.9	5.7e-12
WP_025244546.1|999237_999591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244547.1|1000155_1000953_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
WP_025244549.1|1002195_1002381_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_025244550.1|1002553_1003834_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_081742938.1|1004804_1006355_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	7.9e-103
WP_025244553.1|1008116_1008461_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.5e-27
WP_025244554.1|1008561_1009182_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_025244555.1|1009879_1010581_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_025244556.1|1010741_1012256_+	dGTPase	NA	NA	NA	NA	NA
WP_025244557.1|1012410_1013856_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	8.9e-24
WP_025244558.1|1017190_1018399_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	2.4e-46
>prophage 10
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1053525	1180941	4513140	transposase,tRNA,integrase	uncultured_virus(21.62%)	105	1049045:1049062	1113282:1113299
1049045:1049062	attL	CTGCCGGCGGTGCACAAC	NA	NA	NA	NA
WP_025244583.1|1053525_1054287_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.6	2.1e-40
WP_025244584.1|1054280_1054907_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.2	1.6e-33
WP_038468300.1|1055112_1056213_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	4.4e-07
WP_025244586.1|1056264_1057254_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.4	5.1e-31
WP_051419996.1|1057458_1059990_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.1	8.2e-25
WP_025244588.1|1060036_1060837_-|integrase	site-specific integrase	integrase	A0A1I9KF78	Aeromonas_phage	44.1	4.7e-51
WP_025244589.1|1061874_1062345_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	40.2	4.8e-11
WP_025244590.1|1062319_1063528_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_025244592.1|1064400_1064787_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	56.7	1.7e-35
WP_025244030.1|1064943_1066152_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244593.1|1066397_1066814_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	49.3	3.4e-21
WP_025244594.1|1067092_1067359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244595.1|1067448_1067874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244596.1|1067884_1068112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244598.1|1070715_1071924_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.7e-44
WP_025244600.1|1073089_1074298_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.6	3.8e-44
WP_025244601.1|1074288_1075182_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.2	1.0e-115
WP_025244030.1|1079836_1081045_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244604.1|1081258_1082029_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025244605.1|1082321_1082810_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	4.0e-29
WP_148297002.1|1084120_1084543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244606.1|1084636_1085704_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	1.0e-109
WP_025244607.1|1085690_1086089_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_025244608.1|1086235_1088863_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.7	5.1e-78
WP_025244609.1|1089117_1089303_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_148297003.1|1089296_1089536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244610.1|1091607_1092180_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_025244611.1|1092256_1093819_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_025244612.1|1096053_1096842_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025244613.1|1097007_1098369_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_025244614.1|1098480_1098729_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_025244615.1|1098767_1099316_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_025244616.1|1099354_1100110_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_025244617.1|1100172_1100520_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_025244618.1|1100839_1101907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244619.1|1101816_1103025_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_025244359.1|1103750_1104326_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_025244360.1|1104368_1106087_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_025244620.1|1106062_1106431_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_025244362.1|1106854_1108075_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025244363.1|1110008_1110464_+	FxsA family protein	NA	NA	NA	NA	NA
WP_025244364.1|1110684_1110978_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	2.8e-09
WP_025244621.1|1111023_1112670_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.5	7.9e-186
WP_025244366.1|1112871_1113228_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_025244622.1|1113483_1114512_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
1113282:1113299	attR	GTTGTGCACCGCCGGCAG	NA	NA	NA	NA
WP_025244368.1|1114553_1115123_+	elongation factor P	NA	NA	NA	NA	NA
WP_025244624.1|1116702_1117626_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_025244625.1|1119005_1119272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244626.1|1119298_1120222_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	1.7e-124
WP_025244627.1|1120267_1120984_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_025243834.1|1122858_1123782_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244628.1|1124226_1124772_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	5.0e-28
WP_025244629.1|1124875_1125904_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_025244630.1|1125997_1126885_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_025244631.1|1126916_1130237_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_025244632.1|1130451_1131429_-	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_025244633.1|1132734_1132866_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_071882299.1|1132973_1133105_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_025244634.1|1133101_1134316_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.8e-46
WP_025244635.1|1134707_1135649_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071882142.1|1135728_1136223_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025244637.1|1138120_1138948_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025244638.1|1139538_1139691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468319.1|1139683_1140607_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	3.3e-125
WP_025244639.1|1140868_1141792_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	6.7e-126
WP_025244640.1|1143025_1143859_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244641.1|1143935_1144895_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025244642.1|1144926_1145178_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	60.0	2.6e-16
WP_025244643.1|1145269_1145596_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148297004.1|1145692_1145830_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_158382330.1|1145833_1145995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244645.1|1146122_1146386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468324.1|1146436_1146670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468327.1|1146686_1146902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244647.1|1147007_1147640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244648.1|1147573_1149028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297005.1|1149583_1150615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244650.1|1150715_1151807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244651.1|1151954_1152272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244652.1|1152289_1153036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244653.1|1153013_1153898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297006.1|1153903_1154749_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_025244655.1|1154877_1156857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244656.1|1156969_1157944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244657.1|1158690_1159545_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_038469690.1|1159901_1160090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244659.1|1160333_1160813_+	lipoprotein	NA	NA	NA	NA	NA
WP_081742941.1|1160980_1162531_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	2.3e-102
WP_025244661.1|1162542_1163292_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	3.9e-39
WP_025244662.1|1163931_1164855_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	5.4e-75
WP_025244663.1|1166407_1166617_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	2.2e-21
WP_025244664.1|1166737_1167121_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.5	8.6e-19
WP_025244665.1|1167432_1167633_+	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_025244666.1|1167700_1168666_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_038468338.1|1168844_1169510_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_025244668.1|1169518_1169782_-	YbeD family protein	NA	NA	NA	NA	NA
WP_025244669.1|1169911_1171123_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.9	1.9e-112
WP_025244671.1|1172033_1173146_-	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_025244672.1|1173152_1175057_-	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_025244673.1|1175094_1175565_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_038468341.1|1175568_1175874_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_025244675.1|1176053_1176707_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_025244676.1|1176699_1177731_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_025244677.1|1177765_1178344_-	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_025244678.1|1178358_1180941_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.9	8.3e-182
>prophage 12
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1296498	1353929	4513140	transposase,tRNA,protease	uncultured_virus(15.38%)	39	NA	NA
WP_025244761.1|1296498_1298430_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	3.7e-118
WP_025244762.1|1298572_1299418_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.3	2.6e-07
WP_025244763.1|1299414_1300752_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011410237.1|1301220_1301553_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_025244765.1|1302048_1302501_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_025244766.1|1302522_1304010_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_025244767.1|1304035_1306672_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.0	3.6e-23
WP_025244768.1|1306740_1307157_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_025244769.1|1307156_1308098_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_025244770.1|1308217_1308487_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_025244771.1|1308746_1310900_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_025244772.1|1310986_1311874_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_148297011.1|1311926_1312040_+	protein YrbN	NA	NA	NA	NA	NA
WP_025244775.1|1316744_1317953_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244779.1|1319656_1320886_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.6	2.8e-87
WP_158382332.1|1322052_1322241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244780.1|1322304_1323282_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_025244781.1|1323389_1324094_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_025244782.1|1324122_1324842_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_025244783.1|1324997_1326221_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_025244784.1|1327392_1328172_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_071882147.1|1331304_1331466_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	68.6	5.6e-12
WP_025244788.1|1331628_1332552_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.0	6.3e-124
WP_025244789.1|1332673_1333288_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_025244790.1|1334019_1335609_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.0	4.1e-30
WP_025244791.1|1335731_1336175_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_025244792.1|1336143_1336557_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_025244793.1|1336669_1337722_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_081742944.1|1338414_1339512_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_025244795.1|1340087_1341011_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	7.4e-125
WP_025244796.1|1343207_1343594_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	51.3	2.7e-12
WP_038468399.1|1343590_1344112_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_025244798.1|1344907_1345849_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_025244799.1|1347026_1348577_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	1.3e-102
WP_025244800.1|1348588_1349338_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.9e-38
WP_025244801.1|1349420_1350629_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_025244802.1|1350825_1351335_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_081742945.1|1351404_1352034_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_025244804.1|1352903_1353929_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1362890	1445527	4513140	transposase,tRNA	uncultured_virus(16.67%)	52	NA	NA
WP_025244812.1|1362890_1364099_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.0e-44
WP_025244813.1|1364246_1364663_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_025244814.1|1366593_1369437_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.3e-310
WP_025244815.1|1369681_1370218_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.1	3.0e-54
WP_025243926.1|1371042_1371966_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_148297012.1|1372026_1372920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081742946.1|1373579_1374569_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025244817.1|1374682_1375216_-	OsmC family protein	NA	NA	NA	NA	NA
WP_158382334.1|1375215_1375368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382336.1|1375408_1376149_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038468409.1|1376538_1376949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382338.1|1377244_1377487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244823.1|1379522_1380272_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.6e-37
WP_081743105.1|1380283_1381834_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	7.9e-103
WP_148297013.1|1381862_1382057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244825.1|1382179_1382938_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.2e-13
WP_025244826.1|1385712_1387359_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_081742947.1|1387422_1388055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244828.1|1388152_1388575_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_025244829.1|1390972_1391290_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_025244830.1|1393844_1395143_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_038468413.1|1396168_1397719_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.2	1.2e-103
WP_025244030.1|1398722_1399931_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244833.1|1399991_1401167_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	8.2e-44
WP_025244835.1|1402554_1403037_+	protein CreA	NA	NA	NA	NA	NA
WP_025244836.1|1403245_1403962_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_025244837.1|1405047_1407498_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_025244838.1|1407499_1408432_+	homoserine kinase	NA	NA	NA	NA	NA
WP_025244839.1|1408435_1409737_+	threonine synthase	NA	NA	NA	NA	NA
WP_025244840.1|1409838_1410618_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_025244841.1|1410676_1412050_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_025244842.1|1414116_1415427_+	MFS transporter	NA	NA	NA	NA	NA
WP_025244843.1|1415896_1417789_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	7.5e-148
WP_025244844.1|1417900_1419016_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.9	8.6e-27
WP_025244845.1|1419185_1420409_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.4	9.0e-78
WP_025244846.1|1420575_1420839_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_025244847.1|1421255_1422194_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_025244848.1|1422225_1425045_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.3	2.0e-80
WP_038468417.1|1425041_1425551_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_025244850.1|1426010_1426961_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_025244851.1|1428136_1428958_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_038468420.1|1429399_1430575_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	4.2e-48
WP_025244854.1|1430576_1433801_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_025244855.1|1434002_1434488_+	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.2	3.1e-29
WP_025244856.1|1434620_1435469_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YRJ8	Escherichia_phage	39.7	1.7e-06
WP_025244857.1|1435471_1435849_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_025244858.1|1435862_1436681_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_025244859.1|1436673_1437666_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_025244860.1|1437655_1438951_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_025244861.1|1439016_1441359_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_025244862.1|1441542_1442367_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_025244865.1|1444603_1445527_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	2.6e-125
>prophage 14
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1449150	1620527	4513140	transposase,protease,integrase	Escherichia_phage(33.33%)	114	1541469:1541528	1612304:1612400
WP_025244868.1|1449150_1450323_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	8.8e-38
WP_025244869.1|1453013_1453301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244870.1|1453297_1453771_-	membrane protein	NA	NA	NA	NA	NA
WP_025244871.1|1453776_1454082_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_038469750.1|1454510_1454855_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_025244873.1|1454881_1455553_-	DedA family protein	NA	NA	NA	NA	NA
WP_025244875.1|1455853_1456777_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	9.7e-125
WP_025244876.1|1456824_1457022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244877.1|1463054_1464464_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_025244878.1|1464524_1465976_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_025244879.1|1465989_1467480_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_081742951.1|1469408_1469936_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_025244881.1|1469938_1470946_+	methyltransferase	NA	NA	NA	NA	NA
WP_025244882.1|1471027_1471327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244883.1|1471546_1472341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244884.1|1472367_1473291_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025244885.1|1473872_1474796_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	4.8e-124
WP_025243834.1|1475378_1476302_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244030.1|1477377_1478586_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025244887.1|1480114_1481038_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	43.2	5.8e-61
WP_025244888.1|1481217_1482444_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_038468426.1|1483239_1483620_+	secY/secA suppressor protein	NA	NA	NA	NA	NA
WP_025244889.1|1483705_1483936_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_025244890.1|1487883_1489452_-	glucan biosynthesis protein G	NA	NA	NA	NA	NA
