The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	788685	828297	5402276	terminase,portal,capsid,head,tail,integrase,transposase,holin,protease	Enterobacteria_phage(42.86%)	57	779218:779232	793652:793666
779218:779232	attL	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000533643.1|788685_789756_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|789733_789952_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|789991_790159_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120060.1|790401_791004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|791214_791436_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001386642.1|791534_791816_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548536.1|791826_792018_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|791990_792173_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|792169_792850_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000100847.1|792846_793632_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000372923.1|794007_794151_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
793652:793666	attR	CAATATCAACCTGAT	NA	NA	NA	NA
WP_001198860.1|794119_794284_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_021559784.1|794356_794725_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	1.7e-64
WP_032228038.1|794913_795795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332935.1|795791_796247_-	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_000618038.1|796467_796872_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000028394.1|796868_797501_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_001194218.1|797604_797820_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251073.1|797939_798233_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_025380269.1|798265_798541_+	hypothetical protein	NA	M1FN81	Enterobacteria_phage	100.0	5.0e-37
WP_085961182.1|798546_799759_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000788866.1|799858_800560_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_000145931.1|800556_800847_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736898.1|800920_801361_+	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000153262.1|801357_801885_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_001254222.1|801881_802064_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_001505174.1|802567_804340_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001108081.1|804885_805452_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_025380270.1|805426_806038_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	97.5	4.1e-95
WP_001028841.1|806034_806700_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|806911_807871_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|808207_808330_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|808344_809034_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|809218_809962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|810047_810206_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_025380271.1|810504_812355_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_000284517.1|812507_812723_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|812727_813072_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_025380272.1|813122_813656_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000675931.1|813876_813990_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001208680.1|814211_814397_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|814924_815239_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|815320_815545_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|815939_816449_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|816420_818349_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259002.1|818332_818539_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025380273.1|818535_820128_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_025380274.1|820117_821623_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.0	1.8e-99
WP_000256821.1|821659_822007_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522623.1|822064_823093_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|823144_823528_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_025380275.1|823520_823970_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
WP_025380276.1|824037_824610_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.0	1.1e-99
WP_025380277.1|824674_825988_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.7e-77
WP_001023459.1|825989_826259_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|826364_827246_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|827469_828297_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
>prophage 2
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	1048242	1116937	5402276	terminase,portal,capsid,head,tail,transposase,holin,protease	Enterobacteria_phage(39.58%)	79	NA	NA
WP_025380286.1|1048242_1050003_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025380287.1|1050188_1050641_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750414.1|1050715_1051771_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1052127_1052637_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1052855_1053485_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875041.1|1053447_1055610_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1055619_1056066_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1056188_1058243_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1058274_1058733_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1058828_1059491_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1059663_1060077_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1060121_1060439_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116291.1|1060496_1061687_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048228.1|1061781_1062060_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1062056_1062386_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1062476_1063136_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_085961182.1|1063954_1065167_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000273151.1|1065853_1066096_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025380290.1|1066163_1068599_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001098307.1|1068692_1068884_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1068880_1069069_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_025380291.1|1069772_1070219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000367377.1|1070317_1070470_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_021568727.1|1070742_1071033_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000108762.1|1071032_1071224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380292.1|1071241_1071742_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.8e-16
WP_025380293.1|1072110_1072536_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_025380294.1|1072607_1073714_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_000788759.1|1073720_1074467_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_000451007.1|1074488_1075259_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1075274_1075688_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1076039_1076813_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1077178_1077316_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|1077360_1077573_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|1077740_1078019_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_025380295.1|1078020_1079070_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.7e-109
WP_001217436.1|1079082_1079454_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1079443_1079815_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1079966_1080785_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1081071_1081269_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1081406_1082120_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874348.1|1082888_1084739_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284518.1|1084891_1085107_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1085111_1085456_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_025380272.1|1085506_1086040_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000675931.1|1086260_1086374_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001208680.1|1086595_1086781_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|1087308_1087623_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1087704_1087929_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1088323_1088833_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|1088804_1090733_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259002.1|1090716_1090923_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025380297.1|1090919_1092512_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_025380298.1|1092501_1094007_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	3.6e-100
WP_000256809.1|1094043_1094391_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1094448_1095477_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|1095528_1095903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|1095895_1096249_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_025380299.1|1096264_1096798_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|1096794_1097190_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000106789.1|1097197_1097950_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	3.2e-134
WP_000479105.1|1097963_1098395_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_071826504.1|1098421_1098835_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.7e-41
WP_025380301.1|1098815_1101395_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
WP_000847304.1|1101391_1101721_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_025380302.1|1101720_1102419_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_000194723.1|1102429_1103173_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_144319767.1|1103118_1103751_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	1.4e-103
WP_000649829.1|1103941_1104469_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_025380304.1|1104602_1108079_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.7	0.0e+00
