The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	723258	750545	3827433	transposase,protease,integrase,plate	Liberibacter_phage(25.0%)	22	715805:715821	750837:750853
715805:715821	attL	TCGGCGTCGTCGCGCTC	NA	NA	NA	NA
WP_019255998.1|723258_723777_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
WP_025404679.1|724047_725265_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.0	3.9e-89
WP_082264239.1|725880_728757_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	6.6e-71
WP_025404681.1|728869_729196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004522498.1|729205_729553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404682.1|729545_729758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404683.1|729750_730053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404684.1|730582_730885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043300520.1|730881_731091_-	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	52.5	5.7e-09
WP_082264240.1|731214_731748_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_146034401.1|732197_734282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404687.1|734558_735167_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	42.1	3.7e-24
WP_025404688.1|735748_737245_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	56.7	3.8e-147
WP_025404689.1|737241_738753_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.2	1.9e-138
WP_025404690.1|738745_739954_+	hypothetical protein	NA	A0A240FAT6	Liberibacter_phage	56.0	1.0e-44
WP_025404721.1|742957_743380_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
WP_085952127.1|743463_744700_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_025404692.1|744918_746481_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|746510_746858_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|746857_747220_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009888580.1|748416_749202_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009906858.1|749198_750545_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
750837:750853	attR	GAGCGCGACGACGCCGA	NA	NA	NA	NA
>prophage 2
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	1088008	1097239	3827433		Hokovirus(16.67%)	7	NA	NA
WP_009904051.1|1088008_1089961_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
WP_009889258.1|1090224_1091355_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_025404755.1|1091386_1093396_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.7	8.2e-52
WP_009904054.1|1093571_1094387_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_009889263.1|1094451_1095135_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009889265.1|1095131_1095659_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009904055.1|1095694_1097239_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
>prophage 3
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	1459138	1467820	3827433		Bacillus_phage(16.67%)	8	NA	NA
WP_009904402.1|1459138_1460539_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
WP_009889854.1|1460507_1461494_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
WP_009904403.1|1461551_1462544_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|1462615_1462933_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009904404.1|1463267_1464170_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_080554803.1|1464264_1465635_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|1465684_1466608_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_025404856.1|1466977_1467820_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	6.5e-19
>prophage 4
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	2635441	2702302	3827433	transposase,coat,plate,tRNA	uncultured_Caudovirales_phage(28.57%)	49	NA	NA
WP_025405105.1|2635441_2638066_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_025405106.1|2638509_2639730_+	CoA transferase	NA	NA	NA	NA	NA
WP_025405107.1|2639823_2640630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891706.1|2641649_2643359_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_025405108.1|2643644_2644121_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	1.5e-20
WP_009891709.1|2644139_2644526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080555112.1|2644812_2646861_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905872.1|2646837_2647017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905874.1|2647013_2647874_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_082264322.1|2647919_2649080_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009905877.1|2649568_2651152_+	acid phosphatase	NA	NA	NA	NA	NA
WP_009905879.1|2651376_2652570_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009905880.1|2652587_2653430_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009891722.1|2654146_2654779_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025405110.1|2654779_2656852_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	2.6e-29
WP_009905886.1|2657262_2658228_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_082265716.1|2658243_2660592_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009905896.1|2660699_2661539_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038708375.1|2661556_2662081_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905900.1|2662163_2662724_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_019255106.1|2662776_2663322_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|2664130_2665024_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038708373.1|2665439_2666729_+	MFS transporter	NA	NA	NA	NA	NA
WP_025405114.1|2666773_2667700_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891738.1|2667991_2668228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891740.1|2668185_2668467_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080511535.1|2668666_2668969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936444.1|2669448_2670535_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	3.4e-44
WP_082264272.1|2670726_2671446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275018.1|2672776_2673496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405116.1|2673506_2676530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905923.1|2676532_2677549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405117.1|2677552_2680375_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.7	1.5e-30
