The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	85320	96548	4067985	integrase	Burkholderia_virus(22.22%)	10	82734:82751	99327:99344
82734:82751	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_038722961.1|85320_87408_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	3.2e-99
WP_004202928.1|87730_88630_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004553012.1|89812_90400_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.0	9.1e-44
WP_024430280.1|90779_91097_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	3.7e-15
WP_004530410.1|91096_92014_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922654.1|92267_92810_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.4	3.3e-48
WP_009932249.1|93067_93520_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_038723776.1|93519_94599_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	98.3	1.4e-159
WP_004525721.1|94755_95004_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004195754.1|95903_96548_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
99327:99344	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	276085	328977	4067985	protease,plate,transposase	Burkholderia_phage(33.33%)	55	NA	NA
WP_004196743.1|276085_276799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011852289.1|277089_281793_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_004521924.1|281886_283353_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_004521925.1|283633_285145_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004521926.1|285141_285702_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004527892.1|285899_287666_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_004521927.1|288268_289402_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004521928.1|289450_289648_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_004199935.1|289700_290516_+	thiazole synthase	NA	NA	NA	NA	NA
WP_004521929.1|290512_291616_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004521930.1|291715_292534_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.4e-20
WP_004199929.1|292530_293298_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004521931.1|293310_293886_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_004521932.1|293933_294893_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_004521933.1|295007_295640_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199923.1|295636_295906_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004554063.1|296201_297128_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	2.0e-21
WP_004199919.1|297124_297880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199917.1|297965_298205_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004521935.1|298218_299568_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_038722992.1|299564_300221_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004527888.1|300262_301600_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004521936.1|301755_302826_+	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.9	5.6e-15
WP_004199911.1|302889_303477_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004199909.1|303532_304153_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_004199907.1|304149_304791_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004199906.1|304958_305714_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004557290.1|305796_306570_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004201279.1|306569_306983_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004202813.1|306979_307348_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_004202812.1|307400_307790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185206.1|307818_308184_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_038722994.1|308272_308506_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004531855.1|308532_309060_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004199900.1|309098_309881_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	8.7e-26
WP_038722996.1|310225_311434_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	8.5e-12
WP_004202811.1|311455_312202_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|312422_313043_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004199894.1|313043_314426_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_004521940.1|314448_315207_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|315299_315911_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004199890.1|315980_316502_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_038723778.1|317195_317522_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	98.1	3.3e-51
WP_076882245.1|317823_318426_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	88.5	1.9e-81
WP_111952238.1|318822_319413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009922432.1|319516_319882_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	1.1e-52
WP_004521948.1|319983_320769_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038722998.1|320765_322112_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038723000.1|322220_322835_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|323209_323881_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|323917_324436_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|324452_325943_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|326015_326519_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|326576_327059_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038723001.1|327138_328977_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	657861	667106	4067985		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|657861_659814_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|660080_661211_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_038723056.1|661244_663251_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	1.9e-53
WP_004194137.1|663434_664250_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|664314_664998_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|664994_665522_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004522151.1|665558_667106_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	1002687	1011570	4067985		Bacillus_phage(16.67%)	8	NA	NA
WP_004522358.1|1002687_1004088_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|1004119_1005043_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|1005101_1006094_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|1006165_1006483_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004532363.1|1006864_1007767_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_038723131.1|1007993_1009283_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|1009461_1010385_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_063831528.1|1010727_1011570_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 5
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	1309339	1319630	4067985	lysis,integrase	Burkholderia_phage(33.33%)	11	1306540:1306555	1315710:1315725