WP_158382340.1|1489705_1489855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162149697.1|1490404_1490683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244891.1|1490774_1491923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038469762.1|1492563_1492746_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_148297017.1|1494163_1494421_+	hypothetical protein	NA	G4KKN5	Yersinia_phage	41.8	6.0e-08
WP_148297018.1|1497364_1497796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244897.1|1498201_1498954_+	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	43.8	1.4e-44
WP_025244899.1|1499810_1500008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244900.1|1500000_1500252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297019.1|1500466_1500610_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_025244901.1|1500920_1501391_+	hypothetical protein	NA	A0A2D1GLT5	Escherichia_phage	45.1	2.4e-31
WP_025244902.1|1501455_1502379_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	2.8e-124
WP_025244905.1|1503755_1504262_-	thymidine kinase	NA	C4MYQ7	Escherichia_phage	52.7	8.4e-38
WP_025244906.1|1504896_1505304_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_025244907.1|1506496_1507504_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	29.2	1.2e-32
WP_025244908.1|1507513_1508857_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.4	1.9e-81
WP_025244909.1|1508907_1509810_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.6	3.7e-60
WP_025244795.1|1510030_1510954_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	7.4e-125
WP_148297020.1|1511762_1512716_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.5	9.7e-11
WP_025244911.1|1513134_1513941_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_025244913.1|1517047_1518901_+	signal peptide peptidase SppA	NA	K4I1N3	Providencia_phage	27.1	1.1e-07
WP_025244914.1|1519080_1520136_+	asparaginase	NA	NA	NA	NA	NA
WP_025244915.1|1520906_1521179_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_025244916.1|1521227_1521641_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_038468430.1|1521983_1522982_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_025244918.1|1524064_1524919_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_025244919.1|1526177_1528112_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_025244920.1|1530384_1532115_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_025244923.1|1533792_1534092_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	61.2	5.9e-23
WP_025244924.1|1534478_1535099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244925.1|1535095_1535374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|1535642_1536566_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025244926.1|1536650_1537322_+	hypothetical protein	NA	Q8W644	Enterobacteria_phage	40.9	1.5e-34
WP_071882151.1|1538165_1538363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468439.1|1538355_1538607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297021.1|1538821_1538965_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_025244929.1|1539242_1540451_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.8e-46
WP_025244930.1|1540508_1541432_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
1541469:1541528	attL	GATTCTGTGTAAATGCCTTTTCTCAGAAGTGACCGTCCAGGCGGTCACCGAACTCGATAA	NA	NA	NA	NA
WP_025244933.1|1542815_1543019_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025244934.1|1543099_1543849_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	39.2	1.2e-40
WP_025244935.1|1543860_1545411_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.8	3.3e-101
WP_038469787.1|1545556_1546444_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025244937.1|1546433_1547321_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_025244938.1|1548148_1549336_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.2e-27
WP_025244939.1|1549220_1550543_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158382342.1|1550753_1551635_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244941.1|1555161_1556403_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_081742952.1|1556975_1557971_-	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_025244943.1|1558436_1559078_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158382344.1|1560594_1560759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382346.1|1561484_1563284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244947.1|1563356_1564040_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244948.1|1564064_1565444_-	MFS transporter	NA	NA	NA	NA	NA
WP_025244949.1|1565809_1566049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297182.1|1569976_1571002_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025244953.1|1575512_1576487_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_148297022.1|1576938_1577292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081742953.1|1578118_1578853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_148297023.1|1579006_1579387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297024.1|1579420_1579651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297025.1|1579838_1580981_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_158382349.1|1580845_1581076_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025244956.1|1581201_1582479_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025244957.1|1584151_1585549_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	9.2e-18
WP_038469806.1|1586046_1586835_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025244959.1|1586840_1587833_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_025244961.1|1588599_1589439_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025244964.1|1593727_1594540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382351.1|1594551_1595004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419541.1|1595065_1595656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419542.1|1595663_1596029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297026.1|1596043_1596742_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_025244966.1|1598287_1599496_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.5e-45
WP_025244967.1|1599596_1600367_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_081742954.1|1600416_1600581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244968.1|1603095_1603632_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244969.1|1606542_1606998_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025244971.1|1608074_1608701_+|transposase	IS256 family transposase	transposase	F6MIM4	Haemophilus_phage	69.8	1.7e-11
WP_025244972.1|1609279_1610614_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_081742955.1|1610991_1611192_+	DUF4102 domain-containing protein	NA	A7X7X0	Dichelobacter_phage	51.6	3.7e-13
WP_081742956.1|1611210_1612242_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	37.7	1.4e-52
WP_025244973.1|1612475_1613399_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.7e-125
1612304:1612400	attR	GATTCTGTGTAAATGCCTTTTCTCAGAAGTGACCGTCCAGGCGGTCACCGAACTCGATAATAAAGCGGCTCATTGCCATGCGCCAGTCCCTCAAAGG	NA	NA	NA	NA
WP_025244974.1|1613440_1614598_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.8e-42
WP_025244975.1|1614752_1615502_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.1e-38
WP_081742957.1|1615513_1617064_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	1.3e-102
WP_148297027.1|1617399_1618104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244978.1|1618159_1618618_+	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_051419545.1|1618669_1619275_-	MFS transporter	NA	NA	NA	NA	NA
WP_051419546.1|1619296_1619545_-	MFS transporter	NA	NA	NA	NA	NA
WP_025244979.1|1619603_1620527_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	1.1e-125
>prophage 15
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1650189	1709578	4513140	transposase,tRNA,protease,integrase	uncultured_virus(21.43%)	36	1651433:1651492	1718040:1718143
WP_025245002.1|1650189_1651398_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
1651433:1651492	attL	TTAGCCAGAGCCTGCAACTGTTTTTCGTCCATAAATTAACCTGTTTTTGATGTTGGATTG	NA	NA	NA	NA
WP_025245004.1|1654745_1655081_+	hypothetical protein	NA	Q2A0A2	Sodalis_phage	69.2	4.1e-17
WP_025245005.1|1655715_1655982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245006.1|1656046_1656517_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	39.6	1.5e-12
WP_025245008.1|1657611_1658535_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.1e-125
WP_051419560.1|1658612_1658930_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_025245009.1|1659009_1659936_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.4	9.7e-125
WP_025245010.1|1659962_1660499_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_162149707.1|1660624_1660876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245012.1|1662440_1663349_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245013.1|1664249_1664474_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_025245015.1|1667615_1668278_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	56.0	4.5e-47
WP_025245016.1|1668400_1668727_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_025245017.1|1669411_1670602_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_025245018.1|1670678_1670996_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_025245019.1|1671863_1672130_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_148297032.1|1672349_1672490_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_025245020.1|1672980_1674189_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_025245021.1|1674443_1676498_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.1	3.0e-17
WP_025245023.1|1677921_1678671_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	36.7	2.8e-37
WP_158382359.1|1680257_1680407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245027.1|1681779_1682379_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_148297033.1|1682500_1682965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245028.1|1687415_1687940_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	58.8	3.9e-54
WP_025245029.1|1688053_1689262_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	2.6e-45
WP_025245030.1|1690255_1692007_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025245031.1|1692072_1692591_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_071882302.1|1692690_1692855_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_025245032.1|1693124_1693571_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_025245033.1|1696549_1698472_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	2.6e-47
WP_038468473.1|1698475_1700602_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_025245034.1|1700705_1701812_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_025245035.1|1701871_1702420_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_025245036.1|1702588_1703599_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_025245037.1|1703877_1706490_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	5.3e-19
WP_025245038.1|1708177_1709578_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	33.5	6.7e-77
1718040:1718143	attR	CAATCCAACATCAAAAACAGGTTAATTTATGGACGAAAAACAGTTGCAGGCTCTGGCTAACGAACTGGCCAAAAATCTCAAAACCCCTGAAGATCTCGGTCACT	NA	NA	NA	NA
>prophage 16
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1723293	1789578	4513140	transposase,tRNA,protease	Escherichia_phage(33.33%)	47	NA	NA
WP_148297019.1|1723293_1723437_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_148297034.1|1723748_1724048_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	49.1	3.9e-19
WP_025243904.1|1724093_1725017_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	3.3e-125
WP_025245054.1|1727276_1727711_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245055.1|1729159_1730230_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_025245056.1|1733955_1734684_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_025245057.1|1735001_1735532_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_025245058.1|1736433_1737357_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.6e-125
WP_025245059.1|1737593_1738043_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_081742963.1|1738159_1738447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081742964.1|1738556_1740107_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	2.7e-103
WP_025245062.1|1740118_1740868_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	27.5	2.2e-18
WP_025245063.1|1742260_1742746_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_025245064.1|1743390_1743672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245065.1|1743806_1744484_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_025245066.1|1744505_1745318_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_025245067.1|1745321_1745591_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_148297035.1|1745675_1746773_-	ribonuclease D	NA	NA	NA	NA	NA
WP_038469866.1|1746854_1747424_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_025245068.1|1747528_1748230_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_025245071.1|1750319_1750670_+	RidA family protein	NA	NA	NA	NA	NA
WP_025245072.1|1751077_1752439_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	35.8	9.2e-47
WP_025245073.1|1752431_1753025_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_158382361.1|1753199_1753340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245074.1|1753336_1754701_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_025245076.1|1755756_1757313_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.2	1.2e-39
WP_025245077.1|1758661_1759585_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.6	3.4e-122
WP_051419570.1|1759822_1760563_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_025245079.1|1762343_1763267_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.3e-124
WP_025245080.1|1763351_1763882_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_025245086.1|1766787_1767138_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.3	9.3e-28
WP_081742965.1|1768266_1768521_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_025245089.1|1769281_1770832_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	1.9e-101
WP_025245090.1|1770843_1771593_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	2.5e-38
WP_081742966.1|1771589_1771895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382363.1|1773161_1773323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245093.1|1774398_1775046_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_025245094.1|1776516_1777398_+	agmatinase	NA	NA	NA	NA	NA
WP_025245095.1|1777484_1778288_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025245096.1|1778559_1779309_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.7e-39
WP_025245097.1|1779320_1780871_-|transposase	IS21-like element ISSoEn3 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	8.7e-102
WP_081742967.1|1781039_1781357_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245098.1|1782722_1783940_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_025245101.1|1785176_1785668_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_025245102.1|1785769_1786447_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_025245103.1|1786466_1788506_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.6	6.7e-86
WP_025245104.1|1788696_1789578_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 17
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1828844	1877042	4513140	transposase	Escherichia_phage(41.67%)	30	NA	NA
WP_025243834.1|1828844_1829768_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245147.1|1831122_1832046_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	69.6	4.1e-123
WP_025245149.1|1833497_1834133_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.3	1.4e-42
WP_025245150.1|1834132_1834411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245151.1|1834532_1835747_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.1e-46
WP_148297038.1|1836006_1836627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245152.1|1836871_1837942_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_025245153.1|1839269_1840112_-	serine hydrolase	NA	NA	NA	NA	NA
WP_025245154.1|1840117_1840882_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	7.5e-22
WP_025245158.1|1851641_1852391_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.3e-39
WP_148297039.1|1852471_1852633_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_025244030.1|1852673_1853882_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245160.1|1854478_1854832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245161.1|1855415_1855796_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_025245162.1|1856065_1857856_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_025245163.1|1857936_1859226_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_025245164.1|1859326_1860166_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_025243834.1|1860231_1861155_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_162149699.1|1861558_1861762_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_025245165.1|1862383_1862638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297041.1|1862783_1863281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382368.1|1863577_1863985_-	peptidase A24	NA	NA	NA	NA	NA
WP_025245168.1|1864031_1865240_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.4e-45
WP_148297042.1|1865671_1866073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382370.1|1867016_1867280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297043.1|1868330_1869188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468521.1|1869285_1870629_-	cytochrome c	NA	NA	NA	NA	NA
WP_025244160.1|1871285_1872209_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025245177.1|1874849_1875902_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	21.5	1.4e-18
WP_025244160.1|1876118_1877042_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
>prophage 18
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1899576	1950247	4513140	head,transposase,protease,integrase,tail	Escherichia_phage(33.33%)	47	1891183:1891242	1954968:1955077
1891183:1891242	attL	CTTTTTCACTGCGTCGTCGGTCGGGAACACCTTGCGCTTTTTGATGGCATGCCGGATCAC	NA	NA	NA	NA
WP_025243926.1|1899576_1900500_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_081743110.1|1901290_1901431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882163.1|1901440_1902457_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	66.9	2.5e-134
WP_025245196.1|1905174_1905723_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_025245197.1|1905781_1907614_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_025245198.1|1907606_1908263_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_025245199.1|1908914_1909139_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_081743111.1|1909262_1909403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244427.1|1910383_1911307_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.1e-125
WP_038468544.1|1912655_1913042_+	hypothetical protein	NA	B6SD43	Bacteriophage	68.0	2.4e-37
WP_025245204.1|1913174_1913513_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	66.7	3.0e-39
WP_025245205.1|1913726_1914209_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	71.9	1.7e-56
WP_025245206.1|1917010_1917676_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	68.4	5.8e-87
WP_025245207.1|1918924_1919242_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	60.2	5.6e-32
WP_025245208.1|1919241_1919589_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_025245209.1|1919572_1919944_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	34.1	6.2e-14
WP_025245210.1|1919940_1920333_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	60.2	5.7e-34
WP_025245211.1|1920367_1920874_+	hypothetical protein	NA	Q7Y403	Yersinia_phage	69.3	1.9e-53
WP_025245212.1|1920870_1921236_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	42.9	4.1e-18
WP_025245213.1|1924310_1924646_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	45.5	7.5e-27
WP_025245214.1|1924999_1925728_+	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	66.4	9.4e-99
WP_148297186.1|1926406_1926586_+	recombinase RecA	NA	NA	NA	NA	NA
