The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	551357	626283	5585613	tail,head,portal,holin,protease,transposase,terminase,capsid,integrase,lysis	Enterobacteria_phage(50.0%)	69	554282:554297	606181:606196
WP_000336726.1|551357_552176_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|552211_552514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001307618.1|552635_553817_-	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_000616241.1|553822_554293_-	cyanase	NA	NA	NA	NA	NA
554282:554297	attL	TGACTGAATCATGGTG	NA	NA	NA	NA
WP_025404245.1|554323_554983_-	carbonic anhydrase CynT	NA	NA	NA	NA	NA
WP_022581475.1|555092_555992_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	9.4e-16
WP_001299008.1|556124_557408_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_025404246.1|557397_558657_-	cytosine permease	NA	NA	NA	NA	NA
WP_025404247.1|558892_560779_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.8e-53
WP_001275899.1|560818_562270_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_001205750.1|562303_563473_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_000052173.1|563517_564408_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_000941050.1|564646_566233_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000691953.1|566330_566606_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000976987.1|566752_567424_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000290614.1|567440_567686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024221672.1|568098_568914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692736.1|569156_570206_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-72
WP_000662404.1|570582_571965_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661625.1|571974_572925_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_134889244.1|572956_573283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083465.1|573254_574673_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111816.1|574672_576220_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_024221671.1|576209_577073_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_022581412.1|577467_577842_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013899.1|578099_578597_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001089563.1|578688_579621_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000146391.1|579662_580751_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_072095750.1|580892_584876_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	5.5e-124
WP_000131059.1|585448_587482_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	1.7e-20
WP_001301903.1|587610_588198_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089079.1|588211_589684_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159144.1|589697_591368_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	1.0e-60
WP_157832602.1|592064_592199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072095745.1|592407_592995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	1.5e-51
WP_001362383.1|593324_594119_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213049.1|594272_595034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404248.1|595075_595642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135277.1|597058_597556_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|597772_597955_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|598045_598339_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|598699_598894_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|599283_599829_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|599803_601729_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|601725_601932_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|601928_603530_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_025404250.1|603510_604830_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.0e-232
WP_001358225.1|604839_605172_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063244.1|605227_606253_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
606181:606196	attR	CACCATGATTCAGTCA	NA	NA	NA	NA
WP_000158866.1|606294_606690_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000785282.1|606701_607055_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|607066_607645_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|607641_608037_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001342267.1|608044_608785_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|608800_609223_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|609204_609639_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025404251.1|609631_612211_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000847347.1|612207_612537_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|612536_613235_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_025404252.1|613240_613984_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.1e-146
WP_000090891.1|613920_614553_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025404253.1|614613_618111_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|618181_618781_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_025404254.1|618845_621806_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885574.1|621805_622390_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|622444_623113_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|623169_623475_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|623658_625143_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|625329_626283_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 2
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	838554	870762	5585613	tail,head,portal,holin,transposase,terminase,capsid,integrase,lysis	Enterobacteria_phage(45.45%)	40	831894:831953	855652:856342
831894:831953	attL	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCG	NA	NA	NA	NA
WP_032162118.1|838554_839610_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	97.1	4.9e-189
WP_000088311.1|839625_839928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|839963_840782_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001303849.1|840869_841088_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|841127_841295_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_085961182.1|841418_842631_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000411802.1|843076_843283_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085947772.1|843605_844818_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001358663.1|846466_847663_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_025404260.1|847641_848292_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_000499454.1|848590_848749_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|848834_849578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|849762_850452_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|850466_850589_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|850926_851886_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|852097_852763_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|852759_853371_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|853363_853534_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|853530_853713_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|853709_854237_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_000736898.1|854233_854674_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_029594380.1|854747_855020_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	98.9	1.0e-42
WP_064758453.1|854962_855097_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.0e-06
WP_085961182.1|855062_856276_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000092318.1|856424_856862_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
855652:856342	attR	CGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAAGCTACGGCGCT	NA	NA	NA	NA
WP_000881338.1|857011_857629_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_001307652.1|857816_858011_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|858405_858915_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|860797_861004_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404261.1|861000_862593_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_024239710.1|862582_864088_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256846.1|864124_864472_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	9.9e-22
WP_000522623.1|864529_865558_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|865609_865993_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_025380275.1|865985_866435_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
WP_025404262.1|866502_867075_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.5	2.3e-100
WP_025404263.1|867139_868453_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023459.1|868454_868724_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|868829_869711_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|869934_870762_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
>prophage 3
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	1102064	1173646	5585613	tail,head,portal,holin,protease,transposase,terminase,capsid,integrase	Enterobacteria_phage(37.25%)	81	1117160:1117219	1168910:1168974
WP_000156509.1|1102064_1103825_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1104010_1104463_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750414.1|1104537_1105593_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1105949_1106459_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1106677_1107307_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875041.1|1107269_1109432_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1109441_1109888_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1110010_1112065_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1112096_1112555_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1112650_1113313_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1113485_1113899_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1113943_1114261_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116291.1|1114318_1115509_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048228.1|1115603_1115882_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1115878_1116208_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1116298_1116958_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1117160:1117219	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001299351.1|1117365_1118385_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1118362_1118605_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025404266.1|1118672_1121144_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.5e-58
WP_001098307.1|1121237_1121429_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1121425_1121614_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1122187_1122397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1122397_1123036_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379552.1|1123047_1123200_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001416688.1|1123492_1123831_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1124222_1124465_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693858.1|1124448_1124874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404268.1|1124945_1126052_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_000788742.1|1126058_1126805_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|1126826_1127597_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1127612_1128026_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1128377_1129151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1129516_1129654_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|1129698_1129911_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|1130078_1130357_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|1130358_1131408_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|1131420_1131792_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1131781_1132153_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1132304_1133123_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1133409_1133607_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_113706111.1|1133744_1134458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001368722.1|1134907_1135339_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_025404270.1|1135817_1137653_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.0	0.0e+00
WP_085961182.1|1137678_1138891_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000411809.1|1140840_1141047_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|1141051_1141396_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|1141446_1141980_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_001303555.1|1142135_1142318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1142330_1142462_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_012816791.1|1142689_1142875_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1143402_1143717_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1143798_1144023_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1144424_1144934_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_025404272.1|1144905_1146834_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.8e-261