WP_009905925.1|2680387_2680693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905926.1|2680710_2681043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038708366.1|2682067_2682559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906870.1|2683317_2683812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405119.1|2683789_2687125_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011402458.1|2688485_2689085_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025405120.1|2689081_2689639_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_019256183.1|2689766_2692172_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009906968.1|2692168_2692768_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082264274.1|2693255_2693855_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025405121.1|2693851_2694409_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009905935.1|2694545_2695379_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_025405122.1|2695381_2698180_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.6e-27
WP_009891791.1|2698705_2698972_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025405123.1|2698995_2700423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|2700451_2702302_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	3081484	3142454	3827433	terminase,tail,plate,capsid,portal,head,protease,integrase,transposase	uncultured_Caudovirales_phage(29.41%)	71	3073082:3073116	3117201:3117235
3073082:3073116	attL	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_025405210.1|3081484_3082273_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	95.4	7.4e-150
WP_043300542.1|3082415_3082961_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.3	1.1e-80
WP_025405212.1|3082960_3083458_-	lysozyme	NA	A4JX20	Burkholderia_virus	77.6	2.5e-66
WP_004533694.1|3083450_3083645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405213.1|3083720_3084773_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.2	1.0e-77
WP_025405214.1|3084782_3084989_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	2.6e-14
WP_025405215.1|3084963_3085845_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
WP_025405216.1|3085853_3088262_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.8	1.5e-68
WP_025405217.1|3088349_3088652_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	35.9	4.3e-05
WP_025405218.1|3088721_3089225_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	4.7e-41
WP_025405219.1|3089235_3090405_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	4.3e-162
WP_025405220.1|3090471_3090924_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	79.3	1.8e-44
WP_025405221.1|3090939_3092403_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.4	2.2e-216
WP_025405222.1|3092390_3092966_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.5	1.2e-32
WP_025405223.1|3092958_3093852_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	39.8	4.2e-48
WP_025405224.1|3093848_3094193_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	1.0e-23
WP_025405225.1|3094189_3094396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405226.1|3094459_3095140_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.5e-18
WP_025405227.1|3095142_3095676_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	38.0	7.5e-21
WP_025405228.1|3095665_3096196_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.5	2.0e-10
WP_025405229.1|3096197_3096488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082264282.1|3096491_3097517_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	2.2e-109
WP_025405231.1|3097551_3097896_-|head	head decoration protein	head	NA	NA	NA	NA
WP_025405232.1|3097923_3098991_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.7	2.8e-51
WP_025405233.1|3098987_3100481_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	1.5e-135
WP_004533700.1|3100477_3100684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405234.1|3100694_3102683_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	6.0e-180
WP_025405235.1|3102645_3103215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405236.1|3103308_3103497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405237.1|3103716_3104490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964499.1|3104707_3107200_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
WP_009964497.1|3107321_3107792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975963.1|3108165_3108624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964493.1|3108625_3109081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405238.1|3109088_3109421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|3109434_3109962_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_076853252.1|3110050_3110278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|3110426_3110912_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_123850154.1|3110859_3111315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|3111443_3111662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|3111713_3112049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|3112045_3112651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964485.1|3112647_3113097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|3113096_3114413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405240.1|3114526_3114856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043300578.1|3114864_3115653_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	5.0e-21
WP_025405241.1|3115640_3115871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405242.1|3115904_3117005_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_085952127.1|3118174_3119411_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
3117201:3117235	attR	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_082264283.1|3120167_3121001_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_082264284.1|3121689_3124557_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
WP_009907004.1|3124686_3125028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405247.1|3125024_3125282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936421.1|3125254_3125632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405248.1|3125821_3126301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525824.1|3126300_3126471_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009906999.1|3126701_3127214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082264242.1|3127314_3127677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025404693.1|3127676_3128024_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_025404692.1|3128053_3129616_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404721.1|3131154_3131577_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
WP_025405250.1|3132015_3132957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405251.1|3132925_3134026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936425.1|3134052_3134202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082264285.1|3134656_3135232_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	38.3	4.0e-20
