The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	18853	43219	2938059	transposase	Clostridium_phage(50.0%)	19	NA	NA
WP_144235235.1|18853_19640_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003597463.1|19771_19996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025375932.1|20086_23032_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662080.1|23039_23609_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144235236.1|24121_24908_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003662076.1|25841_26210_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003601979.1|26286_26937_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_001748085.1|27089_28265_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_016376044.1|28444_28954_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_144235237.1|29341_30128_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003562845.1|30443_31892_-	MFS transporter	NA	NA	NA	NA	NA
WP_025375935.1|33300_33936_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003663123.1|34536_34809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375936.1|35298_36297_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003562847.1|36527_36674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562849.1|36933_39315_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_016365891.1|39557_41183_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016365892.1|41587_42376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108299274.1|42419_43219_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	189402	249831	2938059	transposase,holin,protease	unidentified_phage(20.0%)	59	NA	NA
WP_014566389.1|189402_190092_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_025375946.1|190155_190842_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012490911.1|190924_191314_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003577580.1|191345_191870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375948.1|192484_193405_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016363600.1|193563_194289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577587.1|194288_194969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016364690.1|194958_195747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365516.1|196197_197724_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	1.3e-52
WP_016365515.1|197994_199116_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016364688.1|199108_200077_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573439.1|200077_200389_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003661526.1|200530_201817_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016365514.1|201833_202256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|202277_203138_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_016365512.1|203250_203892_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003574021.1|204859_205780_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_012490975.1|205892_206204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|206308_207325_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_025375949.1|207690_210225_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_016366028.1|210508_210946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563323.1|210958_211453_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563326.1|211604_212468_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563328.1|212470_213316_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_012490978.1|213349_213667_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_012490980.1|214743_215406_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_025375950.1|215443_216205_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003563340.1|216378_217026_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003583219.1|217041_217605_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_025375951.1|217662_219627_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_025375952.1|219655_220840_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_012490984.1|221075_222125_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012490985.1|222121_222871_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	2.4e-25
WP_025375953.1|222880_223759_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003563355.1|223773_224442_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016364555.1|224438_225125_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012490987.1|225552_226821_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.5	1.1e-46
WP_012490988.1|227222_227753_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_003563363.1|227920_228073_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_016365654.1|228082_228847_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	50.3	3.0e-47
WP_025375954.1|229384_230128_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003577713.1|230240_230867_+	flavodoxin	NA	NA	NA	NA	NA
WP_012490991.1|231117_231621_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016365655.1|231625_232687_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003563376.1|232691_233381_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
WP_003583264.1|233493_233754_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012490993.1|233753_234122_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016365454.1|234412_235783_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.4e-10
WP_011674103.1|236146_236965_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016364183.1|237280_237550_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_016365455.1|237790_238798_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563385.1|238849_239341_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563386.1|239383_240193_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568992.1|240185_241037_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_012490997.1|241066_243310_+	alpha-xylosidase	NA	NA	NA	NA	NA
WP_016365456.1|243399_243816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566412.1|243808_245494_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012491002.1|247481_249191_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	8.0e-40
WP_076665317.1|249708_249831_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 3
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	331131	420346	2938059	holin,integrase,transposase,protease,capsid	Lactobacillus_phage(32.0%)	73	327143:327159	344316:344332
327143:327159	attL	CATTTTCTGGGTGGTAA	NA	NA	NA	NA
WP_003569067.1|331131_332301_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|332413_332674_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_094515910.1|332795_333583_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003662634.1|333710_335243_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_025375963.1|335242_336202_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.4e-27
WP_025375964.1|336207_337533_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016377436.1|339489_341388_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	3.5e-105
WP_003582479.1|341429_341651_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_016366545.1|341660_342209_+	stress induced DNA-binding protein	NA	NA	NA	NA	NA
WP_080687495.1|343129_343600_+|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	36.4	8.7e-21
WP_044003027.1|344405_345326_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	3.0e-17
344316:344332	attR	TTACCACCCAGAAAATG	NA	NA	NA	NA
WP_016376609.1|345698_346553_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025375969.1|346740_347652_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003587210.1|349080_349548_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_025375971.1|350508_351426_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003593246.1|351572_352181_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
WP_010010565.1|352191_353460_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
WP_025375972.1|354667_355351_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
WP_003635798.1|355595_356024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375974.1|356880_358296_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_011674639.1|358421_359438_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_080687497.1|359807_359993_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_044003027.1|360176_361097_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	3.0e-17
WP_109990484.1|361507_361684_+	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	100.0	1.8e-24
WP_025375976.1|361737_362580_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	6.7e-157
WP_016366602.1|363214_363478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587111.1|363537_366360_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_094515910.1|366679_367466_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021353390.1|367842_367932_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003592338.1|368398_369748_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.7	8.6e-122