WP_000259002.1|1146817_1147024_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831765.1|1147020_1148613_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000256809.1|1150613_1150961_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1151018_1152047_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|1152098_1152473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|1152465_1152819_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975046.1|1152834_1153368_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|1153364_1153760_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_001357739.1|1153767_1154520_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000479105.1|1154533_1154965_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533423.1|1154991_1155405_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_025404275.1|1155385_1157965_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
WP_025404276.1|1157961_1158291_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_025380437.1|1158290_1158989_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	5.6e-133
WP_025404277.1|1158999_1159743_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.1e-147
WP_148294918.1|1159688_1160321_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.1	3.4e-105
WP_000649829.1|1160511_1161039_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_025404279.1|1161172_1164646_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_025404280.1|1164713_1165313_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	2.6e-110
WP_025404281.1|1165377_1166691_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023408.1|1166692_1166962_+	hypothetical protein	NA	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_038426800.1|1167088_1167982_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1168427_1168811_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|1169427_1170546_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1168910:1168974	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1170542_1172336_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1172354_1173062_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003670.1|1173058_1173646_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	1407946	1478921	5585613	tail,tRNA,head,terminase,transposase,capsid,integrase	Stx2-converting_phage(27.27%)	78	1422324:1422339	1473210:1473225
WP_022581747.1|1407946_1409065_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	3.5e-84
WP_000003742.1|1409033_1409303_-	excisionase	NA	NA	NA	NA	NA
WP_025404296.1|1409364_1411836_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000199480.1|1411931_1412120_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1412116_1412305_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1412704_1412872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1412865_1413099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1413076_1413484_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1413506_1413725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1413797_1414097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1414361_1414769_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1415055_1415607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020557.1|1415578_1416619_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_157832601.1|1416530_1417073_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1417106_1417841_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|1417837_1418002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162026.1|1418699_1419458_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1419735_1419948_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_025404298.1|1420168_1420429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038426828.1|1420495_1420774_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1420775_1421831_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1421831_1422197_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1422193_1422883_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
1422324:1422339	attL	GAAAAAAAATCCGGTA	NA	NA	NA	NA
WP_025404299.1|1423681_1424245_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	94.7	2.1e-82
WP_025404300.1|1424241_1425903_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.4	0.0e+00
WP_025404301.1|1425966_1427904_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.3	0.0e+00
WP_001063027.1|1427948_1428170_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|1430695_1431022_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|1431032_1431383_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1431379_1431826_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|1431822_1432167_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275505.1|1432225_1432942_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001453698.1|1433416_1433626_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_077697708.1|1434611_1436915_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.6	0.0e+00
WP_000807940.1|1436907_1437249_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_025404305.1|1437248_1437947_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_000194723.1|1437957_1438701_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_148294919.1|1438646_1439276_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	96.2	1.8e-106
WP_025404307.1|1439516_1442993_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.2	0.0e+00
WP_025404308.1|1443059_1443659_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_023307795.1|1443723_1445037_+	hypothetical protein	NA	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_025404309.1|1445038_1445308_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_115801847.1|1445414_1445504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453949.1|1445523_1447872_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1448462_1451864_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_148294915.1|1452406_1453483_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	2.7e-174
WP_001301834.1|1455280_1455406_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1455485_1455761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1455821_1457183_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799400.1|1457546_1458410_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1458393_1459530_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1459779_1461006_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1461054_1462176_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1462424_1463654_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1464018_1464207_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1464256_1464583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1464707_1464881_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1465011_1465209_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1465201_1465414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1465403_1465868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1465860_1466094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1466099_1466399_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1466395_1467796_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|1467996_1468248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1468244_1468655_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1468665_1468938_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1469064_1469289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1469540_1469747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404312.1|1469746_1470802_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	44.0	9.2e-71
WP_000380886.1|1470814_1471150_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1471162_1471576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1471781_1472324_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1472580_1472862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1473463_1474924_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
1473210:1473225	attR	GAAAAAAAATCCGGTA	NA	NA	NA	NA
WP_001265481.1|1474923_1475595_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1475763_1477134_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1477137_1477779_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|1477814_1478921_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	1591322	1649515	5585613	tail,head,protease,terminase,capsid,integrase	Stx2-converting_phage(29.41%)	62	1591159:1591186	1633672:1633699
1591159:1591186	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1591322_1592453_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1592430_1592679_-	excisionase	NA	NA	NA	NA	NA
WP_025404315.1|1592743_1595215_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|1595310_1595499_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1595495_1595684_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1596083_1596251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1596244_1596478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1596455_1596863_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1596885_1597104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1597176_1597476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1597740_1598148_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1598224_1598452_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1598435_1598987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020557.1|1598958_1599999_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_157832601.1|1599910_1600453_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1600486_1601221_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|1601217_1601382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162026.1|1602079_1602838_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1603116_1603329_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1603549_1603807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1603876_1604155_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1604156_1605212_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1605212_1605578_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1605574_1606264_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_025404316.1|1607062_1607626_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	1.4e-81
WP_025404317.1|1607622_1609284_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.2	0.0e+00
WP_025404318.1|1609348_1611286_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001074112.1|1611330_1611552_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_000125988.1|1614240_1614567_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007889.1|1614577_1614928_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|1614924_1615371_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1615367_1615712_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_022581165.1|1615779_1616496_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
WP_001030063.1|1616501_1616876_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1616971_1617181_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_025404321.1|1617232_1620475_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.6	0.0e+00
WP_000807954.1|1620467_1620809_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025404322.1|1620808_1621507_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	96.6	3.4e-130
WP_000194723.1|1621517_1622261_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|1622206_1622839_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_025404323.1|1623181_1626655_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001303943.1|1627956_1628235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1628662_1628809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001401309.1|1628945_1629593_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.6	1.9e-42
WP_001144877.1|1629776_1630367_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1633129_1633348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1633849_1634356_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1633672:1633699	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056550.1|1634401_1634902_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807658.1|1634987_1635167_-	general stress protein	NA	NA	NA	NA	NA
WP_000443065.1|1635547_1636354_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1636353_1637547_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024221648.1|1637558_1638917_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763498.1|1638920_1640516_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194605.1|1640515_1642078_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1642169_1642214_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285684.1|1642351_1643233_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1643229_1643850_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022581766.1|1643877_1645773_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291215.1|1645985_1646861_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1646900_1647491_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1647487_1648246_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|1648465_1649515_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	1733154	1791805	5585613	tail,tRNA,head,portal,holin,terminase,transposase,capsid,integrase	Escherichia_phage(51.52%)	72	1732788:1732803	1788628:1788643
1732788:1732803	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_001401302.1|1733154_1734387_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