1306540:1306555	attL	GCCGCCGCGTCGGCGG	NA	NA	NA	NA
WP_038723190.1|1309339_1312024_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_038723191.1|1312183_1313485_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	6.1e-149
WP_009890227.1|1313435_1313678_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_038723806.1|1313686_1314160_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	3.0e-05
WP_038723193.1|1314168_1314498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723808.1|1315508_1316054_+|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	96.1	4.1e-83
1315710:1315725	attR	GCCGCCGCGTCGGCGG	NA	NA	NA	NA
WP_038723194.1|1316197_1316986_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.3	1.0e-151
WP_004539736.1|1317026_1317737_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
WP_172644489.1|1317748_1318417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080278160.1|1318701_1319208_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.7	3.3e-18
WP_004539640.1|1319204_1319630_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
>prophage 6
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	1533475	1541663	4067985		Burkholderia_virus(50.0%)	13	NA	NA
WP_004196630.1|1533475_1533739_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076804731.1|1533722_1533908_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_038723235.1|1533928_1534654_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_038763587.1|1534660_1535263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063832618.1|1535604_1536111_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_012729878.1|1536107_1536530_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_004557051.1|1536810_1537206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|1537459_1537687_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004521250.1|1537722_1537971_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	60.6	4.6e-13
WP_004550288.1|1538031_1538493_-	avidin	NA	NA	NA	NA	NA
WP_004534930.1|1539426_1539609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193371.1|1539735_1540359_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004192901.1|1540553_1541663_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.0	7.8e-36
>prophage 7
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	2320968	2393660	4067985	tRNA,plate,transposase,coat	Klosneuvirus(14.29%)	56	NA	NA
WP_004542503.1|2320968_2323593_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_038723393.1|2324119_2325340_+	CoA transferase	NA	NA	NA	NA	NA
WP_004196731.1|2325675_2325915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2326164_2327874_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004552886.1|2328217_2328700_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	1.7e-19
WP_004545113.1|2328718_2329105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012730066.1|2329392_2331492_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_004521728.1|2331593_2332454_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_028359092.1|2332497_2333931_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2334164_2335748_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004538373.1|2335945_2337139_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_038723394.1|2337762_2338950_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_038723395.1|2339131_2340751_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038723396.1|2340752_2342462_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192810.1|2342764_2343397_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038723397.1|2343397_2345479_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2345889_2346855_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038723398.1|2346870_2349282_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038723400.1|2349326_2350166_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2350183_2350708_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|2350784_2351345_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004538378.1|2351397_2351943_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004531175.1|2352203_2352425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2352770_2353664_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038723401.1|2354107_2355367_+	MFS transporter	NA	NA	NA	NA	NA
WP_038723402.1|2355411_2356395_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2356862_2357144_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009927991.1|2357406_2357679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004554454.1|2358572_2359886_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_038723403.1|2360145_2361066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071897650.1|2361725_2362220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139777.1|2363294_2363741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723406.1|2364022_2364283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009951519.1|2364497_2364665_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	50.0	9.5e-07
WP_076851597.1|2365237_2365951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076882428.1|2366873_2367167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526764.1|2367507_2367753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972818.1|2367796_2368705_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004526762.1|2368662_2368914_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_004545145.1|2369044_2369965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723408.1|2370082_2372926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723410.1|2372922_2373798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723411.1|2373799_2376640_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	2.8e-21
WP_004521762.1|2376652_2376958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021251390.1|2376975_2377218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521767.1|2378307_2378799_-	lipoprotein	NA	NA	NA	NA	NA
WP_009973662.1|2378776_2382112_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038723412.1|2382220_2384629_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009943538.1|2384625_2385219_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038723414.1|2385215_2385773_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012730392.1|2385909_2386743_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038723415.1|2386745_2389556_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	5.7e-27
WP_004521773.1|2389589_2389817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009920929.1|2390076_2390343_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004521774.1|2390366_2391782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542513.1|2391809_2393660_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	2443602	2522377	4067985	tail,integrase,terminase,capsid,portal,holin,lysis,head	Burkholderia_virus(91.43%)	92	2463616:2463664	2522507:2522555
WP_038723436.1|2443602_2443848_+|integrase	tyrosine-type recombinase/integrase	integrase	A4PE72	Ralstonia_virus	73.2	3.2e-19