WP_071799104.1|369789_369984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_123837388.1|370331_371118_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003606765.1|371105_371429_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003589800.1|371772_372651_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_016365902.1|372771_374505_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589794.1|374531_375956_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|376004_376340_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_144235238.1|376874_377662_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003590051.1|377848_378406_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003590049.1|378371_379556_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016366018.1|379597_380509_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.2	4.5e-58
WP_044003053.1|380906_381827_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	6.9e-22
WP_003590045.1|382193_382859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661676.1|382991_383579_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.9	3.5e-19
WP_016388654.1|385315_386644_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567312.1|386844_387402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|389095_389383_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003688752.1|389406_390285_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	8.8e-43
WP_003574021.1|390800_391721_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_019728331.1|392075_393092_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016366331.1|393389_394496_-	anion permease	NA	NA	NA	NA	NA
WP_002816285.1|395565_395817_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_016366102.1|396514_397651_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016366101.1|397752_398565_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003597676.1|398596_399310_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003662771.1|400136_401048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662772.1|401320_402709_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_016365557.1|403797_404466_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003563532.1|404533_405553_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003662776.1|405533_405911_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003662777.1|405907_406186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383833.1|406209_407904_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_025375985.1|408383_409304_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003563543.1|409798_410500_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365555.1|410651_411011_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_016365554.1|410994_411696_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_025375986.1|411846_413868_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365906.1|413943_414918_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003662785.1|415085_416813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365907.1|416799_417594_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	1.6e-27
WP_003662787.1|417846_418395_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_016365908.1|418442_419267_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_123837385.1|419425_420346_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	505922	587021	2938059	portal,integrase,capsid,transposase,bacteriocin,tail,terminase,head	Bacillus_phage(18.75%)	79	500383:500399	553530:553546
500383:500399	attL	TCAGCAATATCAGGCAG	NA	NA	NA	NA
WP_108299274.1|505922_506722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003563790.1|507105_507927_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003563792.1|508100_509162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569200.1|509154_509985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375997.1|510215_510866_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003662860.1|511583_513971_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003662862.1|514452_515409_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003574024.1|515967_516936_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003574026.1|517138_518110_+	permease component of an ABC superfamily transporter	NA	NA	NA	NA	NA
WP_003563800.1|518112_518916_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	3.4e-09
WP_003662865.1|519143_520103_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_003662867.1|520212_522876_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.8	1.1e-75
WP_003563806.1|523114_524092_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	38.0	4.0e-52
WP_003593505.1|524127_526278_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003563810.1|526264_526672_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003563812.1|526829_527525_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	1.3e-33
WP_003604553.1|527521_528817_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003563820.1|528932_529313_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003563824.1|531089_531950_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003569228.1|532739_533399_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_108299274.1|533956_534755_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_025375998.1|535809_536961_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.1	5.9e-55
WP_025375999.1|537038_537812_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016366183.1|537931_538126_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016373398.1|538148_538424_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016366185.1|538503_538725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376000.1|538835_539027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376001.1|539074_539365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574347.1|539361_539550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376002.1|539533_540346_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	35.5	8.8e-13
WP_016365625.1|540358_541942_+	phage/plasmid primase P4 family protein	NA	A0A1B1P7L5	Bacillus_phage	28.5	4.7e-26
WP_016365624.1|542263_542599_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016365623.1|542603_542789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365622.1|542785_543211_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	47.1	6.4e-23
WP_016365621.1|543324_543795_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_016365620.1|543791_545495_+|terminase	phage terminase-like protein	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.7	6.2e-117
WP_016365619.1|545460_545640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365618.1|545644_546826_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.7	3.1e-59
WP_025376003.1|546812_548357_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	2.1e-39
WP_016365616.1|548431_548725_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016365615.1|549083_549905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662896.1|550447_551488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563847.1|551505_551844_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563849.1|552004_552310_-	membrane protein	NA	NA	NA	NA	NA
WP_003563851.1|552465_552765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593573.1|552825_553848_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
553530:553546	attR	CTGCCTGATATTGCTGA	NA	NA	NA	NA
WP_025376004.1|554101_554464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593574.1|554601_555081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563871.1|555073_556240_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003563872.1|556743_556938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563873.1|557066_557693_+	transcriptional repressor LexA	NA	A0A1B2APZ3	Phage_Wrath	35.9	4.9e-11
WP_003593577.1|557821_558295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003578002.1|558308_559256_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003593579.1|559278_559896_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003593583.1|560157_561066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003593584.1|561160_561721_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003563881.1|561728_562085_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_003569257.1|562288_563224_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003593587.1|563448_564324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016365565.1|564773_566441_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003563892.1|566444_567431_+	AEC family transporter	NA	NA	NA	NA	NA
WP_003563894.1|567475_567973_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_003662913.1|568246_568738_+	flavodoxin	NA	NA	NA	NA	NA
WP_003662915.1|568794_569751_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012491183.1|569884_571477_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	3.6e-18
WP_016365566.1|571637_573449_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	41.0	1.7e-125
WP_003563904.1|573594_573945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577841.1|574139_575384_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003661944.1|575544_576750_-	acetate kinase	NA	NA	NA	NA	NA
WP_003571154.1|577040_578009_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016365951.1|578084_578999_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_025376005.1|579024_580095_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_016376041.1|580802_581000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|580974_581328_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011674296.1|581428_582931_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_025376006.1|583688_584891_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	7.9e-10