WP_025380305.1|1108145_1108745_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	1.2e-110
WP_038428786.1|1108809_1110123_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_025380306.1|1110124_1110394_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_038428789.1|1110520_1111273_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_001443410.1|1111718_1112102_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|1112718_1113837_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1113833_1115627_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1115645_1116353_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003670.1|1116349_1116937_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	1181904	1243915	5402276	transposase,integrase	Stx2-converting_phage(43.75%)	55	1201216:1201231	1219164:1219179
WP_085961182.1|1181904_1183118_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000493084.1|1183734_1184295_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001039007.1|1184337_1184961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240833.1|1186350_1190163_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.7	1.1e-23
WP_025380314.1|1190251_1191871_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001219669.1|1191886_1192255_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_122994603.1|1192268_1193030_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000049966.1|1193033_1193582_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000106017.1|1193603_1193885_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_025380315.1|1193920_1195081_+	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_025380316.1|1195154_1197713_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000367822.1|1197717_1198941_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_000137010.1|1198937_1199891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192027.1|1199901_1200609_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-35
WP_025380317.1|1200592_1201249_+	hypothetical protein	NA	NA	NA	NA	NA
1201216:1201231	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_025380318.1|1201249_1202560_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001055485.1|1202568_1203357_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_025380319.1|1203353_1204742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122994604.1|1204755_1205697_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_025380321.1|1205693_1206680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|1207046_1208249_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282206.1|1208435_1210253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1211364_1211661_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1211887_1212085_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|1212303_1213737_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1214557_1215121_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1215275_1217636_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_025380322.1|1218392_1219931_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
1219164:1219179	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_000612591.1|1219980_1220328_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1220324_1220705_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032210650.1|1221195_1222050_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_028913479.1|1222096_1222702_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|1222749_1223001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1223024_1223315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|1224000_1224360_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591994.1|1224452_1226072_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1226296_1226572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886249.1|1226952_1227732_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1227741_1228044_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612148.1|1228052_1228373_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000467898.1|1228398_1230069_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1230078_1230543_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1230543_1231218_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1231229_1231847_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1233056_1233320_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1233621_1233762_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397130.1|1234632_1235304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1237491_1237917_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1237913_1238264_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1238294_1239908_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957249.1|1240811_1241192_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_144319762.1|1241178_1241445_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000422741.1|1241498_1241924_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1241920_1242271_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1242301_1243915_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 4
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	1394149	1455451	5402276	terminase,tRNA,portal,capsid,head,tail,integrase,transposase,holin	Stx2-converting_phage(22.73%)	77	1392461:1392476	1461252:1461267
1392461:1392476	attL	GCTTGTATTCGCGATG	NA	NA	NA	NA
WP_085961182.1|1394149_1395362_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001331716.1|1396250_1396415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|1396418_1396637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379598.1|1396796_1396952_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000787426.1|1397155_1397563_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	8.3e-28
WP_000912290.1|1397639_1397867_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_025380328.1|1397850_1398402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380329.1|1398373_1399414_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_157832601.1|1399325_1399868_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_025380330.1|1399897_1400320_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	69.1	4.4e-48
WP_072131549.1|1400320_1400734_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	5.0e-57
WP_000063625.1|1400782_1400995_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_032206192.1|1401030_1401864_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_001278459.1|1401973_1402078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813256.1|1402321_1402477_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_071826518.1|1402746_1402986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162212.1|1403052_1403331_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_025380331.1|1403332_1404382_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_025380332.1|1404394_1404769_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	4.9e-35
WP_000762928.1|1404765_1405587_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_025380333.1|1406757_1408608_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411804.1|1409057_1409264_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1409519_1409792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1409951_1410485_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1411131_1411338_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1411402_1411627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1411983_1412124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1412253_1412439_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_001372000.1|1412480_1412846_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_000958387.1|1413134_1413698_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001299337.1|1413694_1415356_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000173031.1|1415419_1417357_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1417401_1417623_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_038428807.1|1417568_1419986_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	93.2	0.0e+00
WP_000125990.1|1419988_1420315_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1420324_1420675_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1420671_1421118_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_158414416.1|1421114_1421258_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	7.9e-18
WP_025380305.1|1422240_1422840_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	1.2e-110
WP_025380335.1|1422904_1424218_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_024262417.1|1424219_1424489_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
WP_115801847.1|1424595_1424685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1424704_1427053_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_025380336.1|1427643_1431045_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	2.3e-219
WP_122994605.1|1431213_1431789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1431811_1431937_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1432016_1432292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1432352_1433714_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799400.1|1434077_1434941_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1434924_1436061_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1436310_1437537_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1437585_1438707_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1438955_1440185_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1440548_1440737_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1440786_1441113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1441237_1441411_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1441541_1441739_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1441731_1441944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1441933_1442398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1442390_1442624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1442629_1442929_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1442925_1444326_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|1444526_1444778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1444774_1445185_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1445195_1445468_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1445594_1445819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1446070_1446277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1446276_1447332_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1447344_1447680_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1447692_1448106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1448311_1448854_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1449110_1449392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1449993_1451454_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1451453_1452125_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1452293_1453664_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1453667_1454309_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|1454344_1455451_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1461252:1461267	attR	CATCGCGAATACAAGC	NA	NA	NA	NA