WP_038718123.1|2448010_2448271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038718126.1|2448381_2448600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972816.1|2449309_2449855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009970413.1|2449966_2450557_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	41.1	7.5e-22
WP_009970412.1|2451120_2451939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128972815.1|2452111_2452903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|2453624_2454455_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004521811.1|2455002_2455911_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_038723439.1|2456207_2456909_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	39.3	1.4e-11
WP_004531123.1|2456986_2457160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192280.1|2457171_2457285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193897.1|2457264_2458890_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	2.3e-68
WP_004192567.1|2459154_2459472_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_004531119.1|2459479_2460871_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004531118.1|2461132_2461324_-	lipoprotein	NA	NA	NA	NA	NA
WP_004191316.1|2461491_2461662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004266561.1|2461994_2462813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004550641.1|2462964_2463423_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
2463616:2463664	attL	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
WP_038723840.1|2463861_2464533_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	96.4	5.9e-132
WP_038723440.1|2464618_2465260_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	99.5	1.2e-118
WP_038723441.1|2465392_2466484_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	99.4	7.2e-212
WP_004552924.1|2466511_2467246_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
WP_076882068.1|2467242_2467803_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	98.9	1.8e-102
WP_038723442.1|2467984_2468911_-	hypothetical protein	NA	C7BGE2	Burkholderia_phage	53.9	3.0e-73
WP_038723443.1|2469019_2469808_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.7	5.5e-153
WP_038723444.1|2469950_2470496_-|lysis	lysis protein	lysis	A4JX21	Burkholderia_virus	87.8	1.7e-76
WP_038723445.1|2470495_2470987_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	96.9	2.1e-86
WP_004552929.1|2470979_2471192_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_038723446.1|2471234_2471978_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	71.6	2.1e-101
WP_080278171.1|2471977_2472244_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	75.0	2.4e-36
WP_038723447.1|2472282_2475594_-|tail	phage tail protein	tail	Q6JIL2	Burkholderia_virus	98.0	0.0e+00
WP_004526680.1|2475590_2476175_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	99.5	6.8e-100
WP_038723448.1|2476171_2476924_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	98.4	8.7e-148
WP_004549626.1|2476973_2477657_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	96.0	3.7e-129
WP_038723450.1|2477653_2479042_-|tail	tail fiber domain-containing protein	tail	Q6JIL6	Burkholderia_virus	94.4	7.0e-260
WP_004548805.1|2479050_2479389_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
WP_038723451.1|2479385_2483450_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	99.7	0.0e+00
WP_004526674.1|2483463_2483748_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	100.0	6.8e-45
WP_004548907.1|2483747_2484212_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	100.0	2.4e-84
WP_004549350.1|2484238_2484694_-	hypothetical protein	NA	A4JX07	Burkholderia_virus	100.0	7.5e-78
WP_015984957.1|2484755_2485103_-	hypothetical protein	NA	A4JX06	Burkholderia_virus	100.0	3.5e-59
WP_024429290.1|2485099_2485522_-	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	99.3	1.0e-68
WP_024429289.1|2485514_2485841_-|head	phage head closure protein	head	A4JX04	Burkholderia_virus	87.0	1.8e-49
WP_038723452.1|2485840_2486407_-	hypothetical protein	NA	A4JX03	Burkholderia_virus	71.8	1.6e-74
WP_024429287.1|2486413_2486599_-	hypothetical protein	NA	A4JX02	Burkholderia_virus	62.3	6.2e-15
WP_038723454.1|2486659_2487967_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	82.5	1.3e-194
WP_038723455.1|2488068_2489037_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	96.9	5.0e-164
WP_038723456.1|2489033_2490293_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	99.5	2.5e-240
WP_015984952.1|2490297_2490483_-	hypothetical protein	NA	A4JWZ8	Burkholderia_virus	100.0	2.0e-21
WP_038723457.1|2490479_2492195_-|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	99.8	0.0e+00
WP_004549538.1|2492198_2492675_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	99.4	2.1e-86
WP_004548856.1|2492826_2493183_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	100.0	3.3e-65
WP_004549735.1|2493241_2493499_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004548635.1|2493495_2493882_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
WP_080278149.1|2494477_2495461_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_076882155.1|2495958_2497125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080278150.1|2497060_2498815_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_076882153.1|2498790_2499276_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_038723459.1|2499613_2500261_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	90.7	3.3e-103
WP_038723461.1|2500840_2501266_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	99.3	1.3e-79
WP_038723462.1|2501262_2501637_-	hypothetical protein	NA	Q6JIF8	Burkholderia_virus	98.4	2.1e-62
WP_172644498.1|2501633_2502101_-	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	91.6	2.9e-77
WP_038723465.1|2502145_2503138_-	hypothetical protein	NA	A4JX55	Burkholderia_virus	99.1	3.4e-176
WP_004526650.1|2503291_2503552_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	100.0	4.2e-41
WP_038723466.1|2503548_2504370_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	99.6	2.3e-146
WP_024429365.1|2504404_2505367_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	99.3	3.5e-170
WP_024429366.1|2505804_2506119_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	98.1	1.6e-50
WP_038723467.1|2506265_2506706_-	phage regulatory CII family protein	NA	Q8W6P5	Burkholderia_virus	90.4	9.4e-70
WP_021251775.1|2506891_2507146_+	hypothetical protein	NA	Q8W6P6	Burkholderia_virus	98.8	9.4e-38
WP_038764272.1|2507375_2507708_-	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	96.4	8.4e-55
WP_004552953.1|2507824_2508139_-	helix-turn-helix domain-containing protein	NA	Q6JIG9	Burkholderia_virus	100.0	3.0e-54
WP_004552954.1|2508382_2508604_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	98.6	3.3e-31
WP_038723468.1|2508600_2508864_-	hypothetical protein	NA	Q6JIH1	Burkholderia_virus	98.9	3.2e-41
WP_004552955.1|2508947_2510237_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	100.0	1.5e-235