WP_123837492.1|584987_585089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016366363.1|585386_586301_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_003603074.1|586901_587021_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	645326	715396	2938059	transposase,protease	Staphylococcus_phage(18.18%)	53	NA	NA
WP_003577841.1|645326_646571_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_016377504.1|647061_648063_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003662021.1|648137_649805_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_016383936.1|649807_651769_+	PTS sugar transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_003571014.1|652325_653510_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_025376012.1|653759_654326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377499.1|654796_657847_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003662028.1|657864_659463_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	48.5	6.8e-118
WP_025376013.1|659622_661758_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003662031.1|661804_662611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003607260.1|663613_664426_+	sugar kinase	NA	NA	NA	NA	NA
WP_003662037.1|665234_665840_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003662038.1|666265_666856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377498.1|666896_669479_+	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.4	1.5e-50
WP_003662040.1|669945_670692_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_003662041.1|670968_671712_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_025376015.1|671774_673997_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_025376016.1|674812_676237_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003566730.1|676233_676440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363973.1|676411_676822_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003662045.1|676931_678032_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_003588351.1|678088_678424_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003566723.1|678674_679241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662046.1|679711_680494_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003570969.1|680490_681975_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003662047.1|681967_682675_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003566713.1|683486_684050_+	elongation factor P	NA	NA	NA	NA	NA
WP_016377049.1|684112_685111_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_016377316.1|685707_687132_+	MFS transporter	NA	NA	NA	NA	NA
WP_003566710.1|687563_689186_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003566708.1|689360_690284_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566706.1|690283_691282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566704.1|691293_692346_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
WP_025376017.1|692347_693325_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	1.1e-20
WP_003570958.1|693633_694272_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003566698.1|694531_694843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566696.1|695127_695352_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	34.4	1.0e-08
WP_003607236.1|695348_696062_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_016383829.1|696173_696674_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_003580147.1|696957_697677_-	acyltransferase	NA	NA	NA	NA	NA
WP_025376018.1|698033_699068_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	41.2	1.1e-65
WP_025376019.1|699473_700391_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_025376020.1|700406_701150_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_025376021.1|701381_701873_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025375985.1|703052_703973_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674296.1|704767_706270_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|706370_706724_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003585301.1|706698_706896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375985.1|707032_707953_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003570852.1|708946_709606_+	sugar transferase	NA	NA	NA	NA	NA
WP_003588306.1|711196_712090_-	LCP family protein	NA	NA	NA	NA	NA
WP_003570845.1|712267_713032_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_025376023.1|713245_715396_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.4e-121
>prophage 6
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	775905	873667	2938059	holin,portal,integrase,transposase,tail,head,terminase,protease,capsid	Lactobacillus_phage(77.78%)	106	775817:775876	866902:866995
775817:775876	attL	GTAAGCGCACGATTGTGAGGTACATTTAAAACGGCTTCGGATTCCCTTATGATTGAGGAA	NA	NA	NA	NA
WP_011674296.1|775905_777408_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|777508_777862_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003585301.1|777836_778034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003595494.1|778241_779537_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003566327.1|779674_780556_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_004561992.1|780691_782347_-	amino acid permease	NA	NA	NA	NA	NA
WP_003566323.1|782647_783406_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.9e-33
WP_003585113.1|783418_785227_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003566320.1|785577_786237_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004561994.1|786394_787360_+	ferrochelatase	NA	NA	NA	NA	NA
WP_003575726.1|787346_788699_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003566313.1|788810_789272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004561995.1|789329_790235_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_004561996.1|790374_792120_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003591253.1|792191_792386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566303.1|792754_795046_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004562001.1|795050_795527_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003570749.1|795859_797269_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_025376029.1|797332_797614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003561810.1|797614_798544_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_016376525.1|798716_799079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566294.1|799234_800161_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
WP_003566292.1|800333_801887_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
WP_025376030.1|802051_803215_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	31.4	4.8e-44
WP_025376031.1|803320_804169_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_025376032.1|804158_804953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376033.1|805120_805324_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	1.4e-31
WP_025376034.1|805347_805773_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	87.9	1.8e-62
WP_144235239.1|805907_806102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376036.1|806073_806823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020751738.1|806922_807528_-	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	98.0	2.9e-77
WP_025376037.1|807591_808011_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	100.0	4.0e-78
WP_016376226.1|808000_808336_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	5.0e-55
WP_003595437.1|808473_808716_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	1.2e-34
WP_004562013.1|808712_808871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376038.1|808928_809435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080687505.1|809777_810029_+	hypothetical protein	NA	A0A0P0I7L5	Lactobacillus_phage	74.3	7.9e-05
WP_025376041.1|810021_810462_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	59.7	1.1e-38
WP_025376042.1|810458_811322_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	97.2	8.4e-155
WP_080687506.1|811302_812103_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	93.6	1.2e-144
WP_025376044.1|812118_812967_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	92.9	1.2e-105
WP_025376045.1|812953_813736_+	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	91.2	6.9e-132
WP_025376046.1|813732_814062_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	73.1	4.3e-35
WP_025376047.1|814062_814317_+	hypothetical protein	NA	U5U728	Lactobacillus_phage	91.7	8.8e-36
WP_025376048.1|814313_814679_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	98.3	1.5e-65
WP_025376049.1|814691_815156_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	1.3e-13
WP_020751723.1|815167_815410_+	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	51.7	7.6e-13
WP_025376050.1|815938_816154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376051.1|816143_816500_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	51.7	1.8e-26
WP_025376052.1|816496_816790_+	hypothetical protein	NA	Q8LTB2	Lactobacillus_phage	87.4	3.8e-43