WP_000387388.1|1734641_1735625_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123735.1|1736102_1737476_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	6.6e-53
WP_001157377.1|1737604_1738540_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040838.1|1738592_1739828_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_000079604.1|1739829_1740045_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001298826.1|1740144_1740333_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_021500490.1|1740325_1740520_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001004423.1|1740583_1741636_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_025404324.1|1741647_1744773_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.7	0.0e+00
WP_001519830.1|1744874_1745150_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
WP_000245528.1|1745224_1745401_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560227.1|1745394_1745616_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_032102321.1|1746211_1746394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404325.1|1746394_1747033_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	43.0	8.8e-08
WP_000379546.1|1747044_1747197_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000410105.1|1747502_1747922_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1748018_1748261_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702023.1|1748257_1748680_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899742.1|1748692_1749562_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.3	2.2e-78
WP_025404326.1|1749568_1750315_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	1.8e-113
WP_025404327.1|1750336_1751107_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	6.3e-85
WP_001118155.1|1751122_1751518_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000761449.1|1751518_1751932_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	6.6e-57
WP_000063625.1|1751980_1752193_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_029594466.1|1752256_1752601_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
WP_000610382.1|1752597_1752951_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.8	3.2e-36
WP_001278450.1|1753066_1753171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|1753359_1753572_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_071525388.1|1753808_1754060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940348.1|1754131_1754731_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000228019.1|1754730_1755021_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000640148.1|1755017_1755572_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000211416.1|1755845_1756427_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000917763.1|1756670_1756868_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301789.1|1757002_1757716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1758166_1758598_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_024247920.1|1759169_1761020_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000411802.1|1761464_1761671_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731241.1|1761675_1762020_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1762070_1762604_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1762874_1763444_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|1763443_1763590_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1763812_1763998_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1764523_1764838_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1764919_1765144_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000453587.1|1765532_1766078_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|1766052_1767978_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1767974_1768181_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|1768177_1769779_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_025404328.1|1769759_1771079_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.7e-231
WP_001295978.1|1771088_1771421_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063258.1|1771476_1772502_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1772543_1772939_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1772950_1773304_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|1773315_1773894_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683138.1|1773890_1774286_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001342267.1|1774293_1775034_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|1775049_1775472_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1775453_1775888_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025404251.1|1775880_1778460_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000847347.1|1778456_1778786_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|1778785_1779484_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|1779489_1780233_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1780169_1780802_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001585354.1|1784429_1785029_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	5.2e-111
WP_025404329.1|1785093_1786407_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023407.1|1786408_1786678_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_016241229.1|1787045_1787360_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_085961182.1|1787762_1788976_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1788628:1788643	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000527802.1|1790105_1791566_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|1791601_1791805_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	1983155	2038352	5585613	tail,portal,holin,terminase,transposase,integrase	Enterobacteria_phage(36.73%)	60	2008999:2009016	2045032:2045049
WP_001023435.1|1983155_1983425_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_025404333.1|1983426_1984740_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	8.8e-79
WP_038426836.1|1984804_1985407_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	98.5	2.4e-108
WP_141069701.1|1989285_1989915_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	2.1e-102
WP_000194729.1|1989860_1990604_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	8.9e-145
WP_025404337.1|1990614_1991313_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	98.3	1.1e-131
WP_000847298.1|1991312_1991642_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|1991638_1994251_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|1994231_1994645_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1994671_1995094_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|1995107_1995860_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1995867_1996266_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1996278_1996902_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1996904_1997186_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1997178_1997505_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000974567.1|1999560_2001063_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|2001062_2001275_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2001271_2003395_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2003391_2003868_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2004342_2004528_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092872.1|2005046_2005580_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_001041949.1|2006091_2006883_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|2006886_2007102_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290230.1|2007179_2007425_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2007465_2007645_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_025404338.1|2007782_2009729_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
2008999:2009016	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000024315.1|2010232_2011291_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.1	1.8e-207
WP_000917756.1|2011441_2011639_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_001204809.1|2011854_2012235_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_025404339.1|2012253_2013303_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	1.4e-116
WP_000191872.1|2013304_2013577_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2013698_2014043_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000967410.1|2014162_2014375_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_000373318.1|2014728_2015523_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|2015506_2016223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761428.1|2016750_2017164_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.6e-58
WP_001118156.1|2017179_2017560_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000450846.1|2017575_2018346_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_000139445.1|2018379_2018841_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	94.1	1.7e-82
WP_001435286.1|2018833_2019871_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	69.1	5.8e-86
WP_000693921.1|2019939_2020365_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|2020361_2020589_-	cell division protein	NA	NA	NA	NA	NA
WP_000444611.1|2020688_2021333_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_000380316.1|2021606_2021759_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2021770_2022409_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2022409_2022619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2023185_2023374_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2023370_2023562_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025404340.1|2023655_2026127_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	3.2e-58
WP_001368608.1|2026211_2026448_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|2026467_2027763_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|2027782_2027893_-	transporter	NA	NA	NA	NA	NA
WP_000836060.1|2027950_2028970_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-18
WP_001295394.1|2028981_2030196_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000705197.1|2030862_2031204_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138582.1|2031238_2031799_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2031801_2032512_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2032619_2032925_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072095802.1|2035612_2037136_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.7	7.4e-130
WP_085961182.1|2037138_2038352_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
2045032:2045049	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	2327129	2408054	5585613	tail,tRNA,head,portal,holin,transposase,terminase,plate,capsid	Enterobacteria_phage(71.05%)	79	NA	NA
WP_001258668.1|2327129_2328902_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891626.1|2329211_2329778_+	hydrolase	NA	NA	NA	NA	NA
WP_000639274.1|2329774_2330593_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2330645_2331041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019617.1|2331081_2331825_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000564736.1|2331821_2332793_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176856.1|2332957_2335387_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2335411_2336512_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185723.1|2336899_2337646_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|2337659_2338226_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2338441_2340175_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001307852.1|2340351_2340840_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259594.1|2340961_2341354_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066966.1|2341353_2343432_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278936.1|2343424_2344573_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2344774_2345419_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763865.1|2345429_2345819_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2345833_2346883_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204337.1|2346885_2347746_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001297437.1|2349411_2351073_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2351217_2351721_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001406772.1|2351741_2353706_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795622.1|2353710_2354637_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|2354633_2355521_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2355647_2356226_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2356228_2356579_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2357359_2357788_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2357794_2359219_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2359193_2359994_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|2360160_2361150_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2361161_2362676_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2362745_2363735_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2364531_2365035_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2365113_2365365_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2365480_2365567_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_024262403.1|2365829_2366153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400592.1|2366323_2366821_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|2366858_2367098_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797567.1|2367289_2368501_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2368562_2369228_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000687352.1|2369826_2371698_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000465340.1|2371755_2372265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290574.1|2372316_2373072_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_032212789.1|2373471_2374326_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_000088336.1|2374339_2374627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000290304.1|2377688_2379473_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_000779012.1|2379495_2380179_-	YecA family protein	NA	NA	NA	NA	NA