>prophage 5
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	1570122	1631390	5402276	terminase,capsid,tail,integrase,transposase,head,protease	Stx2-converting_phage(31.43%)	66	1569959:1569986	1615547:1615574
1569959:1569986	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1570122_1571253_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1571230_1571479_-	excisionase	NA	NA	NA	NA	NA
WP_025380344.1|1571543_1574015_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|1574110_1574299_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1574295_1574484_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1574889_1575057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1575050_1575284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1575261_1575669_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1575691_1575910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1575982_1576282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1576546_1576954_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1577030_1577258_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1577241_1577793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020557.1|1577764_1578805_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_157832601.1|1578716_1579259_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1579292_1580027_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|1580023_1580188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1580885_1581644_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1581922_1582135_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1582355_1582613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1582682_1582961_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_025380345.1|1582962_1584021_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	4.9e-88
WP_000140002.1|1584021_1584387_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1584383_1585073_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001358663.1|1585622_1586819_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_025380346.1|1587324_1587888_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	6.8e-89
WP_025380347.1|1587884_1589546_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.0	0.0e+00
WP_025380348.1|1589609_1591547_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.2	0.0e+00
WP_001063097.1|1591591_1591813_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	1.3e-35
WP_000125988.1|1594501_1594828_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007889.1|1594838_1595189_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|1595185_1595632_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1595628_1595973_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_025380351.1|1596040_1596757_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	97.5	2.2e-124
WP_000710962.1|1596771_1597146_+|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001453698.1|1597241_1597451_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_025380352.1|1597502_1600745_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.5	0.0e+00
WP_000807964.1|1600737_1601079_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025380353.1|1601078_1601777_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	3.4e-130
WP_000170104.1|1601793_1602048_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000410309.1|1602157_1602310_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1602573_1603452_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_025380354.1|1603505_1604243_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	99.2	7.0e-150
WP_144319768.1|1604188_1604821_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.1	2.2e-104
WP_025380356.1|1605056_1608530_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.6	0.0e+00
WP_001303943.1|1609831_1610110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1610537_1610684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1610820_1611468_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1611651_1612242_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1615004_1615223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1615724_1616231_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1615547:1615574	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056550.1|1616276_1616777_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_021556734.1|1616862_1617042_-	general stress protein	NA	NA	NA	NA	NA
WP_000443065.1|1617422_1618229_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1618228_1619422_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001612893.1|1619433_1620792_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763498.1|1620795_1622391_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194605.1|1622390_1623953_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1624044_1624089_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285684.1|1624226_1625108_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1625104_1625725_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022581766.1|1625752_1627648_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291215.1|1627860_1628736_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1628775_1629366_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1629362_1630121_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|1630340_1631390_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	1917488	1970764	5402276	terminase,portal,capsid,tail,holin,integrase,head	Escherichia_phage(34.55%)	67	1924181:1924196	1975201:1975216
WP_001023381.1|1917488_1917758_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_025380386.1|1917759_1919073_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	1.7e-77
WP_025380387.1|1919137_1919737_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	2.2e-109
WP_025380388.1|1919803_1923283_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.6	0.0e+00
WP_072141513.1|1923529_1924162_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_025380389.1|1924107_1924851_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	1.0e-148
1924181:1924196	attL	CGCCAGACAGAATGCG	NA	NA	NA	NA
WP_001448322.1|1924856_1925555_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000847298.1|1925554_1925884_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|1925880_1928493_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|1928473_1928887_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1928913_1929336_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235101.1|1929349_1930102_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	3.2e-134
WP_000683137.1|1930109_1930505_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975099.1|1930501_1931080_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752994.1|1931091_1931445_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1931456_1931852_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1931893_1932919_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|1932974_1933307_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123292.1|1933316_1934636_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_025380390.1|1934616_1936218_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198153.1|1936214_1936421_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027330.1|1936417_1938343_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1938317_1938863_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|1939258_1939483_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1939564_1939879_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1940406_1940592_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280929.1|1940819_1940951_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|1940963_1941146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992157.1|1941301_1941835_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_000731192.1|1941885_1942230_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000284518.1|1942234_1942450_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_025380391.1|1942599_1944453_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000483509.1|1945096_1946155_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_032324269.1|1946306_1946504_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_001064906.1|1946716_1947406_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_024221875.1|1947402_1947762_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	8.0e-35
WP_001265167.1|1947774_1948824_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_072128871.1|1948825_1949104_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	3.7e-11
WP_000902693.1|1949271_1949484_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_001278450.1|1949673_1949778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555106.1|1949893_1950607_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_000063625.1|1950807_1951020_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_072095809.1|1951068_1951479_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	5.0e-57
WP_001266130.1|1952117_1952414_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_022582018.1|1952410_1952803_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	5.9e-39