WP_025376053.1|816801_817218_+	hypothetical protein	NA	A0A0Y0AFD7	Bacillus_phage	38.8	6.3e-07
WP_025376054.1|817214_817673_+	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	80.0	6.9e-31
WP_025376055.1|817669_817858_+	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	58.5	3.7e-07
WP_025376056.1|818091_818310_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	93.1	3.3e-31
WP_025376057.1|818717_819146_+	DUF1492 domain-containing protein	NA	U5U7A6	Lactobacillus_phage	98.6	1.9e-75
WP_016372094.1|820616_821135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376058.1|821434_822583_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.9	2.0e-220
WP_016376201.1|822968_823541_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	96.3	6.9e-81
WP_025376059.1|823524_824778_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.3	1.2e-245
WP_025376060.1|824782_826210_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	93.3	1.8e-255
WP_025376061.1|826175_827168_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	96.7	6.6e-180
WP_025376062.1|827292_827931_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	98.1	1.6e-89
WP_025376063.1|827943_828258_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	94.2	3.0e-46
WP_025376064.1|828271_829318_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	97.3	5.5e-185
WP_025376065.1|829386_830265_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	80.8	5.6e-146
WP_020751705.1|830264_830639_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	97.6	4.7e-62
WP_025376066.1|830643_830946_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	88.0	4.5e-47
WP_025376067.1|830942_831350_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0I3G7	Lactobacillus_phage	80.7	7.0e-51
WP_019887999.1|831350_831755_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	7.8e-71
WP_025376068.1|831766_832369_+|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	95.7	9.5e-97
WP_025376069.1|832446_832779_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	96.4	7.4e-51
WP_025376070.1|832883_833237_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	1.1e-55
WP_025376071.1|833229_836319_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	90.0	2.9e-258
WP_025376072.1|836319_838374_+|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	60.5	2.0e-215
WP_025376073.1|838374_841581_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	78.1	0.0e+00
WP_025376074.1|841590_841881_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	88.5	6.5e-43
WP_020751697.1|841873_842005_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	7.2e-18
WP_025376075.1|842035_842422_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	96.1	4.7e-65
WP_025376076.1|842402_842609_+	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	97.4	3.2e-12
WP_025376077.1|842605_843052_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	94.6	1.9e-65
WP_025376078.1|843062_844361_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	93.3	1.5e-224
WP_025376079.1|844583_845492_+|protease	serine protease	protease	NA	NA	NA	NA
WP_156656852.1|845488_845635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016366240.1|845965_847159_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	32.2	2.8e-39
WP_014566586.1|847162_847411_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_025376080.1|847767_848019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016366371.1|848039_848438_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003574021.1|849311_850232_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003568911.1|850967_852383_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_025376082.1|853250_853508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025375985.1|853497_854418_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_025376083.1|854727_856368_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_025376085.1|857211_858345_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_144235240.1|858423_859200_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032799151.1|859246_860344_+	EpsG family protein	NA	NA	NA	NA	NA
WP_025376087.1|860386_861103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144235241.1|861482_862637_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_025376088.1|862792_863731_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	43.5	6.2e-10
WP_001748085.1|864037_865213_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_025376089.1|865440_866859_+	flippase	NA	NA	NA	NA	NA
WP_003599410.1|867009_867939_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
866902:866995	attR	GTAAGCGCACGATTGTGAGGTACATTTAAAACGGCTTCGGATTCCCTTATGATTGAGGAAATGCCGAAGCCGTTGTCTTTTATTGAGGTTTATC	NA	NA	NA	NA
WP_002816285.1|868894_869146_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_144235247.1|869307_870042_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.2	2.0e-136
WP_025376091.1|870493_871261_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003577841.1|871381_872626_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_004562064.1|872905_873667_-|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
>prophage 7
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	1827663	1837006	2938059		Streptococcus_phage(33.33%)	8	NA	NA
WP_003593905.1|1827663_1828326_+	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	75.0	1.1e-08
WP_025376189.1|1828648_1829239_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.4e-52
WP_003569571.1|1829355_1829811_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003593901.1|1830196_1831144_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564250.1|1831148_1832177_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564248.1|1832173_1833061_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564246.1|1833223_1833763_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564244.1|1834114_1837006_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
>prophage 8
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	1884983	1941006	2938059	holin,portal,integrase,tail,head,terminase,tRNA,protease,capsid	Lactobacillus_phage(91.49%)	69	1876948:1876965	1948574:1948591
1876948:1876965	attL	TCGCAGTCGCAGAAACCT	NA	NA	NA	NA
WP_003564157.1|1884983_1885493_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003569501.1|1885747_1886590_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003564155.1|1886655_1887603_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016365286.1|1887830_1888820_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_003564153.1|1888947_1889217_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003593849.1|1889329_1889707_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_016365287.1|1889978_1891019_+	lactonase family protein	NA	NA	NA	NA	NA
WP_003564150.1|1891221_1892040_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003569480.1|1892061_1892697_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003569478.1|1892853_1893912_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003564147.1|1894020_1894923_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003564146.1|1894922_1895720_-	NAD kinase	NA	NA	NA	NA	NA
WP_003564145.1|1895721_1896393_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003564144.1|1896586_1897180_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003564143.1|1897249_1897885_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003574245.1|1899238_1900582_-	PFL family protein	NA	NA	NA	NA	NA
WP_003564140.1|1900630_1900897_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003661363.1|1901086_1902415_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003583932.1|1902548_1903754_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_003564137.1|1904018_1904492_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003593829.1|1904588_1906148_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003593827.1|1906175_1907687_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025376193.1|1908208_1909183_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	99.7	1.0e-196
WP_025376194.1|1909169_1909358_-	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	98.4	2.5e-24
WP_025376195.1|1909357_1909792_-|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	8.2e-50
WP_025376196.1|1909781_1910075_-	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	83.5	3.1e-37
WP_025376197.1|1910120_1910390_-	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	98.9	3.1e-39
WP_025376198.1|1910392_1910818_-	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	98.6	2.8e-71
WP_025376199.1|1910846_1915229_-|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	65.8	0.0e+00
WP_025376200.1|1915225_1915921_-	hypothetical protein	NA	A0A1B0Y2S2	Lactobacillus_phage	97.4	3.0e-126
WP_025376201.1|1915927_1919098_-|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	95.4	0.0e+00
WP_012491334.1|1919117_1919279_-	hypothetical protein	NA	A0A1B0Y4R4	Lactobacillus_phage	100.0	5.7e-25
WP_003595114.1|1919359_1919725_-	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_025376202.1|1919801_1920449_-	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	96.7	4.9e-115
WP_025376203.1|1920460_1920844_-	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	97.6	8.5e-67
WP_019875902.1|1920833_1921163_-	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	99.1	2.6e-56