WP_101892112.1|2380175_2381333_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085961182.1|2382749_2383962_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000087810.1|2384707_2385754_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	5.7e-206
WP_000613782.1|2385753_2387505_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262654.1|2387659_2388496_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_001055089.1|2388519_2389572_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632336.1|2389617_2390418_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	1.5e-129
WP_000178988.1|2390521_2391016_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	9.2e-90
WP_000864901.1|2391015_2391216_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2391218_2391542_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2391538_2391931_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780563.1|2391927_2392335_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	1.3e-65
WP_000920594.1|2392472_2392940_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|2392932_2393568_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271894.1|2393564_2394146_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2394142_2394493_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111928.1|2394496_2395393_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.5e-154
WP_000071720.1|2395385_2395916_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_025404349.1|2395918_2397904_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	84.9	2.5e-170
WP_000972142.1|2397906_2398440_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	1.4e-96
WP_001164120.1|2398468_2398996_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_032316220.1|2398999_2399704_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.2	4.8e-124
WP_000905061.1|2399940_2400540_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2400568_2401057_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853440.1|2401069_2403877_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|2403863_2404019_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651580.1|2404027_2404402_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000290450.1|2404457_2404970_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005358.1|2404969_2406154_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	9.6e-226
WP_000132788.1|2406311_2407421_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
WP_000488107.1|2407463_2407724_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2407913_2408054_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
>prophage 9
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	2463322	2524753	5585613	tail,head,portal,holin,protease,terminase,plate,transposase,capsid,integrase	Enterobacteria_phage(31.48%)	70	2512234:2512293	2540133:2540237
WP_095111390.1|2463322_2463454_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_022581903.1|2463800_2464781_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	9.4e-86
WP_001373820.1|2464957_2465206_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.8	4.4e-40
WP_025404350.1|2465227_2466541_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.9	6.9e-76
WP_001360257.1|2466605_2467229_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_025404351.1|2467297_2470774_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.6	0.0e+00
WP_000649829.1|2470907_2471435_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_052915903.1|2471625_2472258_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_025404352.1|2472203_2472947_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
WP_001357740.1|2472952_2473651_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404276.1|2473650_2473980_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_025404353.1|2473976_2476556_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.0	0.0e+00
WP_000533423.1|2476536_2476950_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2476976_2477408_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|2477421_2478174_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|2478181_2478577_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|2478573_2479107_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204549.1|2479122_2479476_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201523.1|2479468_2479843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2479894_2480923_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2480980_2481328_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_025380298.1|2481364_2482870_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	3.6e-100
WP_000831765.1|2482859_2484452_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|2484448_2484655_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404272.1|2484638_2486567_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.8e-261
WP_000235436.1|2486538_2487048_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2487449_2487674_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2487755_2488070_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2488597_2488783_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032162009.1|2489334_2489868_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_000138558.1|2490027_2490300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|2490555_2490762_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|2491210_2493061_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|2493828_2494542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|2494679_2494877_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|2495163_2495982_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_148294920.1|2496133_2496505_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.9	4.0e-53
WP_001217447.1|2496507_2496867_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265233.1|2496879_2497929_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000191872.1|2497930_2498203_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2498324_2498669_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2498788_2499001_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2499234_2499792_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2499793_2500012_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2500139_2500451_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2500443_2500671_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|2500667_2500949_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|2500981_2501698_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2501719_2502466_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_025404357.1|2502472_2503567_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693858.1|2503638_2504064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747948.1|2504047_2504290_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2504681_2505020_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_001345283.1|2505312_2505465_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394548.1|2505476_2506115_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2506115_2506325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2506895_2507084_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2507080_2507272_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000096346.1|2509895_2510099_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533625.1|2510098_2511124_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001302302.1|2511359_2512157_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2512234:2512293	attL	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTT	NA	NA	NA	NA
WP_000055685.1|2512494_2513757_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	3.8e-71
WP_157832604.1|2516178_2516319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242259.1|2516748_2517021_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000983666.1|2517171_2517426_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
WP_000235844.1|2517422_2517884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022581241.1|2518219_2519281_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022581240.1|2519244_2521104_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025404358.1|2521408_2523535_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.1	2.2e-23
WP_113706114.1|2523540_2524753_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
2540133:2540237	attR	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTC	NA	NA	NA	NA
>prophage 10
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	2563817	2610389	5585613	tail,holin,transposase,capsid,integrase	Salmonella_phage(36.23%)	71	2587558:2587572	2612333:2612347
WP_001320295.1|2563817_2564984_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
WP_025404365.1|2565571_2566165_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	64.3	1.6e-59
WP_025404366.1|2566164_2566959_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	81.4	1.7e-69
WP_000049950.1|2566958_2567639_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_025404367.1|2567635_2568835_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	7.5e-186
WP_001270637.1|2568834_2569188_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_024233996.1|2569187_2569943_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	87.3	2.8e-114
WP_000466689.1|2570002_2570242_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_032162015.1|2570295_2570637_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.4	2.5e-33
WP_025404368.1|2570640_2571702_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	2.0e-158
WP_016233440.1|2571704_2572007_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	2.4e-48
WP_001420197.1|2572006_2572594_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_025404369.1|2572593_2574582_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	4.0e-269
WP_023565715.1|2574759_2575212_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109255.1|2575215_2575656_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	1.6e-56
WP_000046924.1|2575666_2576812_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_032162013.1|2576815_2577379_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	7.6e-80
WP_023908474.1|2577353_2577743_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_025404371.1|2577729_2578284_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	1.4e-81
WP_024183605.1|2578280_2578688_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	5.1e-70
WP_025404372.1|2578653_2579022_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	89.3	1.0e-53
WP_000627483.1|2579062_2580004_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	2.9e-156
WP_025404373.1|2580015_2580519_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.0	8.0e-73
WP_025404374.1|2580523_2581744_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	1.5e-202
WP_086353604.1|2581758_2582496_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_025404375.1|2582383_2583850_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.3	3.3e-268
WP_025404376.1|2583849_2585472_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	94.8	5.0e-310
WP_025404377.1|2585474_2585948_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	3.6e-51
WP_025404378.1|2585979_2586600_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	7.5e-89
WP_025404379.1|2586656_2586842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404380.1|2586985_2587378_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	79.1	2.8e-49
WP_025404381.1|2587361_2587838_-	glycoside hydrolase family protein	NA	K7P890	Enterobacteria_phage	94.9	3.0e-85
2587558:2587572	attL	ACTGCGTCCTGGCTT	NA	NA	NA	NA
WP_001570152.1|2587821_2588145_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_001554889.1|2588606_2589125_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_025404382.1|2589115_2589787_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.6	1.1e-130
WP_000144614.1|2589764_2589971_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_000861013.1|2589967_2590363_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	91.6	4.4e-66
WP_000002248.1|2590359_2590650_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	97.9	4.2e-50
WP_025404383.1|2590649_2591375_-	DNA-binding protein	NA	A0A2I6PIF5	Escherichia_phage	99.2	6.7e-129
WP_000566861.1|2591367_2591538_-	protein ninF	NA	K7P6X0	Enterobacteria_phage	100.0	5.5e-26
WP_001254251.1|2591534_2591717_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_032162011.1|2591713_2592241_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_025404384.1|2592237_2592678_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	99.3	2.0e-80