WP_025245217.1|1928429_1929353_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.0	2.2e-124
WP_025245220.1|1930883_1931537_-	hypothetical protein	NA	A0A2D1GLT5	Escherichia_phage	47.3	3.7e-54
WP_148297045.1|1931617_1931860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245221.1|1932702_1934193_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.4	4.6e-100
WP_025245222.1|1934259_1935183_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	9.7e-125
WP_025243834.1|1935387_1936311_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_148297046.1|1936579_1936723_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_025245050.1|1936937_1937189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245223.1|1937187_1937454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245224.1|1937553_1938210_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	52.3	9.5e-42
WP_025245225.1|1938221_1938974_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	43.8	4.3e-46
WP_025245226.1|1939099_1939384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245227.1|1939936_1940287_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	59.6	3.4e-22
WP_025245228.1|1941628_1941865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245229.1|1941861_1942077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245230.1|1942076_1942280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382372.1|1942297_1942465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243865.1|1942558_1943482_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025245231.1|1943690_1944071_-	hypothetical protein	NA	Q9B030	Phage_GMSE-1	56.7	3.3e-31
WP_025245232.1|1944357_1945065_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	45.1	1.4e-54
WP_025245233.1|1945112_1945304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382374.1|1945772_1945913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297047.1|1945909_1946326_+	hypothetical protein	NA	A0A1J0MF60	Staphylococcus_phage	60.0	9.3e-35
WP_158382376.1|1947564_1947717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244030.1|1949038_1950247_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
1954968:1955077	attR	CTTTTTCACTGCGTCGTCGGTCGGGAACACCTTGCGCTTTTTGATGGCATGCCGGATCACGCTGTTTAACGACTCGATGGCGTTGGTCGTGTAGATCACCTTGCGGATGT	NA	NA	NA	NA
>prophage 19
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	1953787	2035136	4513140	transposase	Escherichia_phage(30.0%)	50	NA	NA
WP_025245239.1|1953787_1954711_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	1.8e-126
WP_025245241.1|1956309_1957518_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.6	3.8e-44
WP_025245242.1|1957566_1957857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245243.1|1958303_1958495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297048.1|1958534_1958777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245244.1|1960387_1961596_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245236.1|1961694_1962444_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	5.1e-39
WP_025245246.1|1966804_1967728_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.0	1.4e-123
WP_081743112.1|1967721_1968516_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_081742975.1|1970374_1971079_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_038468565.1|1971845_1972127_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_025245250.1|1972095_1973253_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_148297049.1|1973263_1973860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245251.1|1973624_1974317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245252.1|1974467_1975088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245253.1|1975872_1976133_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_038469949.1|1979501_1980056_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_081742978.1|1980139_1980718_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025245257.1|1982385_1983135_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.3e-39
WP_025245260.1|1984585_1985005_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_051419615.1|1985249_1986521_+	MFS transporter	NA	NA	NA	NA	NA
WP_025245267.1|1988811_1990107_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.5	4.8e-69
WP_025245268.1|1990379_1991021_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_148297050.1|1992287_1992878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245269.1|1993143_1993488_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_025245270.1|1998957_2000220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245272.1|2000458_2000716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245273.1|2000718_2001168_-	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_025245274.1|2001897_2002824_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.7	7.0e-123
WP_025243834.1|2003168_2004092_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245275.1|2004575_2005997_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_025245276.1|2010878_2011673_+	antirepressor	NA	B6SD57	Bacteriophage	37.2	1.5e-44
WP_148297051.1|2012244_2012460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245280.1|2014708_2014951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882171.1|2015970_2016789_+	hydrolase	NA	NA	NA	NA	NA
WP_025244151.1|2017076_2018000_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_148297187.1|2018079_2019360_-	cytosine permease	NA	NA	NA	NA	NA
WP_148297052.1|2019386_2020136_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	30.2	1.9e-17
WP_025245283.1|2022463_2022658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468591.1|2022688_2023297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419626.1|2023442_2023643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245284.1|2024052_2025603_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	1.9e-101
WP_025245285.1|2025614_2026364_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	7.8e-40
WP_025245286.1|2026535_2027744_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	2.4e-46
WP_071882173.1|2027818_2028106_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	62.8	5.6e-23
WP_148297053.1|2028206_2028437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245287.1|2028554_2029763_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	2.4e-46
WP_025243865.1|2029874_2030798_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025245289.1|2031984_2033400_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	4.9e-51
WP_025245291.1|2033759_2035136_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.0	7.9e-30
>prophage 20
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2053008	2140562	4513140	transposase,tRNA,protease,integrase	Escherichia_phage(18.52%)	57	2050828:2050856	2138929:2138957
2050828:2050856	attL	CAATAACGATACCTGGAAAAAGAAAGTAG	NA	NA	NA	NA
WP_025243834.1|2053008_2053932_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245305.1|2054709_2055633_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.3e-124
WP_025245307.1|2056577_2057300_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_025245308.1|2057463_2057874_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_025245309.1|2057880_2059236_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_025245310.1|2062183_2062867_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_025245311.1|2063893_2064985_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_025245312.1|2065054_2065576_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_025245313.1|2066678_2067878_-	MFS transporter	NA	NA	NA	NA	NA
WP_025245314.1|2068019_2069012_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_025245315.1|2070128_2071205_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_025245316.1|2072995_2073919_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	7.4e-125
WP_025245317.1|2074125_2075091_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	70.4	1.3e-127
WP_038468608.1|2077258_2077645_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	29.8	1.6e-09
WP_025245318.1|2077654_2077894_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.7	1.7e-17
WP_038468611.1|2079005_2079197_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_025245319.1|2079257_2080181_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	2.2e-124
WP_148297056.1|2080539_2081712_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.8e-46
WP_025245321.1|2082373_2083027_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	60.6	3.8e-67
WP_025245322.1|2083016_2083232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245323.1|2083239_2083530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245324.1|2083541_2084471_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	49.3	1.7e-68
WP_071882175.1|2086529_2086787_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	61.2	6.6e-23
WP_025245325.1|2086883_2087549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244030.1|2087633_2088842_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245326.1|2090348_2091878_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_025245327.1|2091885_2092764_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_025245328.1|2092810_2093281_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_025245329.1|2093277_2094372_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.7	1.5e-47
WP_038468615.1|2094577_2096002_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_025245331.1|2096175_2097357_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_025245332.1|2097692_2098901_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245333.1|2101277_2101547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743113.1|2101642_2101936_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	43.6	2.3e-16
WP_025245335.1|2102000_2102990_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.8	3.5e-88
WP_148297057.1|2102982_2103321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245336.1|2103463_2103874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245338.1|2104939_2105671_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025245339.1|2105691_2106441_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.5	1.9e-25
WP_025245340.1|2106631_2107183_-	lipoprotein	NA	NA	NA	NA	NA
WP_051419632.1|2107329_2107992_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_025245342.1|2109089_2110799_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_025245343.1|2112018_2112240_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	65.7	2.5e-18
WP_025245344.1|2112557_2112878_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.6	1.8e-14
WP_025245345.1|2112905_2115182_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	1.3e-165
WP_002211347.1|2117082_2117301_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025245348.1|2117393_2118116_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_025245349.1|2118123_2119923_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A076FI99	Aureococcus_anophage	28.9	5.0e-16
WP_025245350.1|2119925_2121689_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.0	1.0e-18
WP_025245351.1|2122143_2123112_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.7	3.2e-62
WP_025245352.1|2123621_2124116_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_025245353.1|2124240_2127240_+	hypothetical protein	NA	A0A218M9A2	Mycobacterium_phage	47.8	3.4e-86
WP_025245354.1|2127392_2128004_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_025245355.1|2129477_2130770_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	3.4e-91
WP_025245356.1|2130940_2132086_+	MFS transporter	NA	NA	NA	NA	NA
WP_025245357.1|2134294_2135035_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.0	3.6e-21
WP_025244030.1|2139353_2140562_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
2138929:2138957	attR	CAATAACGATACCTGGAAAAAGAAAGTAG	NA	NA	NA	NA
>prophage 21
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2154848	2312346	4513140	transposase,tRNA,protease,integrase	Pseudomonas_phage(21.95%)	115	2192805:2192844	2318108:2318158
WP_025245371.1|2154848_2156399_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	1.5e-101
WP_025245372.1|2156856_2157246_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_025245373.1|2157375_2160084_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_025245374.1|2160696_2161224_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_025245375.1|2161300_2162218_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_025245376.1|2162324_2163485_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_025245377.1|2163557_2164814_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_025245378.1|2164810_2165647_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_025245379.1|2165703_2167176_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_025245380.1|2167240_2168308_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_025245381.1|2168304_2169507_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_025245382.1|2169506_2170823_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_025245383.1|2170825_2171908_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_025245384.1|2171901_2173269_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_025245385.1|2173273_2174755_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_038468634.1|2174768_2176514_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_025245386.1|2176539_2176860_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_025245387.1|2176856_2177804_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011410413.1|2177806_2178265_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_025245388.1|2179605_2180610_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_025245389.1|2181074_2181572_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_025245390.1|2187722_2188325_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
2192805:2192844	attL	ATCAAAATCAGGCAAATACACAAATTTCTAAACAGGCTCT	NA	NA	NA	NA
WP_025245394.1|2195348_2196830_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
2192805:2192844	attL	ATCAAAATCAGGCAAATACACAAATTTCTAAACAGGCTCT	NA	NA	NA	NA
WP_025245395.1|2196826_2197909_-	TolC family protein	NA	NA	NA	NA	NA
WP_158382380.1|2197921_2198083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297060.1|2198161_2198491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081742980.1|2199566_2200220_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	69.3	4.5e-84
WP_025245398.1|2200409_2201021_-	helix-turn-helix transcriptional regulator	NA	A0A076FRF7	Pseudomonas_phage	35.1	7.1e-07
WP_025245399.1|2201169_2201436_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	47.6	1.6e-08
WP_071882177.1|2201452_2203501_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.6	1.5e-173
WP_025244443.1|2203468_2204392_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025245401.1|2205520_2205811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297061.1|2205818_2206010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245402.1|2205999_2206629_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	61.1	6.7e-69
WP_025245403.1|2206632_2206824_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	60.0	5.4e-14
WP_025245404.1|2208230_2208962_+	3'-5' exoribonuclease	NA	A0A060D5A6	Salmonella_phage	42.2	9.0e-33
WP_025245405.1|2209873_2210623_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	5.1e-39
WP_038468641.1|2213633_2213867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081742982.1|2213965_2214436_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025245409.1|2214494_2215418_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	2.0e-125
WP_025245411.1|2218291_2219803_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051419638.1|2219805_2220489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245413.1|2220881_2221268_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_025245414.1|2221347_2221812_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_025245416.1|2223412_2223880_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_025245417.1|2224132_2225149_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_025245418.1|2225321_2225762_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_071882179.1|2225860_2227072_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	2.0e-45
WP_025245420.1|2227972_2230828_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	2.7e-141
WP_025245421.1|2230841_2231291_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_025245422.1|2231371_2232883_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	2.3e-46
WP_025245423.1|2233162_2234263_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_025245424.1|2234262_2235339_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_025245427.1|2236472_2237264_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	1.2e-11
2235539:2235578	attR	AGAGCCTGTTTAGAAATTTGTGTATTTGCCTGATTTTGAT	NA	NA	NA	NA
WP_025245428.1|2237758_2238289_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
2235539:2235578	attR	AGAGCCTGTTTAGAAATTTGTGTATTTGCCTGATTTTGAT	NA	NA	NA	NA
WP_158382382.1|2241455_2241614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|2242875_2243799_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245435.1|2244171_2245380_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	6.9e-46
WP_025245436.1|2245433_2248961_-	ribonuclease E	NA	NA	NA	NA	NA
WP_025245437.1|2249522_2250479_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_025245438.1|2251236_2251758_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_025245439.1|2251774_2251945_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_025245440.1|2251961_2252996_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_025245441.1|2253002_2253956_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_025245442.1|2253974_2254904_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_025245443.1|2254918_2255653_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	2.3e-12
WP_011410921.1|2255807_2256044_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	5.0e-09
WP_025245444.1|2256124_2257366_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_025245445.1|2257442_2258240_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_025245446.1|2258325_2259351_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_025245447.1|2259340_2259979_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.3	1.0e-24
WP_025245448.1|2259975_2260971_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.0	2.8e-08
WP_025245449.1|2260990_2261788_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_025245451.1|2262115_2263552_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_158382384.1|2263695_2263833_+	hypothetical protein	NA	Q9B024	Phage_GMSE-1	84.8	4.9e-09
WP_025245452.1|2264936_2265203_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	48.9	8.3e-21
WP_051419640.1|2265235_2266162_-	Fic family protein	NA	NA	NA	NA	NA
WP_148297062.1|2266251_2266632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|2267099_2268023_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_051419646.1|2268873_2270427_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.9	5.6e-157
WP_158382386.1|2270498_2270756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245458.1|2271630_2272200_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	39.3	2.5e-30
WP_025245459.1|2272196_2272457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245460.1|2272538_2272751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245461.1|2273054_2273267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245462.1|2273313_2273538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245465.1|2274653_2275862_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_071882181.1|2276582_2276816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245467.1|2276984_2277164_-	YciY family protein	NA	NA	NA	NA	NA
WP_025245468.1|2277337_2278798_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_038470043.1|2278852_2279176_+	YciU family protein	NA	NA	NA	NA	NA
WP_038468663.1|2283026_2283950_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.3	1.3e-124