WP_012491255.1|1921146_1921485_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_003582271.1|1921423_1921750_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_016382022.1|1921763_1922012_-	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
WP_025376204.1|1922085_1923315_-|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	98.3	1.1e-224
WP_025376205.1|1923319_1924027_-|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	98.7	2.3e-126
WP_025376206.1|1924004_1925240_-|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	99.3	6.5e-233
WP_025376207.1|1925258_1926989_-|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	99.1	0.0e+00
WP_044003587.1|1926991_1927366_-	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	98.4	2.3e-61
WP_025376209.1|1927435_1927816_-	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	96.0	4.0e-69
WP_025376210.1|1928000_1928255_-	hypothetical protein	NA	U5U404	Lactobacillus_phage	94.0	9.7e-43
WP_016364250.1|1928753_1929203_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	92.6	4.9e-74
WP_016364251.1|1929281_1929605_-	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
WP_019884715.1|1929601_1929892_-	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	98.9	4.3e-39
WP_025376211.1|1929896_1930316_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	98.6	3.5e-74
WP_025376212.1|1930382_1931204_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.3	1.2e-153
WP_025376213.1|1931241_1932087_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	97.9	2.6e-132
WP_019875448.1|1932091_1932337_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	97.5	8.4e-36
WP_025376214.1|1932345_1933233_-	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	99.0	1.6e-161
WP_025376215.1|1933232_1933427_-	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	96.9	1.6e-29
WP_025376216.1|1933429_1934305_-	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	98.6	7.9e-169
WP_012491233.1|1934314_1934527_-	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_003657835.1|1934615_1934840_-	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_044003348.1|1934969_1935161_-	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	98.4	1.1e-25
WP_025376217.1|1935168_1935891_-	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	99.6	3.1e-126
WP_003578190.1|1935887_1936085_-	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_025376218.1|1936358_1936688_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	35.1	2.8e-10
WP_025376219.1|1936689_1937100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376220.1|1937113_1937878_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	55.1	5.0e-42
WP_025376221.1|1937949_1938456_+	hypothetical protein	NA	A0A1S5SAH9	Streptococcus_phage	33.1	5.3e-08
WP_044003351.1|1938480_1938927_+	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	43.9	1.6e-24
WP_025376223.1|1938929_1939511_+	TIR domain-containing protein	NA	A0A0S2MYG4	Enterococcus_phage	59.3	2.4e-60
WP_003578182.1|1939520_1939715_-	hypothetical protein	NA	A0A0A7NNT6	Lactobacillus_phage	67.7	5.1e-20
WP_016364608.1|1939866_1941006_+|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	99.2	2.7e-217
1948574:1948591	attR	AGGTTTCTGCGACTGCGA	NA	NA	NA	NA
>prophage 9
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	2132457	2210776	2938059	holin,portal,integrase,tail,terminase,tRNA,protease,capsid	Lactobacillus_phage(61.22%)	94	2173175:2173190	2216453:2216468
WP_003567053.1|2132457_2133102_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003576133.1|2133182_2134241_+	LCP family protein	NA	NA	NA	NA	NA
WP_016365493.1|2134302_2135331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376232.1|2135331_2136219_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003567064.1|2136215_2136581_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567066.1|2136722_2137376_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003580616.1|2137593_2139546_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	7.4e-58
WP_003567071.1|2139822_2140158_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003567073.1|2140253_2141279_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.4e-60
WP_003567075.1|2141312_2141846_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016365492.1|2141829_2142552_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003661866.1|2143035_2143641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567081.1|2143872_2144391_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003603167.1|2144874_2145855_+	asparaginase	NA	NA	NA	NA	NA
WP_003567089.1|2145950_2146694_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003603168.1|2146788_2147646_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.4	9.4e-74
WP_003567092.1|2147647_2147986_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
WP_003588621.1|2147990_2148968_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.8	1.1e-25
WP_003567098.1|2148967_2149297_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_016365525.1|2149331_2149976_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	3.1e-53
WP_003567100.1|2150486_2150750_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003567101.1|2150749_2151349_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003567105.1|2151664_2151973_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003567107.1|2151989_2153687_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	3.0e-55
WP_003567109.1|2154159_2154666_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_025376234.1|2154807_2155137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603173.1|2155193_2155790_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003603175.1|2155894_2158504_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003571317.1|2158906_2159320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365710.1|2159469_2160402_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025376235.1|2160511_2166220_-	PII-type proteinase	NA	NA	NA	NA	NA
WP_016365711.1|2166509_2167409_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_025376236.1|2167738_2167963_-	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	97.3	1.8e-32
WP_025376237.1|2168007_2169306_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	88.9	2.8e-210
WP_016366166.1|2169316_2169763_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	3.8e-66
WP_025376238.1|2169759_2169966_-	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	94.9	7.1e-12
WP_025376075.1|2169946_2170333_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	96.1	4.7e-65
WP_020751697.1|2170363_2170495_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	7.2e-18
WP_025376074.1|2170487_2170778_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	88.5	6.5e-43
WP_025376239.1|2170787_2174003_-|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	77.5	0.0e+00
2173175:2173190	attL	TTAACAAACGTGAATA	NA	NA	NA	NA
WP_025376240.1|2174003_2175989_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	61.5	1.1e-229
WP_025376241.1|2175985_2180617_-	tape measure protein	NA	O03937	Lactobacillus_phage	47.9	2.9e-124
WP_019887723.1|2180635_2181256_-	hypothetical protein	NA	O03936	Lactobacillus_phage	42.1	1.7e-32
WP_025376242.1|2181248_2181680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080687537.1|2181745_2181982_-	Ig domain-containing protein	NA	B8QTT6	Erwinia_phage	60.0	1.8e-11
WP_025376244.1|2181999_2182467_-	hypothetical protein	NA	O03972	Lactobacillus_phage	60.0	1.9e-44
WP_025376245.1|2182473_2182866_-	hypothetical protein	NA	O03934	Lactobacillus_phage	38.5	9.4e-21
WP_025376246.1|2182862_2183231_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_025376247.1|2183230_2183581_-|capsid	phage capsid protein	capsid	O03932	Lactobacillus_phage	32.0	1.3e-10
WP_025376248.1|2183570_2183990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376249.1|2184053_2185046_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	48.1	1.4e-60
WP_025376250.1|2185061_2185655_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	40.9	1.6e-19
WP_044003380.1|2185745_2186891_-|capsid	phage capsid protein	capsid	O03929	Lactobacillus_phage	43.2	5.1e-67
WP_080687514.1|2186890_2188438_-|portal	phage portal protein	portal	M1IFC5	Streptococcus_phage	46.7	7.6e-122
WP_025376253.1|2188501_2189818_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	60.1	5.2e-156
WP_025376254.1|2189795_2190329_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	7.9e-63
WP_025376058.1|2190714_2191863_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.9	2.0e-220
WP_016372094.1|2192162_2192681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815641.1|2193994_2194144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582019.1|2194200_2194629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376255.1|2195040_2195259_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	94.4	1.9e-31
WP_044003593.1|2195336_2195621_-	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	90.1	2.3e-40
WP_080687516.1|2195697_2196075_-	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	64.1	6.9e-37
WP_025376258.1|2196071_2196560_-	class I SAM-dependent methyltransferase	NA	Q8LTB0	Lactobacillus_phage	97.5	6.5e-96
WP_025376259.1|2196571_2196832_-	hypothetical protein	NA	C1KFT6	Lactobacillus_virus	90.7	8.1e-37
WP_025376260.1|2196828_2197239_-	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	71.9	1.0e-46