WP_102827153.1|3135273_3135963_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_043300582.1|3135967_3137068_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	24.7	4.1e-21
WP_025405252.1|3138175_3138661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405253.1|3140248_3140473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405254.1|3140663_3141815_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_019254695.1|3141914_3142454_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	3309511	3320392	3827433	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_025405293.1|3309511_3311812_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.6e-168
WP_009892611.1|3311808_3312123_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3312653_3312857_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_025405294.1|3312968_3314564_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009903329.1|3314728_3315988_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|3316252_3316831_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080555088.1|3317091_3317307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019256450.1|3317502_3318012_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
WP_009903323.1|3318277_3320392_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
>prophage 7
NZ_CP004089	Burkholderia thailandensis H0587 chromosome 1, complete sequence	3827433	3631626	3671487	3827433	transposase,integrase	Burkholderia_virus(33.33%)	29	3616454:3616471	3678688:3678705
3616454:3616471	attL	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
WP_085952127.1|3631626_3632863_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_004522844.1|3632990_3633308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902810.1|3633480_3633732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902806.1|3633921_3635502_-	hydrolase	NA	NA	NA	NA	NA
WP_009902805.1|3635814_3636543_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_025405356.1|3637105_3637543_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082264293.1|3638159_3639722_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	30.6	6.9e-06
WP_082264294.1|3640087_3640822_-	hydrolase TatD	NA	NA	NA	NA	NA
WP_025405358.1|3640818_3642105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405359.1|3642101_3642929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405360.1|3642928_3644809_-	NTPase KAP	NA	NA	NA	NA	NA
WP_146034448.1|3645252_3647898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404721.1|3648238_3648661_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
WP_085952127.1|3648744_3649981_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_025404692.1|3650199_3651762_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|3651791_3652139_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|3652138_3652501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025405362.1|3652557_3653337_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_082264295.1|3653619_3654315_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_043300549.1|3654307_3656425_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_146034438.1|3656583_3658500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405366.1|3658677_3660591_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_025405367.1|3660587_3662933_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025405368.1|3663436_3663670_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025405369.1|3664834_3665485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405370.1|3666265_3666700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405371.1|3666696_3668703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405372.1|3668702_3670247_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_025405373.1|3670221_3671487_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3678688:3678705	attR	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP004090	Burkholderia thailandensis H0587 chromosome 2, complete sequence	2940942	7302	46588	2940942	transposase,tail,tRNA,integrase,plate	Burkholderia_virus(45.95%)	47	19371:19390	48953:48972
WP_025405402.1|7302_8343_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
WP_025405403.1|8473_9697_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009895742.1|9776_9989_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019254422.1|10155_10602_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.3e-22
WP_009899227.1|10698_12576_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_009895748.1|12622_12961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899229.1|13019_15062_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_019256111.1|15430_15616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019256110.1|15709_16000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135351310.1|15980_16379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899233.1|17303_17660_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
WP_009899234.1|17750_18365_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
WP_009899237.1|18461_18794_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
WP_025405404.1|18825_20079_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.1	5.5e-155
19371:19390	attL	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
WP_009899242.1|20075_21872_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
WP_025405405.1|21886_22852_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	70.3	1.4e-102
WP_009899245.1|22865_23177_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
WP_025405406.1|23173_23689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906820.1|23698_23941_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
WP_050789956.1|24071_24491_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
WP_025405407.1|24556_25432_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	28.9	7.0e-24
WP_009906937.1|25925_26273_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	79.1	1.2e-43
WP_025405408.1|26275_26884_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
WP_155275021.1|27048_27483_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	69.3	4.4e-43
WP_009906940.1|27479_27818_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
WP_009906941.1|27814_28147_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	77.8	1.9e-46
WP_025405411.1|28479_28794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906942.1|28964_29429_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
