The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004353	Corynebacterium vitaeruminis DSM 20294 chromosome, complete genome	2931780	179319	220104	2931780	integrase,portal,tail,terminase,holin,transposase	Corynebacterium_phage(100.0%)	54	179844:179891	220369:220416
WP_025251640.1|179319_179706_-|holin	phage holin family protein	holin	NA	NA	NA	NA
179844:179891	attL	TCTGACTACGGATCAGAAGGTTGGGAGTTCGAATCTCTTCGGGCGCAC	NA	NA	NA	NA
WP_025251641.1|180122_181163_+	DUF3644 domain-containing protein	NA	A0A220NQR4	Corynebacterium_phage	100.0	2.4e-196
WP_025251642.1|181418_182630_-|integrase	site-specific integrase	integrase	A0A220NQQ9	Corynebacterium_phage	100.0	3.5e-231
WP_038595099.1|182795_184088_-	DUF4041 domain-containing protein	NA	A0A220NQR9	Corynebacterium_phage	100.0	2.4e-190
WP_081751452.1|184137_184578_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A220NQS5	Corynebacterium_phage	100.0	7.7e-80
WP_025251645.1|184586_185090_-	helix-turn-helix transcriptional regulator	NA	A0A220NQS0	Corynebacterium_phage	100.0	9.4e-90
WP_025251646.1|185208_185427_+	hypothetical protein	NA	A0A220NQR6	Corynebacterium_phage	100.0	1.5e-31
WP_155895053.1|185468_185948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155895054.1|186042_186219_+	hypothetical protein	NA	A0A220NQT2	Corynebacterium_phage	100.0	1.2e-23
WP_025251648.1|186215_186470_+	hypothetical protein	NA	A0A220NQS1	Corynebacterium_phage	100.0	1.3e-42
WP_025251649.1|186578_186779_+	hypothetical protein	NA	A0A220NQT5	Corynebacterium_phage	100.0	3.3e-30
WP_155895055.1|186775_186934_+	hypothetical protein	NA	A0A220NQS2	Corynebacterium_phage	100.0	2.9e-21
WP_025251650.1|186920_187295_+	hypothetical protein	NA	A0A220NQR8	Corynebacterium_phage	100.0	7.5e-60
WP_155895056.1|187338_187575_+	hypothetical protein	NA	A0A220NQS8	Corynebacterium_phage	100.0	7.4e-37
WP_025251652.1|187571_187880_+	hypothetical protein	NA	A0A220NQT4	Corynebacterium_phage	100.0	1.8e-51
WP_155895057.1|187851_188001_+	hypothetical protein	NA	A0A220NQS7	Corynebacterium_phage	100.0	1.2e-16
WP_025251653.1|187997_188372_+	hypothetical protein	NA	A0A220NQS6	Corynebacterium_phage	100.0	7.8e-65
WP_025251654.1|188433_188640_+	hypothetical protein	NA	A0A220NQU4	Corynebacterium_phage	100.0	7.1e-36
WP_155895058.1|188762_189563_+	hypothetical protein	NA	A0A220NQU3	Corynebacterium_phage	100.0	7.3e-145
WP_155895059.1|189685_189988_+	hypothetical protein	NA	A0A220NQT0	Corynebacterium_phage	99.0	1.3e-54
WP_025251657.1|189971_190547_+	hypothetical protein	NA	A0A220NQU5	Corynebacterium_phage	100.0	1.0e-111
WP_025251658.1|190572_191736_+	hypothetical protein	NA	A0A220NQT1	Corynebacterium_phage	100.0	2.2e-206
WP_169729825.1|191981_192353_+	hypothetical protein	NA	A0A220NQT3	Corynebacterium_phage	99.2	3.6e-62
WP_025251660.1|192429_192663_+	hypothetical protein	NA	A0A220NQU2	Corynebacterium_phage	98.7	4.9e-41
WP_025251661.1|192669_192975_+	HNH endonuclease	NA	A0A220NQT8	Corynebacterium_phage	100.0	6.8e-43
WP_051483421.1|193379_193829_+	hypothetical protein	NA	A0A220NQN1	Corynebacterium_phage	100.0	5.4e-81
WP_025251663.1|193839_194271_+	hypothetical protein	NA	A0A220NQN4	Corynebacterium_phage	100.0	3.9e-76
WP_025251664.1|194276_195914_+|terminase	terminase	terminase	A0A220NQP0	Corynebacterium_phage	100.0	0.0e+00
WP_025251665.1|195910_197326_+|portal	phage portal protein	portal	A0A220NQP2	Corynebacterium_phage	100.0	2.4e-271
WP_025251666.1|197351_198887_+	EndoU domain-containing protein	NA	A0A220NQN8	Corynebacterium_phage	100.0	4.5e-300
WP_025251667.1|198894_199167_+	hypothetical protein	NA	A0A220NQN7	Corynebacterium_phage	100.0	1.6e-43
WP_155895061.1|199379_199970_+	hypothetical protein	NA	A0A220NQQ3	Corynebacterium_phage	100.0	5.4e-44
WP_025251669.1|199985_200354_+	DUF2190 family protein	NA	A0A220NQQ0	Corynebacterium_phage	100.0	6.1e-46
WP_025251670.1|200369_201275_+	hypothetical protein	NA	A0A220NQP6	Corynebacterium_phage	100.0	5.9e-167
WP_155895062.1|201387_201666_+	hypothetical protein	NA	A0A220NQP1	Corynebacterium_phage	98.9	1.7e-45
WP_155895063.1|201650_201980_+	hypothetical protein	NA	A0A220NQP4	Corynebacterium_phage	100.0	1.8e-57
WP_025251673.1|201979_202300_+	hypothetical protein	NA	A0A220NQP5	Corynebacterium_phage	100.0	1.7e-52
WP_025251674.1|202308_202740_+	hypothetical protein	NA	A0A220NQQ2	Corynebacterium_phage	100.0	6.6e-76
WP_025251675.1|202816_203743_+	hypothetical protein	NA	A0A220NQQ6	Corynebacterium_phage	99.7	1.7e-169
WP_025251676.1|203844_204237_+	hypothetical protein	NA	A0A220NQP8	Corynebacterium_phage	100.0	4.6e-68
WP_155895064.1|204335_204656_+	hypothetical protein	NA	A0A220NQP7	Corynebacterium_phage	99.1	2.9e-52
WP_025251678.1|204669_209577_+	hypothetical protein	NA	A0A220NQR0	Corynebacterium_phage	100.0	0.0e+00
WP_038595655.1|209593_210469_+|tail	phage tail protein	tail	A0A220NQR1	Corynebacterium_phage	100.0	3.6e-169