WP_025376261.1|2197228_2197432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044003385.1|2197418_2197982_-	DUF1642 domain-containing protein	NA	A0A2D1GPC7	Lactobacillus_phage	46.8	4.1e-33
WP_025376263.1|2197992_2198232_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	58.0	3.6e-15
WP_025376264.1|2198270_2198735_-	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	1.3e-13
WP_025376265.1|2198753_2199137_-	DUF1064 domain-containing protein	NA	A0A0P0IJU5	Lactobacillus_phage	95.3	9.4e-66
WP_025376266.1|2199139_2199589_-	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	90.6	4.5e-67
WP_025376267.1|2199604_2200090_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	84.5	3.1e-58
WP_025376268.1|2200102_2201056_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	87.1	5.1e-121
WP_025376269.1|2201071_2201836_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.4	1.1e-78
WP_025376270.1|2201855_2202722_-	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	53.6	5.1e-59
WP_019885640.1|2202735_2202906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080687517.1|2202907_2203150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003581994.1|2203268_2203595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376272.1|2203585_2204059_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011674683.1|2204121_2204280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016371378.1|2204367_2204595_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_003582323.1|2204591_2204747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376273.1|2204743_2204971_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025376274.1|2205117_2205546_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	36.0	2.7e-21
WP_144235244.1|2205555_2206017_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	29.9	1.7e-05
WP_025376275.1|2206076_2206586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376036.1|2206668_2207418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144235239.1|2207389_2207584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376276.1|2207718_2208144_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	85.8	2.3e-60
WP_025376277.1|2208167_2208368_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	87.9	8.1e-29
WP_025376278.1|2208454_2208847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376279.1|2208858_2209452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044003389.1|2209561_2210776_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	28.0	5.0e-36
2216453:2216468	attR	TTAACAAACGTGAATA	NA	NA	NA	NA
>prophage 10
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	2246911	2361307	2938059	transposase,bacteriocin,tRNA,protease	Bacillus_phage(17.39%)	108	NA	NA
WP_016383619.1|2246911_2248318_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	8.8e-53
WP_003661818.1|2248558_2249953_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003661815.1|2250078_2250666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576205.1|2250665_2250857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2251332_2252826_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|2252973_2253954_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016366278.1|2254069_2254741_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003603237.1|2254924_2255755_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603238.1|2255901_2256741_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003661808.1|2256753_2257770_-	membrane protein	NA	NA	NA	NA	NA
WP_003567242.1|2257776_2258151_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025376282.1|2259903_2260680_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003603253.1|2260697_2261585_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
WP_003567252.1|2261887_2263003_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003599699.1|2263025_2264390_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2264406_2264949_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2265169_2265460_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003661802.1|2265576_2265954_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003603256.1|2266198_2267518_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
WP_003603257.1|2267880_2269227_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003599703.1|2269454_2270555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661801.1|2270551_2271748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2271810_2272689_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003599714.1|2272850_2274905_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
WP_016365316.1|2275061_2277692_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	1.6e-87
WP_003576237.1|2277853_2278477_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016365317.1|2278976_2279648_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003599717.1|2280157_2281279_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_011674865.1|2281292_2281577_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_016365318.1|2281767_2282883_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2283070_2283277_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2283409_2283667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2283737_2283944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2284168_2284420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2284747_2285980_+	MFS transporter	NA	NA	NA	NA	NA
WP_003599729.1|2286058_2287315_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	5.6e-99
WP_003599730.1|2287403_2288237_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
WP_003588746.1|2288553_2288748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|2288981_2289998_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_003571396.1|2290193_2290730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661784.1|2290918_2292142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365913.1|2292377_2293205_-	class C sortase	NA	NA	NA	NA	NA
WP_003661779.1|2293211_2294771_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003596308.1|2296112_2297129_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_164475162.1|2297144_2297282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365504.1|2297283_2300289_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2300566_2301124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365506.1|2301218_2302415_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016365507.1|2302623_2303679_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003599756.1|2303949_2304579_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003567322.1|2304714_2305044_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003599757.1|2305040_2305829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365508.1|2305881_2306670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2306714_2306993_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599758.1|2307016_2307301_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2307888_2309244_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2309549_2309861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016366046.1|2310456_2311836_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_025376283.1|2311846_2314039_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	2.4e-36
WP_003574021.1|2314295_2315216_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003571414.1|2315559_2315697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|2316659_2316947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003688752.1|2316970_2317849_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	8.8e-43
WP_003574021.1|2318814_2319735_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_080638873.1|2320051_2320372_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003661762.1|2320733_2320931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365868.1|2321477_2321717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599800.1|2321990_2322164_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016365869.1|2322202_2322376_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016370698.1|2322699_2323716_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	6.4e-37
WP_003567359.1|2323889_2324114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376287.1|2324915_2325728_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003599805.1|2326011_2326170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599808.1|2326285_2326618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365872.1|2326869_2327061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577841.1|2327448_2328693_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003599812.1|2328844_2329180_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_016365949.1|2329298_2329895_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003661740.1|2330046_2330301_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003603324.1|2330302_2330710_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_003599822.1|2330861_2331815_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	8.2e-10