WP_009906943.1|29425_29671_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
WP_009906944.1|29674_31108_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_025405412.1|31109_31634_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.8	1.0e-86
WP_009906946.1|31946_32276_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
WP_009906947.1|32247_32406_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	80.8	2.5e-17
WP_082264390.1|33021_35115_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	50.2	2.6e-157
WP_009906887.1|35116_36019_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
WP_009906886.1|36018_36225_+	membrane protein	NA	A4JWL2	Burkholderia_virus	78.3	1.5e-25
WP_025405415.1|36212_37418_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	70.6	2.5e-136
WP_009906884.1|37414_38017_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	4.3e-65
WP_146034418.1|38030_38327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405417.1|38489_39572_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	46.2	1.2e-70
WP_009907016.1|39568_40012_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_009907015.1|40306_40660_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
WP_009907014.1|40656_41808_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
WP_009907013.1|41800_42382_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
WP_025405418.1|42381_44349_+|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	59.0	3.0e-131
WP_009907011.1|44364_45066_+|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.7	1.1e-59
WP_043300628.1|45370_46588_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	5.5e-27
48953:48972	attR	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP004090	Burkholderia thailandensis H0587 chromosome 2, complete sequence	2940942	834370	905942	2940942	tail,capsid,head,terminase,portal,holin,protease,lysis,plate	Burkholderia_virus(57.41%)	80	NA	NA
WP_025405625.1|834370_836359_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	45.1	1.4e-104
WP_009900206.1|836465_837071_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_025405626.1|837309_838800_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_025405627.1|839801_840293_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.9	2.8e-14
WP_009896955.1|840289_840745_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_009900214.1|840746_841736_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_009900215.1|841751_842492_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025405628.1|842735_843536_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_025405629.1|843613_845044_+	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_025405630.1|845124_845934_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025405631.1|846809_847289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405632.1|847347_849861_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.4	4.3e-58
WP_009900226.1|849912_850536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405633.1|850708_853123_-	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_009900232.1|853363_854734_-	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_009896978.1|854885_855305_+	archease	NA	NA	NA	NA	NA
WP_009900233.1|855318_856752_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	45.2	6.0e-105
WP_009900234.1|856809_857070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009896988.1|857200_857905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082264356.1|857901_858336_+	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_009900237.1|858442_859576_+	CapA family protein	NA	S4VS02	Pandoravirus	55.6	9.5e-114
WP_009900238.1|859691_862487_-	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	25.8	3.8e-07
WP_009900239.1|862490_864338_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_019255750.1|864334_864910_-	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_025405634.1|865237_866002_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_154660029.1|865991_866384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009900243.1|866588_867104_+	ProP effector	NA	NA	NA	NA	NA
WP_009897004.1|867117_867447_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_025405635.1|868407_869508_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	96.2	2.8e-195
WP_025405636.1|869507_869933_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	97.9	3.7e-71
WP_082264357.1|869950_872785_-	hypothetical protein	NA	Q45YG8	Burkholderia_virus	70.6	0.0e+00
WP_011204755.1|872781_872895_-|tail	GpE family phage tail protein	tail	A4JWX5	Burkholderia_virus	100.0	1.9e-14
WP_025405638.1|872903_873248_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	95.6	2.4e-52
WP_025405639.1|873305_873815_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	97.6	9.2e-93
WP_025405640.1|873830_875003_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	98.7	1.1e-221
WP_025405641.1|875059_875701_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	87.4	1.5e-108
WP_082264358.1|875717_878090_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	91.1	0.0e+00
WP_025405643.1|878091_878646_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	7.4e-96
WP_025405644.1|878638_879544_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	2.3e-155
WP_025405645.1|879540_879903_-|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.0	8.3e-56
WP_025405646.1|879899_880580_-|plate	phage baseplate assembly protein V	plate	A4JWT3	Burkholderia_virus	96.5	4.5e-119
WP_025405647.1|880753_881530_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	96.5	1.6e-144
WP_043300659.1|881695_882226_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	98.2	1.3e-92
WP_043300663.1|882352_882820_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.2	6.7e-74
WP_004531054.1|882816_883233_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_102827107.1|883225_883369_-	peptidase	NA	K4PAX1	Burkholderia_phage	93.6	3.9e-17
WP_025405648.1|883337_883778_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	91.8	7.7e-64
WP_025405649.1|883774_884587_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.9	3.8e-149
WP_004524440.1|884583_884856_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_025405650.1|884857_885202_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	5.0e-50
WP_010112635.1|885216_885423_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_025405651.1|885419_885671_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	80.7	1.4e-30
WP_025405652.1|885670_886150_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	96.9	6.0e-78
WP_025405653.1|886249_886939_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	96.9	2.9e-113