WP_025251680.1|210465_212130_+	hypothetical protein	NA	A0A220NQQ5	Corynebacterium_phage	100.0	0.0e+00
WP_025251681.1|212130_212550_+	DUF2744 domain-containing protein	NA	A0A220NQQ4	Corynebacterium_phage	100.0	3.6e-79
WP_155895065.1|212629_213370_+	hypothetical protein	NA	A0A220NQP9	Corynebacterium_phage	100.0	2.2e-135
WP_155895066.1|213424_215005_+	hypothetical protein	NA	A0A220NQQ1	Corynebacterium_phage	89.2	2.4e-163
WP_025251684.1|215111_215729_+	hypothetical protein	NA	A0A220NQR2	Corynebacterium_phage	100.0	7.7e-110
WP_025251685.1|215773_217159_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A220NQR5	Corynebacterium_phage	100.0	4.5e-275
WP_025251686.1|217158_217527_+	hypothetical protein	NA	A0A220NQQ8	Corynebacterium_phage	100.0	3.0e-61
WP_025251687.1|217531_217990_+	hypothetical protein	NA	A0A220NQQ7	Corynebacterium_phage	100.0	1.9e-81
WP_025251688.1|217986_218334_+	hypothetical protein	NA	A0A220NQS3	Corynebacterium_phage	100.0	1.6e-56
WP_025251689.1|218564_218801_-	hypothetical protein	NA	A0A220NQR3	Corynebacterium_phage	100.0	7.3e-45
WP_025251690.1|218838_220104_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	100.0	1.2e-239
220369:220416	attR	TCTGACTACGGATCAGAAGGTTGGGAGTTCGAATCTCTTCGGGCGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP004353	Corynebacterium vitaeruminis DSM 20294 chromosome, complete genome	2931780	688982	810393	2931780	protease,capsid,portal,tail,terminase,head,holin,transposase	Erysipelothrix_phage(39.53%)	110	NA	NA
WP_025252096.1|688982_690368_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_025252097.1|690507_691557_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_025252098.1|691579_692218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252099.1|692312_692828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252100.1|692953_695983_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_081751621.1|696132_696420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169729831.1|696514_696784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155895083.1|696909_698076_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	32.3	7.4e-05
WP_081751478.1|698187_698583_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_025252102.1|698711_699788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252103.1|699806_700445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081751479.1|700457_702107_+	cutinase family protein	NA	NA	NA	NA	NA
WP_025252105.1|702103_702805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252106.1|702806_703085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252107.1|703081_703360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252108.1|703390_704026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155895084.1|704032_704959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155895085.1|704955_706632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038595211.1|706641_708126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038595213.1|708141_709020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252111.1|709016_710699_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_155895086.1|710695_710971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252112.1|710967_712587_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q9ZX60	Mycobacterium_phage	46.2	1.5e-24
WP_025252113.1|712608_713151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252114.1|713196_714948_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_081751480.1|714905_715283_+	DUF4913 domain-containing protein	NA	NA	NA	NA	NA
WP_025252116.1|715282_715936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155895087.1|715966_716920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252118.1|717175_720859_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_025252119.1|721030_721423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051483436.1|721549_722815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038595218.1|722865_724572_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_025252122.1|724579_726169_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	48.2	3.2e-136
WP_081751622.1|726168_727599_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	35.8	4.0e-53
WP_025252124.1|727655_727856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252125.1|727852_728263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252126.1|728502_729333_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	66.3	1.2e-60
WP_025252127.1|729332_729800_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	51.5	2.3e-34
WP_025252128.1|729891_730110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252129.1|730106_730541_-	DUF1617 family protein	NA	A0A2K9VCL5	Lactobacillus_phage	31.7	1.0e-12