WP_016365947.1|2332019_2332754_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025376288.1|2332779_2333943_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_025376289.1|2334118_2335495_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003599827.1|2335627_2336386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599829.1|2336677_2338285_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003603333.1|2338672_2341390_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.5	1.7e-60
WP_003580900.1|2341689_2342055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599833.1|2342208_2343582_-	MFS transporter	NA	NA	NA	NA	NA
WP_003599835.1|2343621_2345151_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2345277_2345469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599837.1|2345597_2346236_+	cation transporter	NA	NA	NA	NA	NA
WP_003599840.1|2346256_2346589_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016365631.1|2346708_2347650_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567411.1|2347646_2348543_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2348539_2349283_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	2.0e-16
WP_016365630.1|2349558_2351025_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567416.1|2351225_2351495_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567418.1|2351583_2351703_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2351903_2352821_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567422.1|2353059_2353701_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003661717.1|2353818_2354451_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003599857.1|2354607_2355132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661711.1|2355394_2357230_+	membrane protein	NA	NA	NA	NA	NA
WP_003661709.1|2357377_2358280_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2358522_2358672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161612784.1|2359277_2360144_-	FliK family flagellar hook-length control protein	NA	NA	NA	NA	NA
WP_003574021.1|2360386_2361307_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 11
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	2539274	2604670	2938059	transposase,holin,tRNA,protease	Streptococcus_phage(22.22%)	56	NA	NA
WP_003567794.1|2539274_2540291_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016383395.1|2540831_2542157_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003662635.1|2542162_2543122_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.4e-27
WP_025376303.1|2543121_2544654_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003662631.1|2545311_2547600_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025376304.1|2547739_2548573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016376196.1|2548597_2549569_-	TDT family transporter	NA	NA	NA	NA	NA
WP_003662626.1|2550004_2550649_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003662625.1|2551172_2551847_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.5	6.6e-14
WP_003567813.1|2551974_2552391_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025376305.1|2552603_2555132_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.9	4.1e-109
WP_003662622.1|2555196_2556201_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003567825.1|2556502_2557315_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567827.1|2557377_2557722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567829.1|2558029_2558293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567831.1|2558581_2559259_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003662616.1|2559264_2559951_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003662615.1|2559995_2560808_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567838.1|2560904_2561387_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	1.8e-21
WP_003567840.1|2561392_2562295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016376357.1|2562544_2563747_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.5	1.3e-23
WP_016365408.1|2564051_2565245_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.8	1.9e-104
WP_003662610.1|2565644_2566343_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003567848.1|2566500_2566974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662605.1|2567680_2569663_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662604.1|2569666_2570596_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003567854.1|2570721_2571474_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025376306.1|2571578_2573093_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003577790.1|2573700_2574903_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.3	3.3e-88
WP_025376307.1|2575140_2575254_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003567861.1|2575630_2575873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003603520.1|2575897_2576068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567866.1|2576156_2576759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004271180.1|2576810_2577956_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	34.8	1.0e-54
WP_003603524.1|2577993_2579370_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003662593.1|2579426_2579714_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003662592.1|2579764_2580232_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025376308.1|2580247_2580874_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_025376309.1|2580997_2583049_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_108299274.1|2583079_2583878_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003662589.1|2584136_2584451_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003567884.1|2584534_2584849_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003662588.1|2584841_2586272_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003662587.1|2586346_2587222_-	ROK family protein	NA	NA	NA	NA	NA
WP_011674977.1|2587881_2588898_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_003662581.1|2589702_2592342_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_016365850.1|2592390_2593716_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003567895.1|2593941_2594667_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567897.1|2594924_2595653_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_003567901.1|2595879_2597472_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003576630.1|2597855_2598335_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016365829.1|2598540_2599338_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_016376031.1|2599593_2600442_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_025376311.1|2600948_2602631_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_025376312.1|2603091_2603844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567918.1|2604511_2604670_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 12
NZ_CP007122	Lactobacillus paracasei N1115 chromosome, complete genome	2938059	2744399	2923879	2938059	holin,transposase,bacteriocin,tRNA,protease	unidentified_phage(17.95%)	156	NA	NA
WP_003574021.1|2744399_2745320_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_144235245.1|2746212_2747103_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	4.6e-156
WP_003568371.1|2747309_2747450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568375.1|2747465_2747714_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003568380.1|2748406_2749327_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.9	1.6e-42
WP_003662352.1|2749526_2750456_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003581611.1|2750553_2751510_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_025376320.1|2751627_2752782_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003658978.1|2752785_2753229_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662350.1|2753233_2755291_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_003568392.1|2755327_2757154_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_016365389.1|2757555_2758266_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_003568396.1|2758563_2759349_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568398.1|2759691_2759952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662341.1|2759962_2760139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2760657_2761578_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003577163.1|2762819_2763509_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.0e-37
WP_025376321.1|2763495_2764686_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079322958.1|2766921_2767218_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025376324.1|2769268_2772478_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_003662328.1|2773119_2774205_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003662326.1|2774348_2775548_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004559880.1|2775544_2776033_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003568534.1|2776034_2776799_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003568420.1|2776960_2777170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572790.1|2777430_2779332_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_025376325.1|2779373_2780762_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003572793.1|2781273_2782038_-	protein jag	NA	NA	NA	NA	NA