WP_025245471.1|2283942_2284254_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_025245474.1|2287454_2288075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245475.1|2288071_2288350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245476.1|2288481_2289234_+	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	44.2	1.1e-44
WP_038468666.1|2289245_2289890_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	51.3	1.4e-42
WP_025244899.1|2290076_2290274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245478.1|2290266_2290518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297019.1|2290732_2290876_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_025245479.1|2291187_2291658_+	hypothetical protein	NA	A0A2D1GLT5	Escherichia_phage	46.3	5.8e-33
WP_025243939.1|2292500_2293424_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	7.4e-125
WP_071882183.1|2293753_2293978_+	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	60.0	3.6e-17
WP_025245481.1|2293980_2296023_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.1	2.0e-178
WP_025245482.1|2296034_2296988_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	50.6	2.9e-63
WP_148297063.1|2298671_2299007_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081743115.1|2299483_2299783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245485.1|2299779_2300412_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025245486.1|2300511_2301075_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	45.7	3.7e-26
WP_025245487.1|2301071_2301998_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	3.3e-72
WP_051420005.1|2307750_2308146_-	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	46.6	9.5e-21
WP_081742986.1|2308129_2308441_-	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	53.2	3.4e-05
WP_051419652.1|2308338_2308860_-	3'-5' exoribonuclease	NA	A0A060D5A6	Salmonella_phage	44.5	7.9e-23
WP_158382388.1|2308881_2309046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245496.1|2311422_2312346_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.7e-124
2318108:2318158	attR	AGTGATCGGGTGAAATCGGAATCAGTGATCGGATGTGACCGGAACCAGCAC	NA	NA	NA	NA
>prophage 22
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2321395	2379284	4513140	head,transposase,plate,tail,capsid	Enterobacteria_phage(38.89%)	42	NA	NA
WP_025243834.1|2321395_2322319_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_081742990.1|2322358_2323417_+	hypothetical protein	NA	A0A218M4H2	Erwinia_phage	55.4	2.9e-96
WP_038470086.1|2323494_2323818_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	58.2	6.3e-23
WP_025245510.1|2323810_2324023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245511.1|2325513_2325729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245513.1|2329371_2330208_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.5	7.2e-103
WP_148297190.1|2332078_2332576_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	57.1	2.4e-45
WP_025245515.1|2332575_2332776_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	7.9e-16
WP_025245516.1|2332766_2333069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382394.1|2333594_2333768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081742992.1|2333949_2334141_+	peptidase	NA	NA	NA	NA	NA
WP_025245518.1|2334172_2334637_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	61.0	9.4e-52
WP_025245519.1|2334633_2335272_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.2	1.6e-54
WP_025245520.1|2335845_2336214_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	63.5	8.2e-35
WP_025245521.1|2336200_2337100_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	65.6	6.4e-97
WP_025245522.1|2337092_2337707_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	62.3	3.4e-65
WP_162149700.1|2338717_2339206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081742993.1|2339287_2340295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245526.1|2340365_2341403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081742994.1|2341584_2342502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244030.1|2342526_2343735_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_148297066.1|2343642_2344212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245529.1|2344211_2344574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245530.1|2344668_2345592_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	9.7e-125
WP_025245531.1|2345656_2345983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245534.1|2351683_2351878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297067.1|2351945_2353133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382396.1|2353246_2353576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081742996.1|2353764_2354235_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_025245536.1|2354456_2358344_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.9	9.6e-49
WP_025245539.1|2359526_2359841_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_025245540.1|2362480_2362906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245541.1|2365376_2366909_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_025245542.1|2366919_2368305_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_025245543.1|2368234_2369119_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025245544.1|2370679_2371603_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	4.4e-125
WP_025243865.1|2371721_2372645_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025245546.1|2373052_2374264_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	5.3e-46
WP_148297068.1|2376091_2376664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882191.1|2376647_2377334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245548.1|2377755_2378223_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_025244151.1|2378360_2379284_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
>prophage 23
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2392465	2410202	4513140	transposase	Cronobacter_phage(25.0%)	14	NA	NA
WP_025245556.1|2392465_2394718_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.3	3.8e-138
WP_025245557.1|2395741_2396503_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.3	8.0e-16
WP_025243926.1|2396972_2397896_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_025245559.1|2397974_2399183_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_071882194.1|2399207_2400074_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	45.4	9.6e-58
WP_148297069.1|2400051_2400468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081743000.1|2400477_2401962_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.8	2.1e-153
WP_025245561.1|2401931_2402354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245562.1|2402350_2402692_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	56.6	2.7e-24
WP_025245563.1|2402669_2403854_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	66.0	2.8e-145
WP_025245564.1|2404412_2406074_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	55.3	2.1e-101
WP_025245565.1|2406114_2407263_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.6	8.9e-43
WP_081743001.1|2407394_2407511_+	hypothetical protein	NA	Q2A0A8	Sodalis_phage	70.3	7.8e-08
WP_025245566.1|2408735_2410202_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	60.6	1.0e-144
>prophage 24
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2482882	2557224	4513140	transposase,tRNA	Acidithiobacillus_phage(14.29%)	55	NA	NA
WP_025245619.1|2482882_2484157_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.9	3.1e-81
WP_025245620.1|2484316_2484967_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_025245621.1|2485028_2485349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245622.1|2486850_2487318_+	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
WP_025245623.1|2487395_2487830_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_025245624.1|2489099_2489507_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_025245625.1|2489637_2490342_+	ribonuclease T	NA	NA	NA	NA	NA
WP_025245626.1|2490646_2490994_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_162149701.1|2491398_2491707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162149709.1|2491828_2492260_+	C40 family peptidase	NA	A0A2H4PI41	Streptomyces_phage	38.9	9.1e-17
WP_148297070.1|2492472_2492562_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_025245628.1|2492783_2493803_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	27.1	2.8e-24
WP_025245629.1|2495475_2496093_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_025245632.1|2497832_2499239_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_025243834.1|2499785_2500709_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245633.1|2500859_2501096_+	major outer membrane lipoprotein	NA	K4I3S5	Salmonella_phage	67.1	5.1e-06
WP_025245634.1|2501600_2501846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245635.1|2501898_2503107_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_051419684.1|2504077_2505628_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	3.9e-102
WP_025245638.1|2507021_2507438_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_025245639.1|2507462_2508686_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	39.1	1.2e-85
WP_025245640.1|2508682_2509969_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_025245641.1|2509943_2510690_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	8.4e-10
WP_025245642.1|2510752_2512258_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_025245643.1|2512271_2512646_-	Fe-S cluster assembly scaffold SufA	NA	NA	NA	NA	NA
WP_148297071.1|2513539_2513851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297072.1|2514093_2514327_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_025245646.1|2517568_2518669_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_025245652.1|2522715_2523537_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_148297073.1|2523641_2524730_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	41.9	3.9e-56
WP_025245653.1|2524982_2525564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245654.1|2525609_2525963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245655.1|2526162_2526912_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	36.3	1.1e-36
WP_025245656.1|2526923_2528474_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	3.9e-102
WP_025245657.1|2530144_2531158_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_025245658.1|2531179_2531638_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	40.2	3.2e-12
WP_025245659.1|2531654_2532113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245660.1|2532116_2532662_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	40.2	7.2e-11
WP_025245661.1|2532707_2533223_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_071882200.1|2533485_2533899_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_011411244.1|2534580_2534877_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_025245664.1|2534881_2537269_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_025245665.1|2537284_2538268_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	41.8	1.2e-32
WP_148296353.1|2538393_2538459_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_025245666.1|2538556_2538913_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_025245667.1|2538956_2539154_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071882016.1|2539226_2539769_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	9.7e-16
WP_025245669.1|2539772_2541701_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.0	4.2e-130
WP_025245672.1|2543002_2543881_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_148297074.1|2544236_2546102_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.1	6.1e-33
WP_025245674.1|2546317_2548003_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_025245675.1|2548099_2549023_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	5.7e-125
WP_025245678.1|2550460_2551333_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_025245680.1|2552712_2553054_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025244030.1|2556015_2557224_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
>prophage 25
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2563459	2647650	4513140	transposase,tRNA,integrase	Escherichia_phage(33.33%)	56	2618295:2618310	2650049:2650064
WP_025245685.1|2563459_2564383_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.3	3.4e-122
WP_025245686.1|2564576_2565530_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_025245687.1|2565677_2566103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245688.1|2568753_2569068_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_081743008.1|2574371_2574842_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_158382400.1|2574974_2575628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051419700.1|2576166_2577159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245689.1|2578745_2578994_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_148297075.1|2583477_2583981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245691.1|2583980_2585285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382402.1|2585466_2587533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297076.1|2587619_2588108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297077.1|2588072_2588993_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	86.7	1.5e-125
WP_148297078.1|2589778_2590765_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_025245695.1|2590823_2591501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245696.1|2592174_2592459_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.2	1.4e-05
WP_025243834.1|2592500_2593424_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245697.1|2593587_2593839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245698.1|2593875_2594478_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	43.8	5.3e-39
WP_025245699.1|2594506_2595211_-	hypothetical protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	46.8	7.8e-42
WP_025245700.1|2595292_2595487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245701.1|2595552_2596023_+	hypothetical protein	NA	Q3LZQ4	Bacteriophage	93.0	6.2e-19
WP_081743117.1|2597457_2598141_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	35.6	7.4e-21
WP_025245703.1|2598298_2598823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297081.1|2598758_2599286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245705.1|2601750_2602032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245706.1|2602109_2603318_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	6.9e-46
WP_025243834.1|2604136_2605060_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_158382404.1|2607270_2607420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245708.1|2607446_2608370_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.1e-125
WP_158382406.1|2608362_2610177_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.2	4.8e-152
WP_071882202.1|2610380_2610638_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	58.8	7.3e-22
WP_025243983.1|2610911_2611835_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_025245711.1|2611861_2612464_+	transcriptional regulator	NA	A0A2D1GNR8	Pseudomonas_phage	38.6	2.6e-17
WP_025245712.1|2612556_2613765_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
2618295:2618310	attL	TGGCGATGCTGGGCGC	NA	NA	NA	NA
WP_025245714.1|2619172_2620027_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	37.7	7.8e-44
WP_025245715.1|2620069_2620819_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_025245716.1|2621063_2621912_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_025245717.1|2621911_2622994_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	43.5	4.8e-06
WP_025245718.1|2623019_2624282_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_025245719.1|2624505_2625126_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_025245720.1|2625125_2625983_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_025245721.1|2626102_2627050_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.9	1.0e-44
WP_025245722.1|2627370_2627649_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_025245723.1|2627889_2628474_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_025245724.1|2628588_2629680_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_025245725.1|2631506_2634899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081743012.1|2635448_2635700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245727.1|2636024_2636684_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025245728.1|2636680_2637025_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_051419708.1|2637328_2637865_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245729.1|2637911_2639369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245730.1|2639672_2640272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038470154.1|2640452_2640686_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.1	5.8e-18
WP_158382408.1|2643689_2643854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419710.1|2647422_2647650_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	53.5	4.5e-15
2650049:2650064	attR	GCGCCCAGCATCGCCA	NA	NA	NA	NA
>prophage 26
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2660605	2735365	4513140	transposase,protease	uncultured_virus(16.67%)	47	NA	NA
WP_025245746.1|2660605_2662156_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.0	8.1e-100
WP_025245747.1|2662167_2662917_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.0e-39
WP_025245748.1|2663107_2664316_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_148297083.1|2664395_2664605_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_025245749.1|2664809_2665616_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_025245750.1|2668191_2669064_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.6	5.2e-35
WP_148296350.1|2671310_2671370_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_038468781.1|2671538_2672426_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_025245752.1|2672478_2673099_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_025245753.1|2673571_2674459_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_025245754.1|2676334_2677381_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.5	9.0e-18
WP_025245755.1|2677856_2678108_-	YciN family protein	NA	NA	NA	NA	NA
WP_025245756.1|2678527_2681116_+	type I DNA topoisomerase	NA	A0A1S5V180	Saudi_moumouvirus	34.5	2.7e-87
WP_025245757.1|2681314_2682289_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_025245760.1|2685997_2686453_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025245761.1|2686644_2687244_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	1.1e-39
WP_025245762.1|2687505_2688264_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_025245763.1|2688501_2688819_+	LapA family protein	NA	NA	NA	NA	NA
WP_025245764.1|2688825_2689995_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_025245765.1|2690135_2690888_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_148297191.1|2691275_2691428_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_025245766.1|2691708_2692395_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_025245768.1|2692886_2693906_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_025245769.1|2694042_2695977_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_025245770.1|2701473_2702262_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_025245771.1|2702447_2703260_-	peptide ABC transporter ATP-binding protein SapF	NA	NA	NA	NA	NA
WP_025245772.1|2704256_2705147_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_025245773.1|2705133_2706099_-	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_025245774.1|2706095_2707685_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_025245775.1|2712873_2713218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245777.1|2714455_2714746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743013.1|2715947_2716163_+	hypothetical protein	NA	A3E2H9	Sodalis_phage	93.0	2.5e-28
WP_025245780.1|2716155_2717160_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	90.1	1.1e-140
WP_051419720.1|2717243_2717540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081743014.1|2718793_2719759_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	26.8	1.2e-11