WP_025404385.1|2592952_2594329_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
WP_001608293.1|2594325_2595147_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_021544312.1|2595329_2595608_-	transcriptional activator protein C1	NA	K7P7A2	Enterobacteria_phage	97.8	9.0e-42
WP_000620665.1|2595716_2595911_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|2596017_2596734_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233129.1|2596752_2597121_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	8.5e-56
WP_085947970.1|2597996_2599210_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_157832612.1|2599330_2599501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404388.1|2599702_2599885_+	hypothetical protein	NA	K7PLQ2	Enterobacteria_phage	96.7	3.9e-30
WP_000972063.1|2600119_2600254_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_025404389.1|2600238_2600391_+	host cell division inhibitory peptide Kil	NA	K7PKW3	Enterobacterial_phage	98.0	1.2e-19
WP_000050554.1|2600466_2600637_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031370.1|2600647_2601253_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_025404390.1|2601252_2601636_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	5.5e-66
WP_085961182.1|2601911_2603124_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_032162002.1|2603276_2603441_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	7.1e-23
WP_025404392.1|2603437_2603899_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	72.3	3.1e-55
WP_025404393.1|2603895_2604204_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.2	2.7e-39
WP_025404394.1|2604196_2604841_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.2	2.0e-129
WP_000151165.1|2604837_2605491_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	58.1	2.3e-35
WP_001289898.1|2605487_2606240_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.0	8.8e-108
WP_000797279.1|2606585_2606774_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_025404395.1|2607287_2608001_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	60.0	3.0e-65
WP_021549676.1|2607997_2608258_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	3.5e-40
WP_032162000.1|2608257_2608542_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	2.7e-49
WP_025404397.1|2608614_2608959_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.7e-58
WP_000132739.1|2609038_2609230_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_025404398.1|2609210_2610389_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.7	1.5e-231
2612333:2612347	attR	AAGCCAGGACGCAGT	NA	NA	NA	NA
>prophage 11
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	2696436	2797483	5585613	tail,tRNA,head,holin,terminase,transposase,capsid,lysis	Enterobacteria_phage(33.33%)	87	NA	NA
WP_000476014.1|2696436_2697798_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|2698128_2698446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2698851_2699751_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|2699832_2700612_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000490679.1|2701799_2703155_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823260.1|2703158_2703443_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2703473_2703926_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853896.1|2703935_2705198_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2705226_2706081_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2706388_2707441_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858489.1|2707697_2708975_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846214.1|2708971_2709976_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	2.6e-14
WP_000011993.1|2709972_2710938_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2710911_2711658_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2711709_2712528_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|2712592_2713393_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195570.1|2713389_2714178_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2714400_2714673_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000133660.1|2714793_2715618_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2715836_2716175_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405695.1|2716256_2717291_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945452.1|2717306_2719787_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|2719802_2720477_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830457.1|2720556_2721099_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2721391_2721673_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2721935_2723045_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001400694.1|2723176_2725210_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001556120.1|2729154_2732787_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|2732847_2733165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|2733471_2734560_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|2734570_2736850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|2736842_2737979_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001400695.1|2737975_2739976_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2740100_2740562_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2740601_2741072_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2741118_2741838_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2741834_2743520_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001261971.1|2744034_2744283_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_025404399.1|2744487_2745696_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.3	1.7e-230
WP_001025673.1|2746347_2747589_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.7	3.2e-216
WP_024262412.1|2748581_2748851_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	7.1e-44
WP_025404401.1|2748852_2750166_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	5.0e-82
WP_001230489.1|2750230_2750830_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_097455678.1|2754616_2755246_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.5e-102
WP_025404403.1|2755191_2755935_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.7	3.4e-144
WP_025404404.1|2755940_2756639_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_000807964.1|2756638_2756980_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025404405.1|2756972_2760215_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.7	0.0e+00
WP_001453698.1|2760262_2760472_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2760567_2760942_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_022581165.1|2760947_2761664_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
WP_000133393.1|2761722_2762067_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2762063_2762510_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|2762506_2762857_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|2762867_2763194_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001074112.1|2765720_2765942_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_022581168.1|2765986_2767924_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_025404407.1|2767987_2769649_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.3	0.0e+00
WP_025404408.1|2769645_2770209_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.9	1.4e-89
WP_000829192.1|2770497_2770863_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2770904_2771105_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2771236_2771563_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|2771963_2772149_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|2772371_2772503_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661708.1|2772597_2773293_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_000992065.1|2773566_2774100_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.2e-100
WP_000731192.1|2774150_2774495_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|2774499_2774706_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_025404260.1|2777648_2778299_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_025404410.1|2779406_2779595_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	66.7	1.8e-17
WP_085961182.1|2779668_2780881_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001216963.1|2781424_2781532_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2781512_2782244_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2782248_2783175_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000220837.1|2783167_2784325_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001130308.1|2784331_2785249_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000871507.1|2785459_2787757_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000097402.1|2787952_2789668_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001319943.1|2789705_2790638_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|2790811_2791399_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001296821.1|2791568_2792147_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079538.1|2792276_2793038_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001469803.1|2793090_2794617_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|2794750_2794834_+	protein YohP	NA	NA	NA	NA	NA
WP_001264861.1|2795206_2796154_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|2796392_2796791_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|2796787_2797483_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 12
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	2989509	3083693	5585613	tail,tRNA,portal,holin,terminase,capsid,bacteriocin,integrase	Escherichia_phage(63.01%)	101	3021221:3021244	3083889:3083912
WP_001283590.1|2989509_2990322_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289160.1|2990321_2991335_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699113.1|2991400_2992537_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	5.3e-24
WP_000615820.1|2992635_2993631_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127796.1|2993627_2994806_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2995080_2996301_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683767.1|2996459_2998466_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2998586_2998865_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089226.1|2998898_2999447_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|2999446_3000256_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043835.1|3000255_3001080_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001307917.1|3001083_3002169_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
WP_001309606.1|3002203_3003136_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3003301_3003853_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001383353.1|3003966_3004806_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000782937.1|3004806_3005331_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000698462.1|3005327_3005804_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001248900.1|3005800_3006304_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182848.1|3006319_3007072_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112840.1|3007094_3009734_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3009815_3010379_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3011021_3011507_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426149.1|3011709_3013854_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531918.1|3013853_3015164_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3015345_3015630_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001307921.1|3016001_3017342_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937775.1|3017707_3018982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3019163_3019919_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368129.1|3020212_3021145_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
3021221:3021244	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_032161876.1|3021367_3029767_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	93.9	0.0e+00
WP_025404420.1|3029835_3031101_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.5	3.9e-185
WP_025404421.1|3031111_3031363_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455646.1|3031372_3031819_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_025404422.1|3031821_3032475_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	98.6	6.7e-112