WP_004526641.1|2510391_2511285_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	99.3	4.3e-170
WP_038723469.1|2511786_2512062_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	97.8	2.3e-42
WP_038723472.1|2512415_2513030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172644481.1|2513110_2513428_+	hypothetical protein	NA	Q6JII2	Burkholderia_virus	97.1	2.5e-48
WP_038723473.1|2513424_2514237_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	98.9	2.2e-144
WP_038723475.1|2514510_2515218_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	91.1	7.2e-120
WP_038717937.1|2515231_2515903_+	hypothetical protein	NA	Q6JII5	Burkholderia_virus	96.4	7.5e-119
WP_080124839.1|2516163_2516382_+	hypothetical protein	NA	Q6JII7	Burkholderia_virus	98.6	1.0e-32
WP_004526632.1|2517586_2517844_+	hypothetical protein	NA	Q6JIJ0	Burkholderia_virus	100.0	1.7e-42
WP_015973597.1|2517836_2518079_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	100.0	1.9e-40
WP_038725203.1|2518068_2518407_+	hypothetical protein	NA	Q6JIJ2	Burkholderia_virus	98.2	2.9e-58
WP_038723477.1|2518403_2519351_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	62.3	1.9e-107
WP_038723479.1|2519341_2519584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723481.1|2519970_2520240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723482.1|2520491_2520701_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	2.4e-31
WP_004526625.1|2521052_2521277_+	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	100.0	2.9e-35
WP_004526624.1|2521276_2522377_+|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	100.0	5.4e-215
2522507:2522555	attR	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
>prophage 9
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	3075710	3086674	4067985	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|3075710_3078011_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|3078007_3078322_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|3078854_3079058_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_038723578.1|3079187_3080804_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3080816_3080999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3080971_3082231_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3082498_3083077_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3083339_3083558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|3083749_3084259_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|3084559_3086674_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 10
NZ_CP004042	Burkholderia pseudomallei MSHR146 chromosome 1, complete sequence	4067985	3927087	3977296	4067985	tRNA,portal,transposase	Leptospira_phage(23.08%)	49	NA	NA
WP_038802333.1|3927087_3928208_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_076848512.1|3928671_3929211_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_041190526.1|3930074_3930383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972475.1|3930477_3931251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723739.1|3931955_3932960_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004525845.1|3933493_3933976_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004523107.1|3933972_3934257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723740.1|3934330_3935422_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	92.6	6.8e-194
WP_038723741.1|3935820_3936285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723742.1|3936422_3937298_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.0	4.8e-73
WP_038723743.1|3937308_3938421_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_038723744.1|3938449_3939544_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038723745.1|3939686_3940655_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038723746.1|3940757_3941327_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_004525837.1|3941919_3942468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723747.1|3942731_3944180_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	3.7e-30
WP_038723748.1|3944198_3945812_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_038723749.1|3945970_3946912_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004523120.1|3946908_3948003_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	5.0e-19
WP_004197761.1|3948404_3948821_+	VOC family protein	NA	NA	NA	NA	NA
WP_004530511.1|3948968_3949523_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_004525830.1|3949738_3950086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524603.1|3950571_3951132_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004524602.1|3951293_3951464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553738.1|3951810_3951966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004538579.1|3952028_3953186_-	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_004535567.1|3953751_3954486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524586.1|3954677_3956081_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004198812.1|3956418_3956838_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004524584.1|3956994_3958671_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_009917973.1|3958679_3958985_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.6	1.9e-16
WP_038723750.1|3959028_3959496_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004198824.1|3959512_3959647_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_076882226.1|3959939_3961694_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004196275.1|3961856_3962960_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	1.7e-46
WP_004196276.1|3963148_3965617_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	9.3e-114
WP_128972801.1|3965862_3966363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723753.1|3966531_3967173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076861393.1|3967166_3968303_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076882227.1|3968605_3969076_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	59.7	4.4e-41
WP_038723754.1|3969076_3970735_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_038723755.1|3970738_3972391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723756.1|3972356_3973865_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	26.1	1.7e-25
WP_076861389.1|3973857_3974079_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_076861387.1|3974764_3975145_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038723881.1|3975224_3975485_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	58.5	1.3e-23
WP_076883614.1|3975500_3976025_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	1.9e-24
WP_004538383.1|3976063_3976264_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_038723757.1|3976276_3977296_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP004043	Burkholderia pseudomallei MSHR146 chromosome 2, complete sequence	3245118	324639	331633	3245118	transposase	Burkholderia_virus(50.0%)	8	NA	NA
WP_102812295.1|324639_325760_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	8.1e-49