WP_025244030.1|2720191_2721400_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245782.1|2721759_2722689_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	50.3	1.6e-71
WP_158382410.1|2724751_2724919_-	hypothetical protein	NA	A0A2D1GNH1	Pseudomonas_phage	49.1	1.9e-07
WP_025243834.1|2724977_2725901_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_148297084.1|2726552_2726834_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	47.1	2.8e-06
WP_025245784.1|2727201_2727843_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_025245785.1|2727958_2729434_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	1.8e-80
WP_025245786.1|2729758_2730616_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245787.1|2730784_2732227_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_148297085.1|2732282_2732927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244160.1|2733068_2733992_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025245789.1|2734156_2735365_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
>prophage 27
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2746870	2815615	4513140	transposase,tRNA	Escherichia_phage(29.41%)	55	NA	NA
WP_025243834.1|2746870_2747794_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245799.1|2747854_2748082_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_025245800.1|2748354_2748762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245801.1|2748789_2749203_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148297087.1|2749681_2750041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382412.1|2750396_2750546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243926.1|2750610_2751534_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
WP_051419725.1|2751718_2751940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245802.1|2753025_2753673_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_025245803.1|2753814_2755032_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_025245804.1|2755311_2755896_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_025245805.1|2755913_2756936_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_025245806.1|2758277_2759819_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_025245807.1|2759917_2761648_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	32.4	5.9e-83
WP_025245808.1|2762351_2762912_+	VOC family protein	NA	NA	NA	NA	NA
WP_025245809.1|2764106_2764865_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_025245810.1|2765140_2766112_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_025245811.1|2766932_2767328_-	membrane protein	NA	NA	NA	NA	NA
WP_025245812.1|2767435_2768254_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	66.1	4.4e-44
WP_025245813.1|2768329_2768899_-	hydrolase	NA	NA	NA	NA	NA
WP_025245814.1|2769267_2771058_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	6.5e-08
WP_025245815.1|2771057_2771498_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_025245816.1|2771521_2772265_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025245817.1|2772308_2772830_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.6	6.9e-11
WP_025245818.1|2774509_2775295_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_025245819.1|2775291_2776050_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	27.2	1.7e-13
WP_071882306.1|2776123_2777095_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_025245821.1|2777107_2778433_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	3.7e-16
WP_025245822.1|2778533_2779496_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_081743016.1|2781789_2782572_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_025245824.1|2783107_2783518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244030.1|2783578_2784787_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_148297088.1|2786921_2787257_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_025243865.1|2787298_2788222_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025245827.1|2788798_2789005_-	protein DsrB	NA	NA	NA	NA	NA
WP_025245828.1|2789381_2789615_+	YodD family protein	NA	NA	NA	NA	NA
WP_025245829.1|2790105_2790918_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_025245830.1|2792338_2792734_+	helix-turn-helix transcriptional regulator	NA	D0R0F8	Streptococcus_phage	40.4	6.6e-14
WP_162149703.1|2794947_2795118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743017.1|2795545_2795779_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	57.1	8.3e-17
WP_025245832.1|2796028_2797078_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_025245833.1|2797393_2797693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038468801.1|2798038_2798200_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_071882308.1|2798354_2798519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245834.1|2798817_2799138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243834.1|2799235_2800159_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245835.1|2800223_2800775_-	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_081743018.1|2803015_2804569_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.9	5.1e-102
WP_025245838.1|2805855_2806764_-	cation transporter	NA	NA	NA	NA	NA
WP_148297089.1|2807560_2807842_+	DUF1090 family protein	NA	NA	NA	NA	NA
WP_025245839.1|2807941_2808133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245840.1|2808381_2809305_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	5.7e-125
WP_025245841.1|2810870_2811617_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_025245842.1|2813303_2814053_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	4.6e-40
WP_081743019.1|2814064_2815615_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	2.7e-103
>prophage 28
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	2850754	3009962	4513140	head,transposase,integrase,tRNA,lysis,capsid	Pseudomonas_phage(16.67%)	102	2867183:2867238	3004824:3004912
WP_025245870.1|2850754_2852305_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	3.5e-103
WP_025245871.1|2852316_2853066_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	4.6e-40
WP_025244030.1|2853826_2855035_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245874.1|2856637_2857561_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.7e-125
WP_038468823.1|2859089_2859632_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_025245878.1|2859723_2860620_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_025245879.1|2860717_2861158_+	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_158382416.1|2861157_2861325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419748.1|2861334_2861916_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_025245880.1|2861915_2862119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245881.1|2862768_2863782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297092.1|2865022_2866195_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
2867183:2867238	attL	CAATCGCCCTGATAGGGAGGAAGTCGTCACAAATTTCGGATTTATTCAACAAAGCG	NA	NA	NA	NA
WP_158382418.1|2867314_2867647_-	hypothetical protein	NA	NA	NA	NA	NA
2867183:2867238	attL	CAATCGCCCTGATAGGGAGGAAGTCGTCACAAATTTCGGATTTATTCAACAAAGCG	NA	NA	NA	NA
WP_025245883.1|2867734_2868052_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_025245884.1|2868376_2869525_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_025245885.1|2876580_2877729_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_025245886.1|2877920_2878925_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_038468826.1|2878948_2879722_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_025245888.1|2879854_2881228_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_025245889.1|2881299_2882034_-	glutathione peroxidase	NA	M1I839	Pelagibacter_phage	52.4	5.1e-36
WP_025245890.1|2882177_2883095_+	DNA-binding transcriptional regulator OxyR	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	4.2e-11
WP_025245891.1|2883077_2884475_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_025245892.1|2884719_2885364_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_025245893.1|2885367_2885634_+	DUF1422 family protein	NA	NA	NA	NA	NA
WP_025245894.1|2885735_2886848_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_025245897.1|2888931_2889804_+	glutamate racemase	NA	NA	NA	NA	NA
WP_038468830.1|2893464_2893815_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	50.0	6.9e-23
WP_038468832.1|2895198_2895810_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	34.4	8.6e-21
WP_025245903.1|2895809_2896238_-	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	44.3	2.6e-24
WP_025245904.1|2896240_2897143_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	57.9	5.2e-99
WP_051419750.1|2897580_2897889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051419752.1|2897860_2898526_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	47.0	2.4e-32
WP_038468835.1|2899509_2899770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382420.1|2899800_2900820_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	45.7	2.3e-74
WP_025245905.1|2900833_2901397_-	DUF935 family protein	NA	L7P7P3	Pseudomonas_phage	35.6	1.8e-17
WP_051419756.1|2901347_2903045_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	50.9	1.7e-146
WP_148297192.1|2903107_2903341_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	61.0	1.5e-13
WP_025245907.1|2903343_2904267_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.3	1.3e-121
WP_025245908.1|2904852_2906061_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025245910.1|2908718_2909300_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.6e-32
WP_025245911.1|2911048_2912158_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_025245912.1|2912341_2914381_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.5	3.3e-24
WP_051419758.1|2914577_2915558_+	MFS transporter	NA	NA	NA	NA	NA
WP_051419761.1|2915803_2917354_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	4.6e-103
WP_025245914.1|2917365_2918115_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	2.3e-39
WP_025245915.1|2918242_2919451_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.1e-46
WP_025245917.1|2920109_2921009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245918.1|2920999_2922208_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.1e-46
WP_148297094.1|2922334_2923204_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_025245920.1|2923281_2924211_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_025245921.1|2926289_2927090_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_025245923.1|2927764_2928688_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.6e-125
WP_025245926.1|2930041_2930965_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.3e-125
WP_025243834.1|2931508_2932432_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025245928.1|2934356_2935397_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_148297095.1|2935890_2936094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245929.1|2936288_2936702_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025243926.1|2936743_2937667_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.0e-125
2936688:2936743	attR	CGCTTTGTTGAATAAATCCGAAATTTGTGACGACTTCCTCCCTATCAGGGCGATTG	NA	NA	NA	NA
WP_025245930.1|2937967_2938195_+	hypothetical protein	NA	NA	NA	NA	NA
2936688:2936743	attR	CGCTTTGTTGAATAAATCCGAAATTTGTGACGACTTCCTCCCTATCAGGGCGATTG	NA	NA	NA	NA
WP_025245932.1|2940083_2941247_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_025245933.1|2941305_2941971_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.2	1.0e-51
WP_025245934.1|2943285_2944227_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245935.1|2944136_2944988_+	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	35.6	5.2e-08
WP_025245936.1|2945982_2947956_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	28.9	4.6e-07
WP_081743024.1|2948928_2950479_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	1.8e-102
WP_025245939.1|2950490_2951240_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	6.0e-40
WP_025245940.1|2951277_2951898_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.1	9.1e-10
WP_025245941.1|2954951_2955839_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025245942.1|2955928_2956813_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.2	5.6e-21
WP_025245943.1|2958655_2959594_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_025245944.1|2959590_2960673_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_025245945.1|2961052_2962330_+	sugar efflux transporter	NA	NA	NA	NA	NA
WP_025245946.1|2963361_2964831_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.4	1.8e-40
WP_081743025.1|2964843_2965368_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_148297096.1|2965636_2965822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245947.1|2966997_2967573_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WF62	Clostridium_phage	38.7	2.1e-13
WP_148297097.1|2968107_2968449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051419772.1|2968488_2968935_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_025245949.1|2970902_2971997_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_025245950.1|2973022_2974633_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-21
WP_025245951.1|2974786_2975134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051419774.1|2975567_2976746_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_025245953.1|2978148_2978715_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	59.3	2.4e-41
WP_025245954.1|2979127_2981170_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.3	2.4e-176
WP_025245955.1|2981181_2982111_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	50.7	3.6e-71
WP_148297098.1|2982122_2982383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382422.1|2982420_2982612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297099.1|2987364_2987916_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	53.8	2.2e-44
WP_025245959.1|2988063_2988894_-	iron permease	NA	NA	NA	NA	NA
WP_025245960.1|2990327_2991035_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_025245961.1|2993021_2993306_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_025245962.1|2993545_2994091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297100.1|2994160_2994439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025245968.1|2998381_2998609_+	YejL family protein	NA	NA	NA	NA	NA
WP_025245969.1|3000912_3001692_+	antirepressor	NA	B6SD57	Bacteriophage	40.8	4.1e-52
WP_071882213.1|3001925_3002750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419787.1|3003079_3003433_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	8.5e-21
WP_025245971.1|3003512_3004436_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.0	9.1e-123
WP_051419788.1|3004525_3004795_-	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	44.3	2.3e-10
WP_025245974.1|3006246_3006498_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	52.4	1.4e-17
WP_025245975.1|3006499_3007630_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.2e-172
WP_025245976.1|3007679_3009962_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	66.2	1.8e-297
>prophage 29
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3060096	3183424	4513140	transposase,tRNA	Escherichia_phage(29.03%)	83	NA	NA
WP_025243834.1|3060096_3061020_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_162149704.1|3063579_3063726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246008.1|3063764_3064364_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	35.4	3.8e-05
WP_025246010.1|3065448_3066651_+	acetate kinase	NA	NA	NA	NA	NA
WP_038468874.1|3066725_3068861_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_025246014.1|3071209_3072112_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_038468881.1|3072124_3072898_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	26.6	5.8e-06
WP_081743027.1|3074678_3075290_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_038468887.1|3075368_3076292_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	2.6e-125
WP_148297105.1|3076562_3077669_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.4	1.0e-35
WP_025246020.1|3078062_3078632_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_025246021.1|3078758_3080276_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.4	2.7e-87
WP_025246022.1|3080309_3080798_-	colicin V production protein	NA	NA	NA	NA	NA
WP_025246023.1|3081070_3081715_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_025246024.1|3081704_3082976_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_025246025.1|3083060_3083981_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_025246027.1|3084596_3085346_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.0e-39
WP_025246029.1|3087410_3088223_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_025246030.1|3089449_3090577_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.5	5.9e-15
WP_025246031.1|3092088_3093297_-	MFS transporter	NA	NA	NA	NA	NA
WP_025246032.1|3093476_3094688_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_025246033.1|3096737_3097013_-	YfcL family protein	NA	NA	NA	NA	NA
WP_025246034.1|3097604_3098462_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_025246035.1|3099356_3100442_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.4	8.3e-83
WP_025246036.1|3100521_3101454_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_025246037.1|3101619_3102150_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_025246038.1|3102227_3102863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246039.1|3103059_3103923_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	3.2e-114
WP_081743028.1|3107892_3108189_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_025246045.1|3108550_3109309_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_025246046.1|3110513_3110981_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_025246047.1|3110980_3111535_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_025246048.1|3113498_3113972_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_025246049.1|3113968_3114196_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_025246050.1|3114192_3114909_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_025246051.1|3115630_3116269_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	28.2	1.3e-11
WP_025246052.1|3116551_3117526_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	63.9	6.3e-98
WP_051419806.1|3118303_3118495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246054.1|3118980_3120192_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	9.0e-46
WP_025246056.1|3121126_3122335_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	7.6e-45
WP_025243834.1|3123651_3124575_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025243865.1|3124826_3125750_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025246057.1|3126059_3126332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382430.1|3126853_3127030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246058.1|3127645_3129196_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	8.7e-102
WP_038468903.1|3129207_3129450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246059.1|3130219_3130408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246060.1|3130577_3131786_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_025246061.1|3132276_3132594_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_148297194.1|3132903_3132978_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_038468906.1|3134508_3134727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246063.1|3134938_3135709_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	23.1	4.0e-07
WP_025246064.1|3137601_3138840_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_025246065.1|3139216_3140401_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_025246066.1|3140731_3142138_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025246068.1|3143944_3144868_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	4.4e-125