WP_000450861.1|1952818_1953589_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	1.2e-80
WP_000790459.1|1953618_1954359_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000095674.1|1954365_1955334_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000693888.1|1955356_1955782_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1955765_1956047_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|1956147_1956567_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379563.1|1956832_1956985_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000394546.1|1956996_1957635_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1957635_1957845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1958409_1958598_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1958594_1958783_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102128.1|1958875_1961338_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_001368608.1|1961425_1961662_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|1961681_1962977_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|1962996_1963107_-	transporter	NA	NA	NA	NA	NA
WP_025380392.1|1963164_1964184_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	6.1e-19
WP_001295394.1|1964195_1965410_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000705197.1|1966076_1966418_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138582.1|1966452_1967013_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1967015_1967726_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1967833_1968139_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041657.1|1968337_1970764_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
1975201:1975216	attR	CGCCAGACAGAATGCG	NA	NA	NA	NA
>prophage 7
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	2224014	2321504	5402276	tRNA,terminase,capsid,tail,holin,integrase,head,protease	Enterobacteria_phage(26.98%)	103	2288335:2288350	2314384:2314399
WP_000984517.1|2224014_2224896_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055791.1|2225087_2227136_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431368.1|2227155_2227854_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043887.1|2227950_2228448_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001400643.1|2228577_2229861_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2229829_2232463_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024221588.1|2232542_2233982_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2234099_2234336_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929526.1|2234356_2234632_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812714.1|2234632_2235289_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976475.1|2235683_2236025_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|2236037_2236910_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168738.1|2236913_2237288_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2237426_2237657_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011656.1|2237758_2238415_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944252.1|2238438_2239101_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936914.1|2239097_2241158_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024746.1|2241366_2242026_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2242352_2242709_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2242775_2243066_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2243199_2244378_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2244433_2245075_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2245111_2246923_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2247157_2248633_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|2248970_2249840_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2249967_2251410_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2251540_2252512_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2252631_2253954_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2253969_2254902_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_025380414.1|2254980_2255736_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.7e-18
WP_000571478.1|2255732_2256518_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2256763_2257774_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2257782_2258394_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072095795.1|2258532_2258598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|2258669_2259272_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2259273_2259795_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2259829_2260570_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032161923.1|2260598_2261051_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258668.1|2261168_2262941_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891626.1|2263250_2263817_+	hydrolase	NA	NA	NA	NA	NA
WP_001261931.1|2264134_2264383_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_144319764.1|2264754_2265768_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2265982_2266060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023400.1|2266170_2266440_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_025380416.1|2266441_2267755_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.9	1.1e-76
WP_001230428.1|2267819_2268419_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000515051.1|2268489_2271987_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_000649829.1|2272120_2272648_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2272838_2273471_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2273416_2274160_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_012817889.1|2274170_2274869_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	1.6e-127
WP_000807964.1|2274868_2275210_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025380417.1|2275202_2278445_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.1	0.0e+00
WP_122993730.1|2278495_2278705_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710952.1|2278800_2279175_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275441.1|2279189_2279906_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2279972_2280317_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2280313_2280760_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2280756_2281107_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2281117_2281444_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063097.1|2283970_2284192_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	1.3e-35
WP_025380420.1|2284236_2286174_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.1	0.0e+00
WP_025380421.1|2286237_2287899_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_025380346.1|2287895_2288459_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	6.8e-89
2288335:2288350	attL	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
WP_025380422.1|2288748_2289114_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095736.1|2289155_2289383_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2289807_2289993_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_025380424.1|2290511_2291045_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	6.7e-102
WP_000284510.1|2291049_2291265_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|2291341_2291614_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|2291654_2291834_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000143119.1|2291969_2293907_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	98.9	0.0e+00
WP_001398907.1|2294150_2294474_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_000738072.1|2294771_2295041_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365678.1|2295052_2296012_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000483505.1|2296394_2297453_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_001204809.1|2298017_2298398_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|2298416_2299406_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|2299457_2299715_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|2299711_2301112_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|2301108_2301987_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|2301997_2302906_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621233.1|2302892_2303126_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_000587259.1|2303122_2303785_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|2303893_2304601_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|2304682_2304916_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|2305072_2305762_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|2305909_2306611_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|2306607_2306808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365075.1|2307193_2307766_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|2308135_2308963_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|2309003_2309375_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|2309566_2309821_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|2309854_2311141_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_095585797.1|2311157_2311922_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.6e-72
WP_000252980.1|2311974_2312370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019617.1|2312410_2313154_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000564736.1|2313150_2314122_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176856.1|2314286_2316716_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
2314384:2314399	attR	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
WP_001214304.1|2316740_2317841_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185723.1|2318228_2318975_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|2318988_2319555_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2319770_2321504_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 8
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	2419542	2475898	5402276	terminase,plate,portal,capsid,tail,holin,integrase,head	Enterobacteria_phage(32.73%)	68	2467048:2467107	2496444:2496527
WP_095111390.1|2419542_2419674_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|2420020_2421001_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001371738.1|2421177_2421447_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	9.3e-44