WP_000035555.1|3032568_3032970_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|3033026_3033167_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|3033399_3034137_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|3034216_3034834_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|3034839_3035118_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|3035132_3036401_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001146321.1|3036397_3038023_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_001303606.1|3038317_3038506_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001023407.1|3038644_3038914_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_012816803.1|3038915_3040853_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_000207922.1|3040849_3041500_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|3041499_3042063_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001371266.1|3042046_3042508_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_001140444.1|3042557_3042947_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|3043001_3044216_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345011.1|3044239_3045247_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000787520.1|3045404_3047549_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143988.1|3047548_3049255_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3049235_3050042_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001108577.1|3050334_3050886_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|3051124_3051310_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|3051537_3051684_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3051683_3052253_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087702.1|3052523_3053057_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.2	1.6e-100
WP_000284506.1|3053061_3053277_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|3053353_3053626_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000142777.1|3053666_3053846_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_025404423.1|3053982_3055920_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.2	0.0e+00
WP_000738068.1|3056417_3056687_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3056698_3057658_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204859.1|3058441_3058876_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3058868_3059063_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3059059_3059623_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3059630_3060080_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001193567.1|3060079_3061051_-	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|3061040_3062561_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|3062554_3062932_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000171145.1|3063455_3063695_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000162431.1|3063800_3064520_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
WP_000939555.1|3064615_3066085_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
WP_025404424.1|3066081_3067035_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
WP_000331648.1|3067215_3067686_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
WP_001292087.1|3067685_3068066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706115.1|3068683_3069469_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.0e-139
WP_024177061.1|3069823_3070045_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000995345.1|3070065_3070347_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|3070363_3071314_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|3071310_3072000_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344636.1|3071999_3072587_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_001071603.1|3072661_3073009_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3073072_3073894_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159714.1|3073970_3074414_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	99.3	1.9e-78
WP_001453790.1|3074521_3075400_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|3075396_3075600_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|3075592_3075832_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000036158.1|3075828_3076530_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_000628769.1|3077043_3077997_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	55.0	2.0e-80
WP_000969523.1|3077993_3078254_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
WP_000609351.1|3078338_3079082_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	99.1	2.8e-122
WP_000203819.1|3079405_3079693_+	phage antirepressor Ant	NA	V5URG2	Shigella_phage	97.9	3.9e-48
WP_000211520.1|3079942_3080572_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|3080627_3081059_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|3081055_3081682_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|3081641_3081854_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994795.1|3081889_3082279_+	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_000453637.1|3082357_3082540_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218304.1|3082523_3083693_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	99.7	3.7e-230
3083889:3083912	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 13
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	3315051	3395099	5585613	tail,tRNA,portal,holin,protease	Enterobacteria_phage(45.24%)	77	NA	NA
WP_001295363.1|3315051_3315789_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|3315920_3317255_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_025404428.1|3317287_3318169_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189191.1|3318271_3318859_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3318914_3319298_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262720.1|3319602_3320292_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3320339_3321377_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3321583_3322003_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_024221634.1|3322071_3322770_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082991.1|3322801_3325462_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3325575_3326931_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464869.1|3326955_3327300_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001235102.1|3334371_3336945_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040153.1|3337074_3337806_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079110.1|3337802_3338783_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3338917_3339655_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3339925_3340267_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3340370_3340418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200122.1|3340516_3341677_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3341719_3342841_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3342851_3343922_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3344131_3344497_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212383.1|3344646_3345165_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000368157.1|3345157_3346381_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589825.1|3346396_3346879_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3346955_3347303_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3347344_3348112_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3348142_3348691_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3348709_3348958_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3349094_3350456_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3350547_3351414_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032149952.1|3351434_3352721_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3352775_3353369_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3353490_3354369_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880920.1|3354454_3356116_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3356264_3356606_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3356667_3356958_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3356947_3357424_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3357555_3358038_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3358886_3359135_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001121225.1|3359728_3360379_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491541.1|3360603_3361479_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023407.1|3361619_3361889_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_025404429.1|3361890_3363204_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.3e-77
WP_001230514.1|3363268_3363868_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_025404430.1|3363935_3367412_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.4	0.0e+00
WP_148294921.1|3367653_3368283_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	91.9	9.9e-97
WP_025404434.1|3368981_3369680_-|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	97.8	8.9e-131
WP_000847298.1|3369679_3370009_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_025404435.1|3370005_3372651_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|3372694_3373003_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479061.1|3373029_3373452_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_025404436.1|3373465_3374218_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000682716.1|3374225_3374624_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3374636_3375260_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3375262_3375544_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3375536_3375863_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|3375950_3377930_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|3377919_3379422_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|3379421_3379634_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_158414418.1|3381334_3381529_-	hypothetical protein	NA	Q8VNN7	Enterobacteria_phage	97.7	6.3e-18
WP_113706117.1|3381492_3381753_-	hypothetical protein	NA	Q9EYD1	Enterobacteria_phage	88.4	1.4e-36
WP_000373407.1|3381749_3382226_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816804.1|3382700_3382886_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001092872.1|3383404_3383938_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_000909834.1|3384068_3384701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404437.1|3384921_3385245_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.0	1.0e-52
WP_000284517.1|3385249_3385465_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_025404438.1|3385614_3387468_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3387875_3388043_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3388128_3388872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3389124_3389748_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3389744_3390410_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108081.1|3390992_3391559_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001505174.1|3392116_3393889_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001254222.1|3394392_3394575_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|3394571_3395099_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
>prophage 14
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	3691525	3702114	5585613	integrase	Enterobacteria_phage(88.89%)	12	3687086:3687098	3705268:3705280
3687086:3687098	attL	ACGATCCGCGCGT	NA	NA	NA	NA
WP_025404448.1|3691525_3693859_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|3693873_3694194_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459319.1|3694329_3694785_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|3694777_3695065_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025404449.1|3695057_3695648_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001149160.1|3695644_3695911_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283035.1|3696462_3697197_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_000638631.1|3697193_3697694_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|3697767_3698340_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000611230.1|3698650_3699073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220867.1|3699069_3700941_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
WP_001218984.1|3700950_3702114_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
3705268:3705280	attR	ACGCGCGGATCGT	NA	NA	NA	NA
>prophage 15
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	4080581	4141886	5585613	transposase,tRNA,protease	uncultured_Mediterranean_phage(20.0%)	52	NA	NA
WP_000366126.1|4080581_4081079_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000257293.1|4081084_4081723_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4082117_4082510_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4082525_4082954_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192336.1|4083172_4084300_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4084493_4084892_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|4085045_4086413_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4086502_4087570_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|4087632_4088571_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|4089005_4089476_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695688.1|4089840_4090104_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029006.1|4090159_4090432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510962.1|4090523_4092491_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854033.1|4092496_4093429_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|4093436_4093640_-	AaeX family protein	NA	NA	NA	NA	NA