WP_081743029.1|3144911_3145235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246070.1|3147009_3148245_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038468914.1|3149529_3149979_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246071.1|3150359_3150767_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_148297106.1|3151103_3151472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246073.1|3151774_3152800_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158382432.1|3152804_3153890_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_071882218.1|3153971_3154481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246074.1|3154477_3155587_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025246075.1|3155606_3156476_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025246076.1|3156772_3156988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246077.1|3157010_3159035_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	48.8	7.5e-138
WP_025246078.1|3159290_3160304_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_025246079.1|3160539_3161463_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	9.7e-125
WP_051419812.1|3161588_3162362_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_025246083.1|3166526_3167123_+	hypothetical protein	NA	G9L666	Escherichia_phage	48.5	2.0e-46
WP_148297107.1|3167202_3168405_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	9.0e-46
WP_025246085.1|3168492_3168942_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	77.8	1.0e-15
WP_025246086.1|3169219_3169486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246087.1|3169576_3170002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382434.1|3171878_3172097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246090.1|3173106_3174018_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.9	2.7e-42
WP_051419816.1|3174072_3174582_+	hypothetical protein	NA	A0A2H4JCY7	uncultured_Caudovirales_phage	46.8	7.6e-39
WP_025246092.1|3176888_3178097_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_038468918.1|3178651_3179575_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	4.4e-125
WP_025246094.1|3180529_3180871_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	1.3e-18
WP_025246095.1|3180949_3183424_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	71.6	0.0e+00
>prophage 30
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3214761	3278176	4513140	transposase	Escherichia_phage(37.5%)	55	NA	NA
WP_025246119.1|3214761_3215685_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	7.4e-125
WP_025246121.1|3217476_3217890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468935.1|3217997_3218261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297110.1|3218280_3219579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246123.1|3219553_3219838_+	F-box protein	NA	NA	NA	NA	NA
WP_025246124.1|3220060_3221560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246125.1|3221549_3221765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246126.1|3221761_3222235_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_038468947.1|3222620_3222806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246127.1|3222916_3223843_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.4	6.5e-121
WP_025246128.1|3223833_3225042_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	5.3e-46
WP_025246129.1|3225208_3225604_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_025244443.1|3227053_3227977_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_081743033.1|3228068_3230051_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_148296347.1|3230523_3230610_-	protein YpfM	NA	NA	NA	NA	NA
WP_025246134.1|3231469_3231853_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_025246135.1|3231854_3232982_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_025246136.1|3235061_3235811_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	5.1e-39
WP_081743034.1|3235822_3237373_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	2.3e-102
WP_071882221.1|3237565_3237700_+	YpfN family protein	NA	NA	NA	NA	NA
WP_148297112.1|3237707_3239561_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025246139.1|3239568_3240021_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_025246140.1|3240980_3241694_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	35.7	2.6e-37
WP_025246141.1|3241762_3242812_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_025246142.1|3242828_3243707_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_025246143.1|3243852_3244428_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_025246144.1|3244424_3244892_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_025246145.1|3244985_3246464_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071882222.1|3246550_3247288_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_025246147.1|3247328_3248612_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.4	7.0e-65
WP_025246148.1|3248668_3249295_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025246149.1|3249526_3250564_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.3e-72
WP_025246150.1|3250563_3251202_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.2	2.1e-22
WP_051419826.1|3251470_3252286_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.1	5.9e-09
WP_148297114.1|3252302_3253313_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148297115.1|3253382_3253604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382438.1|3253618_3253768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297116.1|3255133_3255379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246156.1|3255672_3256059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246157.1|3256243_3258313_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_025243834.1|3258394_3259318_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_038470339.1|3259380_3260931_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_025246160.1|3261259_3261451_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	54.2	5.4e-06
WP_025246161.1|3263093_3263840_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025246162.1|3265474_3266092_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_051419829.1|3266163_3266844_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_025246164.1|3266821_3267298_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_038468957.1|3269046_3269334_-	urease subunit beta	NA	NA	NA	NA	NA
WP_025246165.1|3269349_3269592_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_025246166.1|3270980_3271160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382440.1|3274254_3275421_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.9	1.6e-28
WP_025246170.1|3275413_3276121_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	8.2e-31
WP_148297195.1|3276140_3276239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297196.1|3276284_3276542_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_025246173.1|3277252_3278176_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	5.7e-125
>prophage 31
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3325659	3476320	4513140	transposase,tRNA	Escherichia_phage(19.44%)	114	NA	NA
WP_038468971.1|3325659_3326583_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025246206.1|3326876_3327326_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025246208.1|3328853_3330062_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025246209.1|3330370_3331120_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	6.0e-40
WP_081743040.1|3331131_3332682_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	1.0e-102
WP_025246212.1|3333454_3333790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246213.1|3333795_3334014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246214.1|3334025_3335504_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_025246215.1|3335640_3336822_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_025246216.1|3336832_3337447_-	YfgM family protein	NA	NA	NA	NA	NA
WP_025246217.1|3337460_3338735_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025246218.1|3338753_3339875_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_025246219.1|3339915_3340842_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_025246220.1|3340831_3341602_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_025246221.1|3341668_3342832_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_025246222.1|3343004_3343436_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	1.0e-20
WP_081743122.1|3343736_3344084_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_025246223.1|3344295_3345018_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_148297197.1|3345096_3346263_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.7	2.7e-31
WP_025246225.1|3346887_3348075_-	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	30.2	4.4e-29
WP_162149712.1|3348141_3348621_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_025246226.1|3349906_3350710_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_051419844.1|3351760_3352405_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_025246229.1|3352760_3354014_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.0e-100
WP_025246230.1|3354386_3354725_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_025246231.1|3354785_3356099_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.7	2.1e-08
WP_025246232.1|3356095_3356800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246236.1|3359142_3363030_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.0	7.5e-126
WP_025246237.1|3363321_3364809_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_025246238.1|3364857_3365373_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_025246239.1|3368565_3369414_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246240.1|3369421_3369916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246245.1|3372670_3373051_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_025246246.1|3373050_3373782_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_038470377.1|3373937_3374627_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_025246247.1|3374636_3375542_-	GTPase Era	NA	NA	NA	NA	NA
WP_025246248.1|3375538_3376219_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.7	6.2e-20
WP_025246249.1|3376396_3377383_-	signal peptidase I	NA	NA	NA	NA	NA
WP_025246250.1|3377398_3379198_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.8	9.0e-26
WP_025246251.1|3379364_3379766_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	41.5	8.5e-17
WP_148297117.1|3379768_3380191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246252.1|3380183_3381416_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025246253.1|3382500_3383733_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_148297118.1|3383725_3384148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743042.1|3385388_3386051_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_148297119.1|3385819_3386332_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_025246254.1|3388235_3388598_+	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_025246255.1|3388633_3389146_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_148297120.1|3390304_3390862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246257.1|3390858_3391182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081743043.1|3393008_3393800_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	47.1	6.9e-55
WP_038468978.1|3394084_3394267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246260.1|3394350_3394830_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_025246261.1|3394918_3395353_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_025244030.1|3395343_3396552_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025246262.1|3396671_3397307_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	36.9	4.0e-29
WP_081743044.1|3397318_3398869_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	3.5e-103
WP_025246264.1|3399053_3400514_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.1	7.7e-108
WP_148297121.1|3400506_3401487_+	hypothetical protein	NA	E4ZFI9	Streptococcus_phage	50.0	4.3e-06
WP_148297122.1|3401458_3402916_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_071882227.1|3403072_3403309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882228.1|3403385_3404525_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_025246265.1|3407224_3407668_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246266.1|3407664_3409353_+	MFS transporter	NA	NA	NA	NA	NA
WP_025246267.1|3409349_3410492_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_025246268.1|3410628_3411054_+	TolC family protein	NA	NA	NA	NA	NA
WP_025246269.1|3411069_3411303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246270.1|3414062_3414989_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.4	5.9e-122
WP_025246271.1|3415247_3416456_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	4.5e-45
WP_025246272.1|3419188_3420112_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.6	1.7e-121
WP_025246273.1|3420172_3420538_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025246274.1|3420885_3421341_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_025246275.1|3421829_3422168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246276.1|3422174_3422435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246277.1|3422416_3423157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162149713.1|3424303_3425071_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	61.0	3.2e-89
WP_148297124.1|3425446_3425662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246279.1|3425654_3426578_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.3	3.1e-123
WP_081743123.1|3426870_3427731_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_158382448.1|3427761_3427938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246280.1|3429782_3430310_+	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_025246281.1|3430967_3431729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025246282.1|3431841_3432138_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_025244030.1|3435477_3436686_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025243834.1|3437023_3437947_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025246286.1|3438948_3439368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038468223.1|3439407_3439728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246287.1|3441100_3441715_-	hypothetical protein	NA	Q5ULP4	Lactobacillus_virus	39.5	8.7e-05
WP_025246288.1|3441721_3442525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246289.1|3442678_3443491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743045.1|3443890_3444823_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.2	7.5e-08
WP_025246291.1|3444819_3446040_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.8	1.3e-07
WP_025246294.1|3448147_3449119_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.0	8.0e-45
WP_025246295.1|3451004_3451337_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	31.1	3.1e-09
WP_025246296.1|3453847_3454435_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_025244443.1|3455783_3456707_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_081743124.1|3456792_3457116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246301.1|3460134_3460335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246302.1|3460743_3461883_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	NA	NA	NA	NA
WP_025246303.1|3461884_3462865_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	I1TED8	Salmonella_phage	30.4	1.4e-28
WP_025246304.1|3462861_3464844_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.3	1.9e-21
WP_025246305.1|3464840_3465734_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_025246306.1|3465741_3467394_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_025246307.1|3467390_3467726_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
WP_081743125.1|3467782_3468154_+	EamA family transporter	NA	NA	NA	NA	NA
WP_148297125.1|3468129_3468585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025245002.1|3468595_3469804_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025246310.1|3469905_3470364_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_025246311.1|3470360_3471317_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_025246312.1|3471316_3472012_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_158382450.1|3472719_3472872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246313.1|3473040_3474642_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_148297126.1|3475083_3475182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246316.1|3475396_3476320_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.0	3.7e-124
>prophage 32
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3484887	3563278	4513140	transposase,tail,integrase	Escherichia_phage(40.0%)	48	3499508:3499567	3531831:3531935
WP_051420011.1|3484887_3486060_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025246325.1|3486148_3487810_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071882233.1|3488028_3488241_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	50.0	1.6e-06
WP_025246326.1|3488999_3490655_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.2	1.4e-153
WP_025246327.1|3490659_3491196_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	57.9	2.8e-47
WP_025246328.1|3491170_3491881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743048.1|3491880_3492222_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.5	1.2e-19
WP_025246329.1|3492265_3493189_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.3	1.8e-123
WP_148297127.1|3493372_3493714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246331.1|3493650_3494256_-	hypothetical protein	NA	Q37842	Escherichia_phage	33.9	9.8e-25
WP_025246332.1|3494336_3495086_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.3e-39
WP_025246334.1|3498369_3499578_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
3499508:3499567	attL	TGAGGGACTGGCGCATGGCAATGAGCCGCTTTATTATCGAGTTCGGTGACCGCCTGGACG	NA	NA	NA	NA
WP_071882234.1|3500431_3500923_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	54.4	9.0e-45
WP_025246335.1|3501147_3501501_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_025246336.1|3501623_3501908_-	RnfH family protein	NA	NA	NA	NA	NA
WP_025246337.1|3501900_3502335_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_025246338.1|3502494_3502977_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.5e-28
WP_025246339.1|3503582_3504791_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_148297198.1|3504787_3505141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246341.1|3505440_3506082_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025246342.1|3506382_3506676_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025244973.1|3506792_3507716_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.7e-125
WP_025246343.1|3508844_3509768_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	5.7e-125
WP_025246344.1|3510148_3510412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246345.1|3510784_3512233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246346.1|3512540_3513317_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_081743051.1|3520289_3520889_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_025246348.1|3521450_3522098_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_025246349.1|3523786_3524710_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	69.9	8.2e-124
WP_025244030.1|3524819_3526028_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_025246350.1|3529026_3529956_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	50.7	5.6e-72
WP_025246351.1|3530137_3531061_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	2.6e-125
WP_081743052.1|3532058_3533609_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	7.9e-103
3531831:3531935	attR	CGTCCAGGCGGTCACCGAACTCGATAATAAAGCGGCTCATTGCCATGCGCCAGTCCCTCATACTGGTTCCGGTCACATCCGATCACTGATTCCGATTTCACCCGA	NA	NA	NA	NA
WP_025246354.1|3533620_3534370_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	3.0e-39
WP_025246356.1|3535817_3536225_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	60.7	2.7e-39
WP_025243834.1|3536379_3537303_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_071882238.1|3537367_3537514_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.8	2.8e-10