WP_025380433.1|2421448_2422654_-|tail	tail fiber protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.0	1.1e-80
WP_001585354.1|2422718_2423318_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	5.2e-111
WP_025380434.1|2423384_2426861_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.3	0.0e+00
WP_144319769.1|2427110_2427743_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.7e-102
WP_025380436.1|2427688_2428432_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.6e-146
WP_025380437.1|2428442_2429141_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	5.6e-133
WP_000847304.1|2429140_2429470_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_025380301.1|2429466_2432046_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
WP_000533425.1|2432026_2432440_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2432466_2432898_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000106789.1|2432911_2433664_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	3.2e-134
WP_000683066.1|2433671_2434067_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_025380299.1|2434063_2434597_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204549.1|2434612_2434966_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201523.1|2434958_2435333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2435384_2436413_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2436470_2436818_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253961.1|2436854_2438360_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_025380273.1|2438349_2439942_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_000259002.1|2439938_2440145_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816790.1|2440128_2442057_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000235436.1|2442028_2442538_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2442932_2443157_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2443238_2443553_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025380438.1|2444080_2444266_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	82.0	3.4e-21
WP_000675931.1|2444487_2444601_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000992146.1|2444822_2445356_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	6.7e-102
WP_000731241.1|2445406_2445751_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|2445755_2445971_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_025380439.1|2446123_2447974_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.4	0.0e+00
WP_025380440.1|2448545_2448977_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	9.6e-67
WP_144319765.1|2449427_2450141_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2450278_2450476_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640035.1|2450700_2451255_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_025380442.1|2451263_2451623_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	7.3e-36
WP_001265229.1|2451635_2452685_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2452686_2452959_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2453080_2453425_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2453544_2453757_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2453990_2454548_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2454549_2454768_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2454895_2455207_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2455199_2455427_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|2455423_2455705_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|2455737_2456454_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_025380443.1|2456475_2457222_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.0	1.5e-115
WP_025380444.1|2457228_2458335_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_000693858.1|2458406_2458832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747948.1|2458815_2459058_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2459449_2459788_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_001345283.1|2460080_2460233_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2460244_2460883_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2460883_2461093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2461657_2461846_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2461842_2462031_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025380445.1|2462123_2464631_+	exonuclease	NA	V5UQJ3	Shigella_phage	43.4	2.3e-104
WP_000096346.1|2464689_2464893_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533625.1|2464892_2465918_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001302302.1|2466153_2466951_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2467048:2467107	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_025380446.1|2467288_2468551_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	7.6e-72
WP_001242259.1|2471542_2471815_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000983666.1|2471965_2472220_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
WP_000235844.1|2472216_2472678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022581241.1|2473013_2474075_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025380447.1|2474038_2475898_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2496444:2496527	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
>prophage 9
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	2622752	2664612	5402276	tRNA,plate,terminase,portal,lysis,capsid,tail,head,transposase,holin	Escherichia_phage(38.1%)	50	NA	NA
WP_025380459.1|2622752_2624156_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2624152_2624875_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2625065_2625398_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2625544_2626906_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_033810209.1|2627178_2627397_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	2.3e-37
WP_025380460.1|2627478_2628642_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_025380461.1|2628641_2629121_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.1e-84
WP_025380462.1|2629135_2631583_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.0	0.0e+00
WP_000785970.1|2631575_2631695_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031312.1|2631727_2632003_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001516653.1|2632059_2632578_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	98.3	3.6e-92
WP_025380463.1|2632590_2633781_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	8.1e-225
WP_001704939.1|2634230_2634443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380464.1|2634417_2635230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164146.1|2635571_2636099_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.7	1.9e-88
WP_000104679.1|2636102_2638031_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.2	6.6e-224
WP_001285314.1|2638041_2638572_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_025380465.1|2638564_2639473_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.7e-161
WP_000127158.1|2639477_2639825_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
WP_025380466.1|2639821_2640457_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.2e-112
WP_025380467.1|2640540_2641326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380468.1|2641397_2641850_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917151.1|2641842_2642310_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_072127674.1|2642272_2642446_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_000040677.1|2642399_2642843_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_038428851.1|2642830_2643256_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	2.8e-58
WP_000123123.1|2643766_2644048_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2644051_2644255_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2644254_2644764_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203465.1|2644863_2645607_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	1.9e-123
WP_001248561.1|2645610_2646684_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_001085958.1|2646742_2647597_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
WP_000156875.1|2647770_2649543_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038198.1|2649542_2650577_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	100.0	4.9e-202
WP_106121066.1|2650889_2652782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548273.1|2652912_2653377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174129.1|2653390_2654299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380469.1|2654421_2656695_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.1	0.0e+00
WP_000027667.1|2656684_2656960_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|2656956_2657181_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|2657183_2657483_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_025380470.1|2657482_2657707_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217677.1|2657770_2658271_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|2658448_2658724_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2658845_2659145_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_025380472.1|2659575_2661114_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_000612591.1|2661163_2661511_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2661507_2661888_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001318299.1|2662989_2663307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2663712_2664612_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 10
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	2688037	2768442	5402276	tRNA,terminase,capsid,tail,holin,integrase,head	Enterobacteria_phage(34.25%)	84	2708651:2708670	2765949:2765968
WP_001400694.1|2688037_2690071_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001556120.1|2694015_2697648_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|2697708_2698026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|2698332_2699421_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|2699431_2701711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|2701703_2702840_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2702836_2704837_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2704961_2705423_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_025380475.1|2705462_2705933_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.3e-81