WP_025404463.1|4093822_4094752_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|4094879_4096325_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253607.1|4096480_4100281_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|4100348_4101818_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203108.1|4101807_4102401_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|4102409_4102898_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802515.1|4102897_4104001_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4104066_4105110_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241422.1|4105414_4107355_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148476.1|4107506_4108481_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000838308.1|4108517_4109348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354622.1|4110213_4110684_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|4110694_4112044_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000381170.1|4112152_4112395_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175715.1|4112384_4113836_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145827.1|4113847_4114729_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|4115057_4116023_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4116048_4116345_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001258919.1|4116430_4117315_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
WP_001295275.1|4117398_4117578_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|4117580_4118243_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160334.1|4118641_4119799_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_113706119.1|4119868_4121081_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_000825639.1|4121582_4121804_-	membrane protein	NA	NA	NA	NA	NA
WP_032162153.1|4122056_4125149_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_113706120.1|4125202_4126415_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_029594386.1|4126454_4127465_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.7	1.4e-71
WP_000019655.1|4127532_4128714_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001301413.1|4128723_4129827_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078340.1|4129834_4130593_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.1e-20
WP_022581407.1|4136476_4137031_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001070559.1|4137006_4137264_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000451242.1|4137260_4138079_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001301437.1|4138083_4138656_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_001129723.1|4138660_4139203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460670.1|4139231_4139705_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_085947970.1|4140672_4141886_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 16
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	4559028	4569420	5585613	integrase	Enterobacteria_phage(100.0%)	11	4552414:4552426	4564155:4564167
4552414:4552426	attL	AACGCCTGAAAGG	NA	NA	NA	NA
WP_001218986.1|4559028_4560204_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	1.3e-211
WP_000503665.1|4560208_4561117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|4562596_4563169_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638631.1|4563242_4563743_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283035.1|4563739_4564474_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
4564155:4564167	attR	CCTTTCAGGCGTT	NA	NA	NA	NA
WP_001149160.1|4565025_4565292_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025404478.1|4565288_4565888_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.1	3.0e-58
WP_001244665.1|4565880_4566168_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459319.1|4566160_4566616_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|4566751_4567072_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025404479.1|4567086_4569420_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 17
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	4838968	4922940	5585613	tail,tRNA,head,portal,holin,protease,terminase,plate,capsid,integrase,lysis	Escherichia_phage(35.56%)	90	4871783:4871829	4905465:4905511
WP_000560983.1|4838968_4839406_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001343389.1|4839450_4840392_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|4843292_4843511_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086385.1|4843727_4843970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|4844299_4845229_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_025404487.1|4845225_4845861_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4845857_4846760_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077697102.1|4846772_4849823_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_025404488.1|4850016_4850850_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001400645.1|4851002_4852058_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931324.1|4852107_4853856_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019458.1|4853855_4854926_-	aminopeptidase	NA	NA	NA	NA	NA
WP_025404489.1|4854915_4856367_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729614.1|4856377_4856824_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000749945.1|4857301_4858696_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619508.1|4858736_4859051_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179715.1|4859060_4859885_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211504.1|4860151_4861411_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144078.1|4861407_4862877_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217141.1|4863164_4864001_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001362440.1|4863984_4864923_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4864919_4865954_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4866238_4866859_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_022581810.1|4867118_4868102_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270249.1|4868250_4868925_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580424.1|4869040_4870414_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001033722.1|4870410_4871109_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4871258_4871759_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4871783:4871829	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|4871944_4872925_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|4872994_4873288_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4873440_4873713_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|4873882_4874383_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4874446_4874671_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|4874670_4874970_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|4874972_4875197_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027676.1|4875193_4875469_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_000268590.1|4875458_4877765_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_029594353.1|4877743_4878196_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_001540306.1|4878680_4879619_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|4879619_4880612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140373.1|4880598_4881717_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
WP_000038178.1|4882092_4883127_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_000156875.1|4883126_4884899_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085958.1|4885072_4885927_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
WP_001248561.1|4885985_4887059_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_000203465.1|4887062_4887806_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	1.9e-123
WP_000988633.1|4887905_4888415_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4888414_4888618_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|4888621_4888903_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4888902_4889400_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736594.1|4889414_4889840_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	2.5e-59
WP_000040677.1|4889827_4890271_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_000917157.1|4890360_4890828_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	3.3e-81
WP_001001792.1|4890820_4891273_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_000255497.1|4891344_4892130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093705.1|4892213_4892849_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127173.1|4892845_4893193_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121506.1|4893197_4894106_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.8e-161
WP_001285314.1|4894098_4894629_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_000104679.1|4894639_4896568_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.2	6.6e-224
WP_000930007.1|4896536_4897100_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.6	1.9e-86
WP_000796111.1|4897351_4898419_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001286678.1|4898752_4899943_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.6e-223
WP_001251408.1|4899955_4900474_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4900530_4900806_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4900838_4900958_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069943.1|4900950_4903398_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.2	0.0e+00
WP_000978881.1|4903412_4903892_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	4.3e-84
WP_000887624.1|4903891_4905055_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	98.7	2.0e-204
WP_000468308.1|4905135_4905354_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4905589_4906492_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4905465:4905511	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4906672_4907635_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4907953_4908943_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|4909049_4909805_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4909859_4910627_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4910734_4911334_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4911434_4911875_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655983.1|4912086_4912386_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4912412_4912841_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796310.1|4912845_4913592_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250650.1|4913688_4914699_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4914928_4916437_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4916459_4917305_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4917730_4917976_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000232687.1|4918014_4918641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024221530.1|4918763_4919438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|4919497_4919983_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001308187.1|4920075_4921002_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4921068_4922400_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4922409_4922940_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 18
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	5073676	5124118	5585613	tail,tRNA,head,holin,transposase,terminase,capsid,integrase	Enterobacteria_phage(35.19%)	59	5080412:5080426	5121301:5121315
WP_000956557.1|5073676_5074210_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093917.1|5074627_5074909_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_001061344.1|5074945_5075518_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.9	3.5e-109
WP_000145667.1|5075821_5076310_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	1.1e-66
WP_001242734.1|5076306_5076828_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	91.0	3.5e-63
WP_000336726.1|5077299_5078118_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|5078153_5078456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000081283.1|5078750_5079575_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000135681.1|5079640_5080003_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	7.3e-60
5080412:5080426	attL	ATCGCCGCGCTGGTT	NA	NA	NA	NA
WP_000859462.1|5080669_5081344_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|5081434_5081635_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|5081678_5082230_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087342.1|5082226_5083378_+	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000620696.1|5083374_5083599_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_000061518.1|5083595_5084414_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_001447903.1|5084410_5084905_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_001341555.1|5084904_5085558_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210170.1|5085554_5085881_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_023277891.1|5085877_5086267_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	7.8e-68
WP_025404492.1|5086286_5087096_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.4	1.3e-149
WP_001428967.1|5087103_5088093_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001047129.1|5088106_5088859_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001339373.1|5089168_5089321_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_025404493.1|5090138_5091989_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.6	0.0e+00
WP_000411802.1|5092434_5092641_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|5092640_5093138_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|5093354_5093540_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|5094067_5094382_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032321890.1|5094463_5094688_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_000279796.1|5094729_5095095_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_025404316.1|5095390_5095954_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	1.4e-81