WP_025246357.1|3538356_3539280_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.6	9.1e-123
WP_158382452.1|3540581_3540896_+	hypothetical protein	NA	A0A0F7L4A9	uncultured_marine_virus	44.0	4.6e-10
WP_025246358.1|3540941_3541865_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	8.8e-126
WP_025246359.1|3546438_3546771_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	31.1	3.1e-09
WP_071882239.1|3551111_3551225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246362.1|3552381_3553305_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	5.1e-126
WP_025246363.1|3553674_3553926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025244160.1|3555046_3555970_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_158382454.1|3557686_3557791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246364.1|3557975_3558380_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	48.5	3.5e-18
WP_025246366.1|3562354_3563278_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.3e-125
>prophage 33
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3575063	3657726	4513140	transposase,tRNA	Escherichia_phage(35.29%)	55	NA	NA
WP_025244301.1|3575063_3576272_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_025246376.1|3577139_3578690_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	3.9e-102
WP_158382457.1|3578723_3578900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025243865.1|3579141_3580065_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025246378.1|3580159_3580669_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_025246379.1|3580735_3581659_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	6.7e-126
WP_025246380.1|3582803_3583796_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_051419902.1|3583841_3584510_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025244160.1|3585696_3586620_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_025246382.1|3588503_3589073_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025246383.1|3589069_3589585_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_051419906.1|3591831_3592317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297199.1|3592255_3592660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382460.1|3593777_3595502_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_148297200.1|3595398_3595722_-	MFS transporter	NA	NA	NA	NA	NA
WP_051419907.1|3595722_3596631_-	MFS transporter	NA	NA	NA	NA	NA
WP_158382463.1|3596919_3598065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382465.1|3598175_3598316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382468.1|3599310_3599874_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.0	2.4e-09
WP_051419910.1|3599822_3600278_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_148297130.1|3600274_3600673_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148297131.1|3600623_3601190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246387.1|3604339_3604765_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246388.1|3605148_3605772_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.9	1.7e-19
WP_025246389.1|3605826_3606102_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038469029.1|3610842_3612228_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	87.0	1.3e-56
WP_025246391.1|3612367_3614059_+	AsmA family protein	NA	NA	NA	NA	NA
WP_025246392.1|3614111_3615053_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_025246393.1|3615089_3615473_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_025246394.1|3615426_3616329_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_025246395.1|3616384_3616972_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_025246396.1|3617249_3618557_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_025246398.1|3619191_3619965_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	25.3	2.5e-09
WP_025246399.1|3620107_3621919_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	43.5	1.8e-21
WP_025243834.1|3622287_3623211_+|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_025246400.1|3623351_3624770_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_025246401.1|3625962_3627372_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_148297133.1|3627479_3627602_+	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_051419911.1|3629257_3629746_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_025246402.1|3629915_3630560_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_025246403.1|3630961_3633748_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.7	2.5e-46
WP_025246404.1|3634164_3634788_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_025246407.1|3637298_3637814_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_025246409.1|3641003_3641576_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_025246410.1|3641765_3642797_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-31
WP_025246411.1|3642789_3643443_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_025246412.1|3643507_3644323_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_025246413.1|3645803_3647528_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_081743061.1|3647726_3649271_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	3.0e-102
WP_025246415.1|3649282_3650032_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.5e-38
WP_025246416.1|3650130_3651339_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_148297134.1|3652791_3654540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246420.1|3654618_3655560_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.3	2.3e-121
WP_038469034.1|3655697_3655949_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_025246422.1|3655992_3657726_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 34
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3672395	3872654	4513140	transposase,tRNA,protease,portal	Escherichia_phage(21.74%)	118	NA	NA
WP_025246433.1|3672395_3673751_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_025246434.1|3673770_3674625_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_025246435.1|3674634_3675396_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	9.4e-25
WP_025246436.1|3675547_3676789_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_025246437.1|3676944_3677502_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_025246438.1|3677570_3678296_-	UMP kinase	NA	NA	NA	NA	NA
WP_025246439.1|3678436_3679294_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_038469044.1|3679409_3680135_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_025246441.1|3680473_3681268_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_025246442.1|3681378_3683853_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_025246443.1|3683904_3684729_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_025246444.1|3684853_3685243_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_025246445.1|3685411_3685858_-	flavodoxin	NA	NA	NA	NA	NA
WP_025246446.1|3685880_3686666_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_025246447.1|3686658_3686979_-	YqcC family protein	NA	NA	NA	NA	NA
WP_051419912.1|3687884_3688382_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_051419913.1|3688442_3689237_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.5	2.3e-42
WP_025246448.1|3689485_3690850_+	LOG family protein	NA	NA	NA	NA	NA
WP_025246449.1|3690942_3691695_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.7	8.2e-05
WP_025246450.1|3691726_3692404_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_148297135.1|3692973_3693195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419915.1|3693184_3694477_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_025246452.1|3695931_3696681_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	1.6e-37
WP_025246453.1|3696692_3698243_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.8	8.7e-102
WP_025246454.1|3698388_3698640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246455.1|3699950_3700892_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	67.6	5.6e-120
WP_025246456.1|3701332_3702289_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_025246457.1|3702834_3703056_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_025246458.1|3707689_3708328_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246459.1|3711537_3712386_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025246460.1|3712524_3713784_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.3	1.8e-12
WP_025246461.1|3714018_3715362_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_025246462.1|3715500_3717378_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.4	3.1e-21
WP_081743126.1|3717394_3720946_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.4	2.1e-10
WP_025246464.1|3720926_3723848_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.4	2.6e-54
WP_025246465.1|3723976_3727381_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_081743063.1|3727467_3727599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246466.1|3727840_3728368_-	DUF2509 family protein	NA	NA	NA	NA	NA
WP_158382470.1|3728364_3728868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382472.1|3729149_3729353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246469.1|3729679_3730474_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	68.6	1.2e-112
WP_025246470.1|3730480_3731353_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_025246471.1|3731528_3733775_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.8	3.9e-10
WP_025246472.1|3733787_3734315_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_025243865.1|3734784_3735708_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025246473.1|3735891_3737151_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025246474.1|3737781_3738477_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_025246475.1|3738554_3739286_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	1.4e-41
WP_025246476.1|3739751_3740792_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_038469048.1|3741010_3742174_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_025246478.1|3749580_3750330_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	2.7e-40
WP_025246479.1|3752807_3753710_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158382474.1|3754165_3754702_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_025246480.1|3754901_3756170_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_025246481.1|3757234_3758392_-	MFS transporter	NA	NA	NA	NA	NA
WP_148297136.1|3758526_3759207_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025246483.1|3759321_3759519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081743127.1|3759709_3760702_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_025245285.1|3763712_3764462_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	7.8e-40
WP_025244301.1|3764632_3765841_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	9.0e-46
WP_025244865.1|3765950_3766874_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	2.6e-125
WP_025246485.1|3767748_3769452_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025246486.1|3770303_3771350_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025246487.1|3771377_3772112_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_025246488.1|3772170_3772836_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162149705.1|3772726_3773047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038469052.1|3773219_3773645_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_025246490.1|3774770_3775148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246491.1|3775353_3776565_-	SDR family oxidoreductase	NA	J3E7X8	Acanthamoeba_polyphaga_lentillevirus	28.9	4.1e-14
WP_025246492.1|3777694_3777907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246493.1|3778465_3779389_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	8.2e-124
WP_148297138.1|3779975_3780209_-	DNA adenine methylase	NA	Q9B025	Phage_GMSE-1	73.5	1.3e-25
WP_025246496.1|3781045_3781897_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	63.7	6.9e-109
WP_025246497.1|3782194_3783130_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	3.4e-125
WP_158382476.1|3783156_3784158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246499.1|3785140_3785938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246500.1|3786471_3787683_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	6.5e-44
WP_038469058.1|3788709_3790266_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.4	9.7e-101
WP_025246502.1|3790625_3791612_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_081743064.1|3791613_3792210_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025246504.1|3792212_3793136_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	5.7e-125
WP_025246505.1|3793196_3794081_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025246506.1|3794268_3794478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246358.1|3798163_3799087_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	8.8e-126
WP_025246507.1|3799539_3800070_+	gluconokinase	NA	NA	NA	NA	NA
WP_025246508.1|3800518_3801727_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	6.9e-46
WP_025246510.1|3802302_3803052_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.1	4.3e-38
WP_025246513.1|3806179_3807610_+	amino acid permease	NA	NA	NA	NA	NA
WP_025246514.1|3807962_3809234_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_025246516.1|3812513_3813263_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	7.8e-40
WP_051419377.1|3813383_3813629_-	hypothetical protein	NA	Q5ZQW7	Pseudomonas_phage	44.9	1.1e-14
WP_148297139.1|3814284_3814518_-	DNA adenine methylase	NA	Q9B025	Phage_GMSE-1	72.1	1.1e-24
WP_025246520.1|3818835_3819075_-	ANR family transcriptional regulator	NA	A3E2K3	Sodalis_phage	87.0	1.7e-25
WP_025246521.1|3819283_3820489_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_051419924.1|3822898_3823279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038469069.1|3824619_3825270_+	peptidyl-arginine deiminase	NA	NA	NA	NA	NA
WP_071882253.1|3825300_3825600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382478.1|3825674_3825974_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	63.5	7.2e-29
WP_025243834.1|3826015_3826939_-|transposase	IS5-like element ISSoEn1 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	8.8e-126
WP_158382480.1|3827003_3828005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038469078.1|3830670_3831678_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.1	1.1e-65
WP_071882318.1|3832318_3832531_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	5.4e-23
WP_148297140.1|3836466_3836982_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	54.5	1.5e-50
WP_025246528.1|3838311_3839472_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025246529.1|3840620_3841379_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	2.3e-31
WP_158382482.1|3848707_3848965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246530.1|3850608_3851892_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_025246531.1|3852570_3852843_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	1.6e-19
WP_025246532.1|3853033_3853624_-	YjaG family protein	NA	NA	NA	NA	NA
WP_025246533.1|3853681_3854377_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.0	2.2e-20
WP_025246534.1|3855502_3856270_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_025246535.1|3857195_3859022_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025246536.1|3859011_3859662_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_025246537.1|3860383_3860584_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_038469085.1|3862060_3862819_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	60.3	2.7e-88
WP_025246541.1|3863714_3864638_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	1.7e-124
WP_081743066.1|3868996_3869608_-	hypothetical protein	NA	A0A1S6KZW9	Salmonella_phage	45.7	1.6e-38
WP_025246544.1|3871622_3872654_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	63.6	5.0e-130
>prophage 35
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3878327	3945989	4513140	transposase,tail	Salmonella_phage(19.05%)	54	NA	NA
WP_025246547.1|3878327_3879197_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	47.1	4.5e-63
WP_081743067.1|3879207_3879780_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.8	7.3e-30
WP_025246549.1|3879776_3880034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246550.1|3880115_3880328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148297143.1|3880358_3880682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246551.1|3880644_3880830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246552.1|3881141_3882350_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.7e-44
WP_025246553.1|3882588_3883338_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	2.5e-38
WP_081743068.1|3883349_3884900_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	9.3e-104
WP_025246555.1|3885205_3886414_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.0e-44
WP_025246556.1|3886486_3887455_+	hypothetical protein	NA	A0A2H4JE61	uncultured_Caudovirales_phage	27.6	1.5e-14
WP_025246557.1|3887461_3887926_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	67.4	3.1e-47
WP_025246558.1|3887922_3889014_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	58.5	2.1e-110
WP_071882255.1|3889085_3889307_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	62.5	1.2e-20
WP_025246559.1|3889501_3893722_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	5.3e-69
WP_025246560.1|3893812_3897841_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0K9	Chrysochromulina_ericina_virus	33.3	2.0e-25
WP_025246561.1|3898165_3898534_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_025246562.1|3898600_3899101_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_025246563.1|3899410_3900115_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_025246564.1|3900118_3900547_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_009639145.1|3900695_3901241_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_025246565.1|3901242_3901626_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_025246566.1|3901889_3903074_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	26.6	1.1e-06
WP_025246567.1|3904093_3905044_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.3e-28
WP_025246568.1|3905471_3906173_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_025246569.1|3906281_3907241_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_025246570.1|3907237_3908272_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_148297145.1|3908392_3909211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246572.1|3913255_3913795_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_025246573.1|3913808_3915260_-	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_025246574.1|3915303_3915921_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	1.3e-19
WP_025246575.1|3917373_3918075_-	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_025246576.1|3918125_3919610_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_025246577.1|3919791_3920283_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_025246578.1|3920401_3921172_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.1	1.9e-25
WP_025246579.1|3921175_3921739_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_025246580.1|3921742_3922009_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_025246581.1|3922059_3923694_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	27.4	2.2e-39
WP_025246582.1|3923690_3924299_-	membrane protein	NA	NA	NA	NA	NA
WP_025246583.1|3924311_3925070_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_025246584.1|3925141_3926752_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	60.9	6.4e-07
WP_025246585.1|3926818_3927343_-	DedA family protein	NA	NA	NA	NA	NA
WP_025246586.1|3927541_3928309_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_025246587.1|3928558_3929383_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_025246592.1|3933377_3934238_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_158382484.1|3934314_3934491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246593.1|3935342_3936224_-	DMT family transporter	NA	NA	NA	NA	NA