WP_000598641.1|2705979_2706699_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2706695_2708381_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2708651:2708670	attL	CCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261970.1|2708895_2709144_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	98.8	9.1e-38
WP_001340524.1|2709348_2710557_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.8	2.0e-231
WP_025380476.1|2711208_2712444_+	NADPH-dependent L-lysine N(6)-monooxygenase MbtG	NA	H6WZN2	Escherichia_phage	93.0	1.0e-230
WP_001121228.1|2714653_2715304_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.1	2.3e-120
WP_001370116.1|2715528_2716134_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_025380479.1|2717057_2717327_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_025380480.1|2717328_2718642_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.2e-77
WP_001585354.1|2718706_2719306_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	5.2e-111
WP_025380481.1|2719372_2722852_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.6	0.0e+00
WP_077818983.1|2723089_2723722_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.6	1.5e-105
WP_025380483.1|2723667_2724411_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	8.6e-148
WP_025380484.1|2724421_2725120_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.8e-132
WP_000807954.1|2725119_2725461_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025380485.1|2725453_2728696_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.8	0.0e+00
WP_001453698.1|2728747_2728957_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2729052_2729427_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_025380486.1|2729432_2730149_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	96.6	7.5e-125
WP_000133393.1|2730216_2730561_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2730557_2731004_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|2731000_2731351_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|2731361_2731688_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_025380489.1|2734214_2734436_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	94.5	1.6e-33
WP_025380490.1|2734480_2736418_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.3	0.0e+00
WP_025380491.1|2736481_2738143_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_025380492.1|2738139_2738703_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	5.2e-89
WP_025380422.1|2738991_2739357_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095732.1|2739398_2739599_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000828070.1|2739730_2740057_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|2740457_2740643_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|2740865_2740997_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661708.1|2741091_2741787_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_025380493.1|2742060_2742594_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
WP_024216148.1|2742644_2742989_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
WP_000411813.1|2742993_2743200_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_025380494.1|2743492_2745343_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001299632.1|2745821_2746253_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|2746442_2746652_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|2746704_2746929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|2747785_2748712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|2748698_2749247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2749259_2749601_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_025380495.1|2749618_2750608_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.5e-192
WP_001223334.1|2750617_2751133_-	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001061444.1|2751148_2751958_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|2751977_2752367_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|2752363_2752690_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|2752686_2753340_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072141877.1|2753339_2753834_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000104976.1|2753830_2754772_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_001188051.1|2754761_2754941_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_000514170.1|2755116_2755701_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.4	6.5e-58
WP_000098316.1|2755729_2755993_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_001410974.1|2756099_2756804_+	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	58.7	1.3e-68
WP_000606712.1|2757037_2758123_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	39.0	1.2e-60
WP_000135680.1|2759055_2759418_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|2759483_2760308_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_001401560.1|2760435_2760972_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_025380496.1|2760962_2761325_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	1.4e-66
WP_001571184.1|2761321_2761525_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	97.0	1.8e-31
WP_023352820.1|2761517_2761757_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_025380497.1|2761753_2762305_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	98.9	5.1e-97
WP_025380498.1|2762309_2762498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051494563.1|2762588_2763065_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	80.9	1.4e-15
WP_106425043.1|2763121_2763256_+	hypothetical protein	NA	G9L660	Escherichia_phage	97.7	3.8e-14
WP_024247164.1|2763258_2763849_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	99.5	2.1e-117
WP_000457728.1|2763936_2764179_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2764182_2764317_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2764335_2764590_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2764623_2765910_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_029208472.1|2765930_2766632_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
2765949:2765968	attR	CCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2766691_2766799_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2766779_2767511_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2767515_2768442_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 11
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	3236062	3323026	5402276	tRNA,terminase,capsid,tail,holin,transposase,head	Stx2-converting_phage(36.54%)	86	NA	NA
WP_001295363.1|3236062_3236800_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|3236931_3238266_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|3238298_3239180_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189191.1|3239282_3239870_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3239925_3240309_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262720.1|3240613_3241303_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3241350_3242388_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3242594_3243014_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_024221634.1|3243082_3243781_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082991.1|3243812_3246473_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3246586_3247942_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464869.1|3247966_3248311_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001235102.1|3255385_3257959_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040153.1|3258088_3258820_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079110.1|3258816_3259797_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3259931_3260669_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3260939_3261281_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3261384_3261432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200122.1|3261530_3262691_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3262733_3263855_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3263865_3264936_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3265146_3265512_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212383.1|3265661_3266180_+	YfiR family protein	NA	NA	NA	NA	NA
WP_025380540.1|3266172_3267396_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589825.1|3267411_3267894_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3267970_3268318_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3268359_3269127_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3269157_3269706_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3269724_3269973_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3270109_3271471_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3271562_3272429_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032149952.1|3272449_3273736_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3273790_3274384_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3274505_3275384_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880920.1|3275469_3277131_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3277279_3277621_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3277682_3277973_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3277962_3278439_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3278570_3279053_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3279901_3280150_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001121225.1|3280742_3281393_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491541.1|3281617_3282493_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023407.1|3282633_3282903_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_085961182.1|3282971_3284184_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_025380541.1|3284187_3285531_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.2	9.0e-79