WP_025252130.1|730552_733384_-|tail	phage tail protein	tail	A0A2H4JFY7	uncultured_Caudovirales_phage	41.0	3.8e-71
WP_025252131.1|733455_734148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252132.1|734147_736826_-	tape measure protein	NA	A0A2K9V3J7	Faecalibacterium_phage	38.0	6.2e-39
WP_025252133.1|736879_737299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252134.1|737461_737875_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	49.6	7.1e-27
WP_025252135.1|737895_738495_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.3	5.1e-74
WP_025252136.1|738509_738854_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	41.3	1.3e-21
WP_025252137.1|738850_739288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252138.1|739290_739620_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_025252139.1|739631_739949_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	51.0	3.7e-23
WP_025252140.1|739983_741213_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	57.4	9.6e-128
WP_025252141.1|741230_742139_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	59.5	3.8e-57
WP_025252142.1|742135_743491_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	70.5	3.7e-173
WP_025252143.1|743523_743724_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	69.7	1.1e-20
WP_025252144.1|743730_745335_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	75.4	5.1e-238
WP_025252145.1|745369_745657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252146.1|745836_746184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051483437.1|746275_746476_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_025252148.1|746472_747138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252149.1|747233_748484_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	58.3	2.2e-140
WP_025252150.1|748455_749646_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	54.6	5.1e-102
WP_025252151.1|749735_750308_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	50.8	6.3e-50
WP_154545443.1|750398_751307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252153.1|751518_751896_-	HNH endonuclease	NA	A0A2H5BM35	Streptomyces_phage	36.6	1.2e-09
WP_025252154.1|752041_752503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252155.1|752493_753870_-	DEAD/DEAH box helicase	NA	A0A1W6JQF1	Corynebacterium_phage	63.0	3.6e-160
WP_025252156.1|753850_754129_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	52.9	5.8e-17
WP_025252157.1|754262_756521_-	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	47.3	1.2e-197
WP_025252158.1|756517_756961_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	48.9	5.5e-33
WP_025252159.1|756957_757722_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	44.7	7.4e-54
WP_025252160.1|758145_759087_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	22.4	2.0e-08
WP_025252161.1|759102_761070_-	DNA polymerase	NA	A0A1W6JQ98	Corynebacterium_phage	57.6	4.5e-212
WP_025252162.1|761146_761344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252163.1|761356_761908_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	65.0	7.2e-59
WP_025252164.1|761913_763056_-	DUF2800 domain-containing protein	NA	A0A1W6JQ97	Corynebacterium_phage	63.6	4.3e-130
WP_025252165.1|763048_763456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252166.1|763452_763707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252167.1|763805_764312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169729832.1|764593_764737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252168.1|764922_765966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252169.1|765955_766378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252170.1|766370_768209_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_025252171.1|768205_768448_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	56.3	2.5e-16
WP_025252172.1|768448_770284_+	site-specific DNA-methyltransferase	NA	A0A0F6R5U4	Escherichia_coli_O157_typing_phage	30.7	8.0e-38
WP_025252173.1|770283_772872_+	DEAD/DEAH box helicase family protein	NA	A0A088F7C5	Idiomarinaceae_phage	20.2	9.7e-05
WP_025252174.1|772855_773554_-	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_155895089.1|773721_775455_+	N-6 DNA methylase	NA	Q6NE04	Leptospira_phage	35.2	4.6e-75
WP_155895090.1|776592_777276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252175.1|777758_778475_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	57.2	9.3e-75
WP_169729824.1|778601_779024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252177.1|779138_779648_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.0	7.0e-16
WP_081751482.1|779773_781654_+	hypothetical protein	NA	A0A1I9SA50	Rhodococcus_phage	36.3	1.4e-29
WP_155895093.1|781664_782810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025252180.1|782843_783476_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	6.4e-27