WP_004537646.1|328267_328417_-	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_004542548.1|328672_329254_+	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_161788725.1|329484_329784_-	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	100.0	2.3e-35
WP_029248167.1|329750_329972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009975384.1|330248_330524_-	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	95.6	2.6e-41
WP_009939402.1|331191_331365_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|331348_331633_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
>prophage 2
NZ_CP004043	Burkholderia pseudomallei MSHR146 chromosome 2, complete sequence	3245118	484229	555765	3245118	plate,holin	Vibrio_phage(25.0%)	55	NA	NA
WP_004525541.1|484229_484997_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_038757552.1|485035_486037_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|486033_486807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|486803_487493_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|487857_489372_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_038729852.1|491091_492030_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004202234.1|492063_492612_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|492614_494120_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|494263_494791_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190879.1|494870_495302_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|495315_497178_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|497174_498164_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_041188165.1|498166_501037_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	1.8e-60
WP_004525548.1|501027_503319_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|503484_505773_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|505776_507993_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|507992_509063_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|509065_509782_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|509824_510214_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|510219_510813_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004525552.1|510809_512171_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004525553.1|512253_513912_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004525554.1|513908_517412_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|517470_517830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|517852_518278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536812.1|518598_518874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|519424_520324_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172644504.1|520365_520668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205424.1|520557_521877_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004524286.1|521873_523460_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038776723.1|523712_524708_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004532079.1|524833_525016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041188166.1|525012_526596_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|527112_528366_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038756008.1|528878_530543_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	5.4e-57
WP_041188167.1|530675_532160_-	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_004523134.1|532445_533462_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004523135.1|533919_535119_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|535296_536322_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_161630907.1|536335_536620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545861.1|536755_538030_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004186989.1|538102_539074_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|539224_539758_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|539818_541882_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_041188168.1|541884_543810_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|543814_544987_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|544983_545769_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|545793_547062_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_038769379.1|547082_548228_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523141.1|548337_549201_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004523142.1|549381_551037_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|551123_551999_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004554841.1|552142_553015_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041188363.1|553177_554731_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_041188169.1|554727_555765_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP004043	Burkholderia pseudomallei MSHR146 chromosome 2, complete sequence	3245118	2620446	2658524	3245118	plate,transposase	Ralstonia_phage(25.0%)	24	NA	NA
WP_004524833.1|2620446_2620854_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
WP_009927042.1|2621286_2623320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031313668.1|2623560_2625732_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_038750722.1|2625736_2626588_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004524828.1|2626588_2627512_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|2627573_2628815_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|2628850_2630095_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_038784494.1|2630137_2630776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029670706.1|2632547_2633702_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004524822.1|2635044_2635785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009960547.1|2636213_2636369_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.6	2.0e-06
WP_161630900.1|2636334_2636841_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	51.7	1.3e-17
WP_004557924.1|2639127_2639694_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_172644509.1|2639695_2640178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804350.1|2640442_2641566_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.8	4.5e-15
WP_102607710.1|2642820_2644001_-|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	8.2e-60
WP_076847189.1|2644627_2645779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811398.1|2645789_2646077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038758212.1|2649027_2649738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038758213.1|2649753_2651958_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004539258.1|2651954_2654621_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.4e-78
WP_102812242.1|2654633_2656091_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038728075.1|2656087_2657959_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|2657963_2658524_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