WP_025380542.1|3285595_3286195_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_025380543.1|3286261_3289738_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_144319771.1|3289978_3290608_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	97.1	3.2e-103
WP_025380545.1|3290553_3291297_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	2.3e-148
WP_025380546.1|3291307_3292006_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000807954.1|3292005_3292347_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025380485.1|3292339_3295582_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.8	0.0e+00
WP_001453698.1|3295633_3295843_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710962.1|3295938_3296313_-|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_025380547.1|3296327_3297044_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	7.8e-122
WP_000133393.1|3297111_3297456_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|3297452_3297899_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|3297895_3298246_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|3298256_3298583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_025380550.1|3301595_3301817_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	3.9e-32
WP_025380551.1|3301861_3303799_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.3	0.0e+00
WP_025380552.1|3303862_3305524_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.7	0.0e+00
WP_000958387.1|3305520_3306084_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3306375_3306741_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3306782_3307010_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3307434_3307620_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3307847_3307994_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_038428882.1|3307993_3308563_-	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000992148.1|3308833_3309367_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3309417_3309762_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3309766_3309982_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_025380554.1|3310131_3311985_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000499458.1|3312276_3312444_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3312529_3313273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3313525_3314149_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3314145_3314811_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_025380555.1|3314807_3315419_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	96.6	1.3e-93
WP_001108081.1|3315393_3315960_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_000612800.1|3316505_3317396_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	2.2e-150
WP_024167731.1|3317449_3318277_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.9	1.7e-149
WP_001254222.1|3318780_3318963_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_025380556.1|3318959_3319487_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	100.0	1.2e-100
WP_000736898.1|3319483_3319924_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145931.1|3319997_3320288_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_025380557.1|3320284_3320986_-	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	2.4e-128
WP_085961182.1|3321813_3323026_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 12
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	4415592	4422102	5402276		Enterobacteria_phage(100.0%)	9	NA	NA
WP_025380631.1|4415592_4416165_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.4	1.5e-96
WP_000984201.1|4416179_4416425_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_025380632.1|4416421_4417156_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	1.5e-128
WP_001149160.1|4417707_4417974_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001360858.1|4417970_4418570_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001244665.1|4418562_4418850_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459311.1|4418842_4419298_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856729.1|4419433_4419754_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025380633.1|4419768_4422102_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
>prophage 13
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	5092636	5149824	5402276	transposase,protease	Klosneuvirus(11.11%)	58	NA	NA
WP_001162171.1|5092636_5093989_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5094083_5094635_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5094790_5096164_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|5096339_5097338_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|5097370_5098366_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|5098352_5099375_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025380675.1|5099388_5100891_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	9.0e-11
WP_000265933.1|5101030_5101987_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|5102296_5102827_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|5103206_5103548_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060972.1|5103550_5107330_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269316.1|5107326_5109060_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|5109265_5109904_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5110226_5111570_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5111631_5111838_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175286.1|5112162_5112720_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886900.1|5112709_5113450_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589409.1|5113639_5115583_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5115705_5116086_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560597.1|5116174_5117035_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001295194.1|5117143_5118109_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|5118216_5118879_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5118923_5120336_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5120644_5121265_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|5121482_5122121_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_071826550.1|5122267_5123464_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	7.2e-205
WP_001526538.1|5123471_5124086_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001586585.1|5124528_5125323_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5125393_5125843_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5125884_5126112_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5126116_5126431_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|5126437_5126833_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|5127159_5127435_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|5127564_5128251_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949501.1|5128250_5129105_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5129114_5129765_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776521.1|5129778_5130243_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5130252_5130558_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_025380677.1|5130573_5131971_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|5132325_5133390_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|5133497_5134253_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569713.1|5134249_5134999_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5135180_5135510_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5135658_5135934_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001305666.1|5136050_5137676_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5137759_5138923_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101676.1|5138925_5139564_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5139573_5139972_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012565.1|5139989_5140649_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5140699_5141398_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220123.1|5141416_5141818_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5141944_5142676_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|5142766_5145208_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|5145246_5145672_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5145876_5147175_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5147278_5147476_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5147557_5148562_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5148564_5149824_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 14
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	5233859	5240396	5402276	transposase	Stx2-converting_phage(33.33%)	12	NA	NA
WP_001234620.1|5233859_5234678_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849588.1|5234732_5235218_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001560709.1|5235233_5235710_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|5235772_5235994_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001315620.1|5236156_5236525_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854753.1|5236614_5236989_+	toxin	NA	NA	NA	NA	NA
WP_000777547.1|5236985_5237474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|5237485_5237683_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_025380687.1|5237767_5237965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|5237979_5238405_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|5238401_5238752_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|5238782_5240396_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 15
NZ_CP006262	Escherichia coli O145:H28 str. RM13516 chromosome, complete genome	5402276	5317103	5370037	5402276	terminase,portal,tail,integrase,transposase,holin,protease	Enterobacteria_phage(54.72%)	62	5316305:5316319	5347265:5347279
5316305:5316319	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218283.1|5317103_5318321_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000421881.1|5318454_5320587_+	hypothetical protein	NA	A5LH58	Enterobacteria_phage	99.7	0.0e+00
WP_025380694.1|5320888_5321509_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	1.4e-111