WP_025246594.1|3936405_3938154_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_038469101.1|3938296_3938563_+	DUF2756 domain-containing protein	NA	NA	NA	NA	NA
WP_158382486.1|3939362_3939803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382488.1|3939827_3940586_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.4	2.2e-21
WP_081743070.1|3941372_3942260_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_038469104.1|3942342_3943551_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_081743071.1|3944438_3945989_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.0	3.5e-103
>prophage 36
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	3957747	4055057	4513140	transposase,tRNA	uncultured_virus(30.0%)	54	NA	NA
WP_025246612.1|3957747_3958956_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.0e-44
WP_025246614.1|3960390_3961602_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	2.0e-45
WP_025246616.1|3962436_3963045_-	repressor LexA	NA	U5P451	Shigella_phage	42.2	4.0e-10
WP_148297146.1|3963063_3963438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246617.1|3963490_3964711_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025246618.1|3965137_3967597_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_025246619.1|3967730_3968603_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_025246620.1|3968618_3969065_-	chorismate lyase	NA	NA	NA	NA	NA
WP_081743129.1|3969300_3969534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246624.1|3972708_3973464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246625.1|3973460_3974108_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_051420013.1|3974180_3974402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246627.1|3974988_3976638_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_025246629.1|3980427_3981420_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	1.9e-25
WP_025246630.1|3982229_3983051_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025246631.1|3984011_3985013_-	solute-binding protein	NA	NA	NA	NA	NA
WP_025246632.1|3987490_3988240_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.3	7.8e-40
WP_025246633.1|3990045_3990813_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025246634.1|3990988_3991459_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_025246635.1|3991448_3991760_-	Dabb family protein	NA	NA	NA	NA	NA
WP_025246636.1|3991847_3993056_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_025246638.1|3995615_3996053_-	molecular chaperone	NA	NA	NA	NA	NA
WP_025246640.1|3997098_3997503_-	molecular chaperone	NA	NA	NA	NA	NA
WP_025246641.1|3997832_3998750_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.6	2.4e-123
WP_148297147.1|3999371_3999704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246643.1|4001960_4002257_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_038469127.1|4002280_4003246_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_025246644.1|4004415_4005858_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_025246645.1|4005847_4006090_-	YhdT family protein	NA	NA	NA	NA	NA
WP_025246646.1|4007310_4008660_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_025246647.1|4008671_4009136_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_025246648.1|4009157_4009610_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_025246649.1|4009852_4010452_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_011410020.1|4013855_4014899_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_025246650.1|4014993_4016055_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_025246651.1|4016051_4016540_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_025246652.1|4017133_4018603_+	ribonuclease G	NA	NA	NA	NA	NA
WP_025246653.1|4018688_4022090_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_025246654.1|4023676_4024591_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_025246655.1|4024922_4025126_+	AaeX family protein	NA	NA	NA	NA	NA
WP_025246656.1|4025133_4026060_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_025246657.1|4026074_4028033_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_025246658.1|4029688_4029970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246659.1|4030169_4030718_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_025246660.1|4032559_4032946_+	cytochrome b562	NA	NA	NA	NA	NA
WP_025246661.1|4032961_4033870_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_025246662.1|4036011_4037295_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_025246663.1|4037302_4038403_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_081743130.1|4041389_4041914_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_025246665.1|4042547_4042826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246667.1|4047984_4048914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148297148.1|4049044_4049794_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.6	7.1e-25
WP_025246669.1|4052745_4053495_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	4.6e-40
WP_025246670.1|4053506_4055057_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.4	7.4e-101
>prophage 37
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	4083609	4145979	4513140	transposase	Escherichia_phage(41.67%)	53	NA	NA
WP_025243865.1|4083609_4084533_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025246689.1|4084710_4085217_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025243865.1|4085492_4086416_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_025246690.1|4086715_4087372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882266.1|4087227_4087806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158382494.1|4087780_4087918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025420828.1|4087921_4088176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246692.1|4088307_4088532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246693.1|4088528_4089260_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_158382497.1|4089290_4089863_+	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
WP_038469141.1|4089825_4090497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246696.1|4090563_4091166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246697.1|4091181_4091523_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_025246698.1|4093159_4094317_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025246699.1|4094990_4095200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246700.1|4095210_4096341_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.4	2.5e-34
WP_025246701.1|4096538_4097288_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.0	1.0e-39
WP_081743080.1|4098949_4099486_+	phosphotransferase	NA	NA	NA	NA	NA
WP_051419950.1|4099896_4100730_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_025246704.1|4100726_4101224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246705.1|4101501_4101864_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.0	2.9e-32
WP_025246706.1|4104527_4104878_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_025246708.1|4106806_4107727_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_025246709.1|4107758_4109894_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_025246710.1|4109930_4110422_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_025246711.1|4110542_4112090_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.0	1.7e-09
WP_158382499.1|4112133_4112865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297203.1|4112896_4113415_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.3	3.4e-10
WP_158382501.1|4113448_4113757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246713.1|4115699_4116089_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	8.5e-06
WP_025246714.1|4119762_4120233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051419952.1|4120324_4120582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158382503.1|4120588_4120756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246715.1|4120768_4121065_-	anti-sigma-28 factor FlgM	NA	NA	NA	NA	NA
WP_025246716.1|4121148_4121757_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_025246718.1|4122346_4122760_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_025246719.1|4122763_4123156_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_025246720.1|4123168_4123834_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_025246721.1|4125866_4127159_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_025246723.1|4127653_4127941_+	hypothetical protein	NA	A0A0A7RU71	Clostridium_phage	37.3	6.7e-08
WP_025246724.1|4127982_4128906_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.0	8.2e-124
WP_025246726.1|4129303_4130947_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_025246727.1|4130989_4131949_+	flagellar hook-filament junction protein FlgL	NA	NA	NA	NA	NA
WP_025246729.1|4133003_4133927_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	3.3e-125
WP_038469148.1|4134674_4134899_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_025246731.1|4135716_4136079_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_025246732.1|4136146_4136566_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_025246733.1|4136558_4137539_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_025246734.1|4137544_4138024_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_025246735.1|4138170_4138569_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_038469152.1|4138595_4138811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038470613.1|4140718_4141357_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_025246742.1|4145055_4145979_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	9.7e-125
>prophage 38
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	4208843	4292792	4513140	transposase,tRNA,protease	Pseudomonas_phage(15.79%)	56	NA	NA
WP_025246790.1|4208843_4209359_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_025246791.1|4209644_4210865_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_148297154.1|4210869_4211166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246792.1|4213448_4214615_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.6	7.4e-130
WP_025246793.1|4218476_4219415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246794.1|4219445_4219715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246795.1|4220562_4221726_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_025246796.1|4221840_4222917_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_025246799.1|4227276_4227933_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_025246800.1|4228227_4229460_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.4	2.7e-98
WP_025246801.1|4229623_4230295_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_025246802.1|4230550_4230880_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_025246803.1|4231706_4233026_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_025246804.1|4233022_4234201_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_025246805.1|4234232_4235450_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_025246806.1|4235806_4236907_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_025246807.1|4236933_4237329_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_025246812.1|4240375_4240984_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_025246813.1|4241191_4241842_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_025246814.1|4241952_4242939_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_025246815.1|4243151_4243418_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_025246816.1|4243845_4244364_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_025246817.1|4244465_4245365_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.3	5.5e-32
WP_025246818.1|4245440_4246157_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_025246819.1|4246164_4247901_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	3.3e-57
WP_148297155.1|4248013_4249111_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	9.1e-05
WP_025246821.1|4249121_4250642_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.9	1.9e-85
WP_025246822.1|4252790_4253507_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025246823.1|4254302_4255160_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025246824.1|4255271_4256195_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	6.7e-126
WP_025246825.1|4256504_4257443_+	ribokinase	NA	NA	NA	NA	NA
WP_025246826.1|4257439_4257940_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_051419959.1|4260047_4260956_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_051419960.1|4261166_4261742_+	MFS transporter	NA	NA	NA	NA	NA
WP_081743086.1|4261760_4262276_+	MFS transporter	NA	NA	NA	NA	NA
WP_081743087.1|4265374_4266925_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	4.6e-103
WP_025246831.1|4266936_4267692_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.1	6.7e-39
WP_025244292.1|4268009_4269218_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_148297157.1|4270295_4270976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246836.1|4270996_4271572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025244882.1|4271791_4272091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246837.1|4273457_4274456_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_025246838.1|4274455_4275193_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_025246839.1|4276523_4277078_-	YgjV family protein	NA	NA	NA	NA	NA
WP_025246840.1|4278611_4280063_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_051419377.1|4281198_4281444_-	hypothetical protein	NA	Q5ZQW7	Pseudomonas_phage	44.9	1.1e-14
WP_148297158.1|4282097_4282331_-	DNA adenine methylase	NA	Q9B025	Phage_GMSE-1	72.1	1.4e-24
WP_148297159.1|4283986_4284304_+	hypothetical protein	NA	A0A193GZ69	Enterobacter_phage	30.6	6.3e-07
WP_025243865.1|4284349_4285273_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.6	5.1e-126
WP_158382507.1|4285299_4286079_+	hypothetical protein	NA	B5WZU0	Pseudomonas_phage	31.0	2.2e-08
WP_025246842.1|4286139_4287063_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	69.9	3.3e-125
WP_025246843.1|4287164_4287617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246844.1|4287906_4289115_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_025246846.1|4290232_4291105_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	2.9e-30
WP_025246847.1|4291107_4291320_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_025246848.1|4291406_4292792_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.7	1.0e-37
>prophage 39
NZ_CP006568	Candidatus Sodalis pierantonius str. SOPE chromosome, complete genome	4513140	4348221	4446613	4513140	transposase,tRNA,protease,integrase	Acidithiobacillus_phage(25.0%)	60	4374295:4374354	4444072:4444181
WP_025246890.1|4348221_4349496_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	3.3e-131
WP_025246891.1|4349643_4350267_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.1	9.3e-63
WP_025246892.1|4350664_4351969_-	trigger factor	NA	NA	NA	NA	NA
WP_025246893.1|4352288_4352606_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_025246894.1|4352895_4353474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882281.1|4356136_4356460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246895.1|4356449_4357064_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_025246896.1|4357063_4357396_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_025246897.1|4357411_4358302_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_025246898.1|4358527_4359802_+	MFS transporter	NA	NA	NA	NA	NA
WP_025246899.1|4360006_4360498_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_025246900.1|4362279_4363731_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_025246901.1|4363950_4364199_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_025246902.1|4364195_4365098_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_025246903.1|4365135_4366998_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_038470679.1|4368334_4368823_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_025246906.1|4368831_4369818_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_025246907.1|4369887_4370307_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_025246908.1|4370327_4370798_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.3	3.0e-29
WP_025246909.1|4370884_4372012_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.8	1.4e-45
WP_025246911.1|4373171_4373438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148297164.1|4373620_4373941_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	68.6	9.1e-14
WP_025246912.1|4373850_4375059_+|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
4374295:4374354	attL	GTCGAATGGCAAAACCGGCCTCTGGATGCAGTCTATCCCATTGTTTATCTTGACTGTATC	NA	NA	NA	NA
WP_025246914.1|4375474_4377004_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_025246915.1|4377058_4377394_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_025246916.1|4377839_4378301_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_071882283.1|4380333_4380852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071882284.1|4380848_4381169_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_148297165.1|4382663_4383161_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025246919.1|4383265_4385308_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.7	3.8e-44
WP_025246920.1|4385593_4386016_+	DoxX family protein	NA	NA	NA	NA	NA
WP_025246921.1|4386263_4387313_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_025246922.1|4387488_4388163_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_051419968.1|4388302_4389616_-	cytosine permease	NA	NA	NA	NA	NA
WP_025246925.1|4390521_4391343_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_025246926.1|4391440_4392793_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_148297093.1|4401118_4401415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025246930.1|4402189_4403398_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.4e-46
WP_025246931.1|4403516_4404269_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.0	1.4e-36
WP_071882285.1|4409973_4410318_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_148297166.1|4411848_4412181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025243983.1|4412324_4413248_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	70.3	1.5e-125
WP_051419973.1|4414679_4416779_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_051419974.1|4416799_4418524_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_025246934.1|4418561_4421738_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_025244173.1|4423357_4423585_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_158382509.1|4425080_4425797_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	42.5	3.6e-10
WP_071882287.1|4425940_4426156_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	66.2	7.0e-18
WP_025246936.1|4427318_4427681_+	hypothetical protein	NA	A0A2D1GNK9	Pseudomonas_phage	56.3	1.5e-25
WP_025246937.1|4427729_4428278_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	55.1	3.1e-54
WP_025246940.1|4430816_4431155_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_025246941.1|4431275_4432100_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_051420017.1|4433123_4434077_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025246949.1|4439207_4440758_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	1.3e-102
WP_071882288.1|4440769_4441003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882289.1|4440959_4441604_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.8	4.4e-23
WP_025246950.1|4441513_4442671_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	1.1e-37
WP_025246951.1|4442790_4443999_-|transposase	IS256-like element ISSoEn2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	3.1e-46
WP_025245871.1|4444301_4445051_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	38.4	4.6e-40
4444072:4444181	attR	GTCGAATGGCAAAACCGGCCTCTGGATGCAGTCTATCCCATTGTTTATCTTGACTGTATCGTTCTAAAAGTCCGGCAGGACAGCCGCATCATCAACAAATCTGTGTTCCT	NA	NA	NA	NA
WP_071882290.1|4445062_4446613_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.8	7.9e-103