WP_025404494.1|5095950_5097297_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	79.4	2.5e-246
WP_025404495.1|5097360_5099298_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.6	0.0e+00
WP_001063027.1|5099342_5099564_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|5101928_5102255_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|5102265_5102616_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|5102612_5103059_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|5103055_5103400_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275505.1|5103458_5104175_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001030047.1|5104180_5104555_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_122994012.1|5104650_5104860_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	7.4e-33
WP_025404497.1|5104907_5108150_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.9	0.0e+00
WP_000807964.1|5108142_5108484_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025404498.1|5108483_5109182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.9e-131
WP_025404499.1|5109187_5109931_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_064761467.1|5109876_5110506_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_162149718.1|5110751_5111720_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	7.7e-181
WP_113706121.1|5112252_5113737_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.8	2.4e-266
WP_001216290.1|5113805_5114429_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_025404500.1|5114493_5115807_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.9	6.9e-76
WP_001023407.1|5115808_5116078_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001370116.1|5116487_5117093_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|5117317_5117968_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217539.1|5118561_5118810_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|5118871_5119969_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_025404501.1|5120057_5121095_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891400.1|5121228_5121471_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
5121301:5121315	attR	ATCGCCGCGCTGGTT	NA	NA	NA	NA
WP_000235513.1|5121636_5122620_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|5122702_5124118_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 19
NZ_CP006027	Escherichia coli O145:H28 str. RM13514 chromosome, complete genome	5585613	5520928	5553374	5585613	tail,portal,protease,terminase,integrase	Enterobacteria_phage(67.86%)	31	5520130:5520144	5533060:5533074
5520130:5520144	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218292.1|5520928_5522152_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	1.2e-234
WP_000059336.1|5522252_5522705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542348.1|5522746_5523229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024221786.1|5523518_5524115_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.4	6.1e-112
WP_000934114.1|5525643_5527746_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5527742_5527955_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5527954_5529463_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|5529407_5531435_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097042.1|5531521_5531845_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.2e-51
WP_001283153.1|5531837_5532113_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|5532124_5532703_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_024221681.1|5532699_5533101_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	5.4e-72
5533060:5533074	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_000211121.1|5533111_5533855_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_025404521.1|5533915_5534302_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	99.2	2.1e-65
WP_001161009.1|5534310_5534640_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372002.1|5534611_5537677_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.0	0.0e+00
WP_000447248.1|5537676_5538006_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152362.1|5538015_5538714_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	1.6e-132
WP_038427005.1|5538718_5539462_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
WP_025380703.1|5539359_5540007_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.5e-111
WP_025380704.1|5540067_5543466_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_021530825.1|5543532_5544132_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.8e-109
WP_038427007.1|5544196_5547550_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.1e-12
WP_000885593.1|5547549_5548125_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
WP_000086527.1|5548222_5548813_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|5549191_5549425_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|5549493_5549607_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5550033_5550282_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5550501_5552088_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5552480_5553086_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5553212_5553374_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NZ_CP006028	Escherichia coli O145:H28 str. RM13514 plasmid pO145-13514, complete sequence	87120	7319	78610	87120	protease,transposase,integrase	Stx2-converting_phage(41.38%)	65	4431:4445	85285:85299
4431:4445	attL	TTGCAGCTGTTGTCG	NA	NA	NA	NA
WP_012917688.1|7319_8858_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000612591.1|8907_9255_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|9491_9857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|9856_11044_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|11322_12891_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|12894_13242_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_025404525.1|13238_13913_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|13966_14194_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|14356_15334_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_113706123.1|16139_17352_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.3e-166
WP_032162148.1|17392_17590_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	93.8	6.4e-26
WP_001130313.1|17583_17832_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	87.9	5.6e-27
WP_001341451.1|17816_18041_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	91.4	2.7e-28
WP_000445934.1|18105_18501_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|18500_19460_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|19732_20635_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012680995.1|20631_20943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|21018_21702_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|21701_21920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|21931_22366_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|22410_22893_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|22889_23609_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|23885_24203_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|24664_25165_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_162137195.1|25166_25787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|25892_26327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|26419_26686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|26750_27641_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_077776889.1|27664_27886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|27916_28168_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|28746_29595_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|29680_30016_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|30247_30580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991402.1|30591_33312_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|33532_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|33891_34194_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_113706124.1|34620_35834_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	1.6e-164
WP_136138333.1|35832_36246_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000112000.1|36544_36802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|37049_40952_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|41889_42309_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|42239_42914_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|42910_43258_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|43261_44830_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000091308.1|45653_46019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|46018_47206_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|51200_51677_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|54803_55034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000581688.1|55148_64649_+	toxin B	NA	NA	NA	NA	NA
WP_000907857.1|65608_66640_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|67348_67990_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_025404528.1|68130_68796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|69455_71024_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|71027_71375_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|71371_72046_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|72099_72486_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|72613_73474_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_157776129.1|73962_74238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336726.1|74278_75097_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|75132_75435_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_001165114.1|75502_76048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|76209_76626_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|76622_76853_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|77412_77826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|77827_78610_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
85285:85299	attR	TTGCAGCTGTTGTCG	NA	NA	NA	NA
>prophage 1
NZ_CP006029	Escherichia coli O145:H28 str. RM13514 plasmid pRM13514, complete sequence	64561	12678	45830	64561	integrase,transposase	Escherichia_phage(30.77%)	41	6221:6240	28422:28441
6221:6240	attL	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_113706125.1|12678_13892_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	7.1e-168
WP_000811656.1|14290_15802_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|16088_17129_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001097010.1|17290_18166_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_162149453.1|18315_18477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139717.1|18522_19014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012728230.1|19010_19880_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|19884_20895_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|20897_21434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|21732_22014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|22611_23316_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000268552.1|23535_24192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|24191_25619_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|25622_26123_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_001447539.1|26131_26443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|26448_26880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|26947_27622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342216.1|27608_27728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|27870_28248_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|28574_28718_+	hypothetical protein	NA	NA	NA	NA	NA
28422:28441	attR	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000074431.1|28809_29445_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|29497_29770_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|29818_31000_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|31003_31789_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|31816_31948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|31962_32274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|32580_33396_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|33456_34260_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|34259_35096_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|35401_35644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|35675_36326_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|36431_37631_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|37897_38203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012728216.1|38230_39445_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_012728215.1|39661_40546_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|40576_42070_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|42280_42505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|42501_43239_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|43724_43865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|43870_44575_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|45125_45830_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