WP_001404194.1|5321508_5321871_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_001401560.1|5321861_5322398_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_025380695.1|5322525_5323350_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.2	3.3e-148
WP_001564324.1|5323415_5323778_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_025380696.1|5324246_5324663_+	hypothetical protein	NA	U5P096	Shigella_phage	98.4	1.2e-66
WP_025380698.1|5325834_5326041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|5326288_5326915_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|5327012_5327213_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|5327250_5327802_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_071826555.1|5327977_5328157_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	6.6e-14
WP_000104954.1|5328146_5329088_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_000055633.1|5329090_5329570_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	68.9	4.6e-54
WP_000210156.1|5329569_5329896_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_021518590.1|5329892_5330282_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	3.9e-67
WP_025380699.1|5330301_5331099_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	3.4e-150
WP_016230662.1|5331106_5332096_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|5332109_5332862_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_000087756.1|5333277_5333490_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|5333790_5334006_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|5334758_5334974_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189905.1|5334978_5335530_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.9e-35
WP_001306174.1|5335477_5335738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101174.1|5335851_5336385_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	3.2e-96
WP_001071778.1|5336381_5336879_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5337242_5337455_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071826569.1|5337465_5337654_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5337801_5337957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024256583.1|5338129_5338303_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_025380700.1|5338598_5338805_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	1.7e-21
WP_000349509.1|5339357_5339849_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934113.1|5339848_5341951_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|5341947_5342160_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5342159_5343668_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|5343612_5345640_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097042.1|5345726_5346050_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.2e-51
WP_001283153.1|5346042_5346318_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|5346329_5346908_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_024221681.1|5346904_5347306_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	5.4e-72
5347265:5347279	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_025380472.1|5347523_5349062_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_000612591.1|5349111_5349459_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5349455_5349836_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_096954929.1|5349916_5350510_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	6.9e-100
WP_001372042.1|5350570_5350957_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|5350965_5351295_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372002.1|5351266_5354332_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.0	0.0e+00
WP_000447248.1|5354331_5354661_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152362.1|5354670_5355369_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	1.6e-132
WP_025380703.1|5356022_5356670_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.5e-111
WP_025380704.1|5356730_5360129_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_025380705.1|5360195_5360795_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	3.7e-109
WP_025380706.1|5360859_5364213_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.1e-12
WP_000885593.1|5364212_5364788_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
WP_000086527.1|5364885_5365476_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|5365854_5366088_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|5366156_5366270_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5366696_5366945_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5367164_5368751_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5369143_5369749_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5369875_5370037_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NZ_CP006263	Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence	98066	22644	72649	98066	transposase,integrase	Stx2-converting_phage(38.46%)	54	13030:13089	73829:75051
13030:13089	attL	GGTGATATTCTCACCACAACACAAAACAGGTGACTTAATGAACAAGAAAACCAAACGAAC	NA	NA	NA	NA
WP_025380712.1|22644_23832_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001014903.1|25139_25382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302199.1|25648_26470_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|26469_27576_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|27669_29391_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_077629919.1|29464_30463_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_025380713.1|30766_32305_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	8.4e-299
WP_000612632.1|32354_32702_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001171554.1|32698_33079_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000422741.1|33241_33667_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|33663_34014_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|34044_35658_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000139321.1|35768_36329_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704529.1|36431_37292_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205715.1|37350_38097_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	1.2e-08
WP_025380714.1|38116_43387_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001369365.1|43386_45540_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000782454.1|45791_46523_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_021514836.1|46571_47051_-	surface exclusion inner membrane protein	NA	NA	NA	NA	NA
WP_085961182.1|49683_50896_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001278689.1|51205_51427_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_021532964.1|51561_52077_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038348.1|52073_52325_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_071826576.1|52317_52671_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_025380716.1|52624_53212_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_025380717.1|53201_54629_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|54628_55333_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|55343_55910_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|55931_56243_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|56257_56617_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|56650_56878_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_025380718.1|56972_57659_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|57849_58233_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_122994606.1|58509_59157_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234426.1|59453_60275_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	5.7e-44
WP_000107535.1|60392_60680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077632690.1|60912_61101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|61601_61760_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299721.1|61839_62028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276238.1|62039_62759_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_025380720.1|62755_63190_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_025380721.1|63469_63703_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_025380722.1|63765_64305_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_001027500.1|65145_65337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044697612.1|65333_65798_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072128865.1|65797_66100_-	antirestriction protein	NA	NA	NA	NA	NA
WP_077697906.1|66195_66768_-	YubH family protein	NA	NA	NA	NA	NA
WP_033810170.1|67113_67419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001418214.1|67422_67836_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000091308.1|68600_68966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380712.1|68965_70153_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000526859.1|70365_70545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368887.1|70747_71122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066926.1|71908_72649_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
73829:75051	attR	GTTCGTTTGGTTTTCTTGTTCATTAAGTCACCTGTTTTGTGTTGTGGTGAGAATATCACCTTTCATCAGGTGGCCAAATTTAGTGTGCCACTACATCCTTATATAAGCAGTGGTCAGCAGAACAGACATAACATAAGCTGGAGCATGTATATAAGCTGTAGTGAGTAAGTCATGTTTTATGAAGGGAGCAATGCCTCAGCATCAGGTTACGGGATCACTTACGTAAGGGACAGCAGATGGCAGCTCAGCTACAGACAGCACTGCAGGAAACAGAATATAAACTGCAGTGAGCAAACCACTCACTGCCCCGGTTAATATAAGCTGTAGTCAGTAAAGGAGCGATCTTCACTGACTACAGTTTATGTTCAGCGGGATTTGAAGAGTTTTTCCAAGTCATCCAGCGTGATGCCCAGTTTCTCAAGCAGGGCAAGCTTCTCCGCCATCTCCGGACTGACTTTTTCCGCAGGTGAAGGTGGCAACGGATTTTCCTTACTCTCATCATTCGGCGCTTTTAACCGGGGACGCCGGTAGTGAATACAGAAGAGTTTTGTCCGTCCCCGCTGGATCTCAGTGTAATCAAGATATCCAATCTCACGCAATTGCTCCATTGCCCGTCTGACCGTCTGGTTCTGGGAAAATACCGGAGACTTCAGATTGAGGCGTGCACGCAGCCGCGCCAGCGATATCGGTGCCGGATCCCGGGGCAGGCTCTCTATAAAGGTGTAGAGTGCCTGGGCGGACTCACGTCGCTTCAGGGCATTAATCGCCTTAAGCTGGAGAAGAACTTTTCTGTCAAACTGGTACAGTTCAAAAAGGCGGGGATCAGCCTGTAACTGAACAATATCCCGTTCAGTATCGTAGTAGGCTGACTGTACCAGATGAGTGATGTATTCCCGGGTGTGCTTCTCATCGGTGCGGGAAAAGGAGATCACGGTACCGGCAATGCGTTTCAGGGAAGGGCTGATGCGCTCACGCAGCCTGCGTGATGACTGGTTTGAAGGTATACCACACAGTTTTGCAAACTCGACAAAAGGTAGTTCAACTTTGTCACCAGTCACGTTATGGCGGGCAAAGGAATGAATGATCCCCACCCAGGTCTTGAAATCGTTATCCATATCCAGCCGGGGGCCGGTGATCTCAACCTTATCGAATCCCTCTGCACGGGCCAGGGAAAGACGTGTCAGTTCTTCCGTGGCATCAGTACGTGACAGTGTATTTTTTTT	NA	NA	NA	NA