WP_025405654.1|886935_887946_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	91.1	2.3e-172
WP_025405655.1|887979_888789_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.5	1.4e-140
WP_025405656.1|888932_890702_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	97.8	0.0e+00
WP_025405657.1|890698_891754_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.6	2.1e-200
WP_082264359.1|892306_893428_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	86.9	1.3e-192
WP_025405659.1|893436_894174_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	94.3	4.1e-126
WP_025405660.1|894170_894704_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	93.2	9.0e-91
WP_082264402.1|894809_894977_-	ribbon-helix-helix protein, CopG family	NA	A4JWV6	Burkholderia_virus	88.7	4.3e-15
WP_082264360.1|895159_895819_-	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	97.2	2.6e-111
WP_025405663.1|895905_896112_-	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	97.1	2.8e-32
WP_025405664.1|896108_896375_-	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	91.8	3.6e-40
WP_025405665.1|896390_898184_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	88.1	0.0e+00
WP_082264403.1|898183_899791_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.5	1.1e-67
WP_082264361.1|899607_900645_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	75.2	8.3e-141
WP_043300783.1|900717_900855_-	hypothetical protein	NA	A4JWW4	Burkholderia_virus	86.7	2.2e-17
WP_043300668.1|900863_901079_-	hypothetical protein	NA	A4JWW5	Burkholderia_virus	90.1	6.9e-26
WP_025405667.1|901082_901304_-	hypothetical protein	NA	A4JWW6	Burkholderia_virus	91.8	2.4e-34
WP_051491693.1|901300_901486_-	hypothetical protein	NA	A4JWW7	Burkholderia_virus	75.4	4.0e-14
WP_146034402.1|901515_902016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043300670.1|902012_902882_-	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	70.0	2.4e-101
WP_043300672.1|902869_903022_-	hypothetical protein	NA	R4JMC2	Burkholderia_phage	76.0	2.5e-14
WP_025405669.1|903258_903588_+	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	70.5	1.0e-36
WP_009897098.1|903730_904216_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009900245.1|904446_904605_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_009897101.1|904861_905350_+	membrane protein	NA	NA	NA	NA	NA
WP_009907678.1|905801_905942_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	58.7	9.8e-05
>prophage 3
NZ_CP004090	Burkholderia thailandensis H0587 chromosome 2, complete sequence	2940942	929564	978692	2940942	protease,transposase,tRNA	Stx2-converting_phage(18.18%)	37	NA	NA
WP_009900273.1|929564_930437_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_080554986.1|930469_931198_-	MarC family protein	NA	NA	NA	NA	NA
WP_019255908.1|931244_932570_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_009900276.1|932838_933927_+	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_009897150.1|934041_935010_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025405679.1|935355_936534_+	HPP family protein	NA	NA	NA	NA	NA
WP_009897153.1|936676_937090_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019255910.1|937123_938995_+	chloride channel protein	NA	NA	NA	NA	NA
WP_025405680.1|939446_940949_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_019256532.1|941109_941994_+	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	26.8	6.7e-06
WP_019256531.1|942135_942654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906909.1|943907_945140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906910.1|945172_945970_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_080558214.1|947284_948169_+	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_009906916.1|948305_949082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906917.1|949091_949655_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025405683.1|951188_951785_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.7	1.1e-28
WP_025404692.1|951824_953387_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|953416_953764_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|953763_954126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085952127.1|954465_955703_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_135351059.1|956033_956255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080554994.1|956303_957572_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.3e-39
WP_080554993.1|957694_958408_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019255942.1|958442_960269_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_080554992.1|960265_962944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019255940.1|962965_963748_-	radical SAM protein	NA	NA	NA	NA	NA
WP_019255939.1|963793_964585_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_100085574.1|964550_965765_-	sedoheptulose 7-phosphate cyclase	NA	A9YVT7	Ostreococcus_tauri_virus	27.9	6.5e-20
WP_082264362.1|965821_967030_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.7	9.0e-30
WP_019255936.1|967316_969152_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025405685.1|969190_970396_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	3.9e-17
WP_019255934.1|970504_971944_-	amidase	NA	NA	NA	NA	NA
WP_135351058.1|971936_975089_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	29.5	2.3e-64
WP_019255931.1|975224_975836_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_025405687.1|976295_977009_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155275027.1|977548_978692_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.6	1.6e-100
>prophage 4
NZ_CP004090	Burkholderia thailandensis H0587 chromosome 2, complete sequence	2940942	1568244	1634927	2940942	plate,holin	Aeromonas_phage(25.0%)	49	NA	NA
WP_009900960.1|1568244_1569195_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900964.1|1569462_1570407_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900966.1|1570880_1572584_+	peptidase	NA	NA	NA	NA	NA
WP_019254803.1|1572702_1573929_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_009907969.1|1573987_1575130_-	porin	NA	NA	NA	NA	NA
WP_045143333.1|1575357_1576356_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900970.1|1576391_1577945_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_080554767.1|1578080_1578980_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025405820.1|1579123_1579999_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_009898039.1|1580085_1581741_-	APC family permease	NA	NA	NA	NA	NA