WP_081751483.1|783588_784182_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025252181.1|784860_786204_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.0	1.0e-34
WP_169729833.1|786288_786534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025252183.1|787099_788059_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	31.5	2.0e-27
WP_025252184.1|789690_792387_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_169729834.1|794166_795288_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_025252187.1|795409_798226_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_025252188.1|798258_799824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025252189.1|799901_800735_-	ABC transporter ATP-binding protein	NA	A0A1V0SBM3	Catovirus	36.5	2.0e-07
WP_038595819.1|800737_801643_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038595821.1|802763_803741_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	1.5e-11
WP_025252192.1|803926_805204_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_025252193.1|805233_807027_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_025252194.1|807199_808339_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_025252195.1|808345_808795_-	cyanase	NA	NA	NA	NA	NA
WP_155895096.1|809202_810393_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP004353	Corynebacterium vitaeruminis DSM 20294 chromosome, complete genome	2931780	2206598	2249801	2931780	protease,transposase,tRNA	Bacillus_virus(18.18%)	39	NA	NA
WP_025253375.1|2206598_2209325_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.3	3.2e-139
WP_025253376.1|2209787_2210765_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_081751653.1|2211615_2212293_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051483491.1|2212304_2213516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025253379.1|2213707_2214994_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.9	6.3e-138
WP_025253380.1|2215174_2215582_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025253381.1|2216381_2216615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051483492.1|2216656_2216878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051483493.1|2216874_2217684_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025253383.1|2217743_2218373_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.0	2.7e-41
WP_025253384.1|2218412_2219009_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.9	2.3e-42
WP_025253385.1|2219223_2220567_-	trigger factor	NA	NA	NA	NA	NA
WP_025253386.1|2221165_2221558_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025253387.1|2221932_2222163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025253388.1|2222240_2223119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025253389.1|2223482_2223959_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_025253390.1|2224071_2225619_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_025253391.1|2225677_2226295_-	DsbA family protein	NA	NA	NA	NA	NA
WP_025253392.1|2226494_2229089_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.2	2.4e-48
WP_025253393.1|2229119_2229518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025253394.1|2229570_2230725_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	27.8	4.8e-20
WP_025253395.1|2230894_2231677_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.0	2.1e-11
WP_169729850.1|2231675_2232671_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_025253397.1|2232667_2233093_+	globin	NA	NA	NA	NA	NA
WP_025253398.1|2233094_2233982_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025253399.1|2233978_2235055_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_025253400.1|2235243_2236437_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_155895145.1|2236448_2237063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034649453.1|2237135_2237561_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_025253403.1|2237870_2239541_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	29.3	4.6e-48
WP_025253404.1|2239695_2240349_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_025253405.1|2240572_2242615_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_051483583.1|2242772_2243420_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_025253407.1|2243561_2244524_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_025253408.1|2244534_2245191_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025253410.1|2245889_2246072_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_025253411.1|2247440_2247758_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	61.0	2.9e-28
WP_155895200.1|2247757_2248492_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	48.1	3.1e-49
WP_025252719.1|2248457_2249801_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	2.3e-34