WP_009900973.1|1581920_1582784_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019254807.1|1582893_1584033_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009898044.1|1584053_1585295_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_009900977.1|1585346_1586132_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009900978.1|1586128_1587310_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009900979.1|1587314_1589240_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_025405821.1|1589242_1591306_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_009898053.1|1591366_1591900_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009900981.1|1592047_1593019_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898057.1|1593090_1594365_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_080511307.1|1594376_1594616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009898058.1|1594773_1595799_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_019254810.1|1595991_1597191_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.4e-11
WP_009900983.1|1597536_1598553_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080554769.1|1598739_1600311_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_025405823.1|1600429_1602103_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	1.3e-55
WP_039339746.1|1602554_1603823_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025405551.1|1604017_1605580_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_009906874.1|1605632_1606598_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009896564.1|1606730_1608302_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_025405549.1|1608298_1609576_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896560.1|1609855_1610755_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_102815683.1|1611034_1611151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401418.1|1611327_1611699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405824.1|1611919_1612351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|1612373_1612733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405825.1|1612791_1616292_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011401420.1|1616288_1618073_-	OmpA family protein	NA	NA	NA	NA	NA
WP_009893759.1|1618098_1619460_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009900994.1|1619456_1620050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893761.1|1620055_1620445_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|1620484_1621201_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|1621203_1622274_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009900996.1|1622273_1624490_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_025405826.1|1624493_1626782_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_025405827.1|1626950_1629242_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009901009.1|1629232_1632076_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_009901010.1|1632078_1633068_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009901011.1|1633064_1634927_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP004090	Burkholderia thailandensis H0587 chromosome 2, complete sequence	2940942	2324759	2382934	2940942	plate,transposase,holin	Leptospira_phage(25.0%)	45	NA	NA
WP_025405966.1|2324759_2326955_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_106936403.1|2327035_2328123_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.0e-44
WP_019255409.1|2328442_2328862_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|2328881_2329208_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_019255408.1|2329680_2330373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894695.1|2331180_2331537_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_019255406.1|2331656_2331863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255405.1|2332012_2333155_-	porin	NA	NA	NA	NA	NA
WP_082264336.1|2333826_2334750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898267.1|2335367_2335670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009898271.1|2336064_2336295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275044.1|2336316_2336550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255401.1|2336663_2337863_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_019255400.1|2337862_2339287_-	TolC family protein	NA	NA	NA	NA	NA
WP_009898285.1|2339280_2340180_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|2340181_2340406_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_038708432.1|2340402_2342469_-	FUSC family protein	NA	NA	NA	NA	NA
WP_025405971.1|2343478_2345020_-	membrane protein	NA	NA	NA	NA	NA
WP_155275045.1|2345367_2345724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405972.1|2346568_2348170_+	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	5.8e-08
WP_080554843.1|2348245_2349733_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_025987413.1|2349947_2350541_-	membrane protein	NA	NA	NA	NA	NA
WP_009898306.1|2351126_2351681_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025405975.1|2351747_2352488_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_082264386.1|2352710_2355344_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025987411.1|2355336_2355909_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082264387.1|2355972_2356629_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025405979.1|2356631_2358308_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009898320.1|2358651_2359191_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009898321.1|2359224_2360724_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|2360924_2361407_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_019255186.1|2361534_2362077_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025405980.1|2362082_2363432_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009898325.1|2363428_2364730_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_025405981.1|2364744_2368653_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_019255184.1|2368843_2369413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082264338.1|2369480_2372222_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_004523693.1|2372296_2372566_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_025405983.1|2372578_2376031_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_043300729.1|2375923_2377282_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
WP_009894750.1|2377314_2378343_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009898344.1|2378398_2379469_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_009898345.1|2379487_2380537_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025405985.1|2380533_2382414_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|2382415_2382934_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