WP_025376326.1|2782055_2782892_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_012492235.1|2783036_2783393_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568442.1|2783721_2783862_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003568444.1|2784670_2786020_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003568447.1|2786192_2787332_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
WP_003568449.1|2787909_2788122_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003662310.1|2788118_2789234_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003662308.1|2789486_2791448_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.6	9.5e-146
WP_003662307.1|2791509_2794131_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.5	4.9e-113
WP_003568456.1|2794235_2794940_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003662305.1|2795122_2795554_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	8.2e-26
WP_003568460.1|2795681_2795978_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003662304.1|2796008_2796605_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	64.6	8.6e-50
WP_003568467.1|2796691_2796928_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003574021.1|2797374_2798295_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016366189.1|2798424_2799903_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003662302.1|2799895_2800915_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_019728331.1|2801017_2802034_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016383835.1|2802130_2802328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662299.1|2802745_2802964_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016366383.1|2803148_2803364_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_025376327.1|2803441_2804125_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003584064.1|2804521_2804917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673935.1|2805129_2805432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577228.1|2805955_2807191_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003662290.1|2807394_2809968_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|2809980_2810682_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_016366194.1|2810978_2811530_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662288.1|2811573_2812380_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003662286.1|2812384_2812705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376328.1|2812761_2813535_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|2813712_2814318_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|2814441_2815335_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|2815383_2816022_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|2816250_2817627_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|2817849_2818194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|2818269_2818629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365683.1|2818869_2820312_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_025376329.1|2820506_2821139_+	membrane protein	NA	NA	NA	NA	NA
WP_003577243.1|2821311_2821923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|2822804_2823056_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_025376330.1|2823109_2823952_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	7.9e-158
WP_016383971.1|2824471_2824828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562576.1|2824892_2825213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577278.1|2825401_2826277_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	2.3e-11
WP_025376331.1|2826368_2827961_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_016365799.1|2828297_2829671_-	MFS transporter	NA	NA	NA	NA	NA
WP_016365800.1|2829848_2830172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662255.1|2830352_2833664_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|2833660_2834263_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|2834513_2834774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|2834986_2835649_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016365707.1|2835648_2836578_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|2836589_2837219_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662250.1|2837221_2838475_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_016365706.1|2838526_2838862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376332.1|2839094_2839748_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025376333.1|2840031_2841048_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_003662242.1|2841350_2841536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016383902.1|2841572_2843429_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.9	1.3e-67
WP_003592581.1|2843448_2843676_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_025376334.1|2843823_2844408_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016366060.1|2844456_2845116_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_016366059.1|2845730_2846522_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003662226.1|2846514_2847735_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016366296.1|2847718_2848318_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_025375936.1|2849008_2850007_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003572950.1|2850242_2851268_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	4.6e-59
WP_003662216.1|2851929_2852643_-	SMUG2 DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_025376335.1|2852979_2854119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662210.1|2854756_2854939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365985.1|2855055_2856885_-	MFS transporter	NA	NA	NA	NA	NA
WP_016365986.1|2857043_2857622_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003577294.1|2857743_2858118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365987.1|2858101_2858824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044003027.1|2859018_2859939_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	3.0e-17
WP_003662202.1|2860078_2861311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144235246.1|2861881_2862760_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003688751.1|2862860_2863148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144235250.1|2863429_2864287_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.7e-41
WP_016383813.1|2864747_2865434_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	9.4e-24
WP_003662190.1|2865512_2865827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|2866177_2867194_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_025376339.1|2867952_2869368_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003574021.1|2869825_2870746_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016365270.1|2871089_2871488_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003597024.1|2871450_2871720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662186.1|2871869_2872637_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_025376341.1|2872633_2873539_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003604079.1|2873682_2874834_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003572973.1|2874841_2875546_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003662183.1|2875556_2876903_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_025376342.1|2877616_2878996_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003662179.1|2878997_2880005_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_025376343.1|2880008_2881067_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025376344.1|2881262_2881640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572982.1|2881927_2882341_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003662174.1|2882333_2883200_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003662172.1|2883622_2884210_+	phospholipase	NA	NA	NA	NA	NA
WP_003562682.1|2884296_2884596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572989.1|2884907_2886914_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003562688.1|2886929_2887385_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003562690.1|2887627_2889016_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.6	1.6e-126
WP_003577321.1|2889081_2890245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383713.1|2890711_2892703_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_025376345.1|2892689_2893619_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_016377027.1|2893855_2894725_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662164.1|2894827_2895433_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562702.1|2895562_2896267_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	7.1e-35
WP_003662155.1|2899978_2901034_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003562710.1|2901263_2902559_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.6	3.9e-63
WP_025376347.1|2902867_2904727_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.6	8.6e-88
WP_003562714.1|2904821_2905172_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003662146.1|2905258_2907679_-	plasma-membrane proton-efflux P-type ATPase	NA	M1INF1	Acanthocystis_turfacea_Chlorella_virus	25.1	1.6e-41
WP_003577841.1|2907803_2909048_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_016365941.1|2909393_2910272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662139.1|2910737_2911859_+	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	43.8	6.5e-06
WP_016365926.1|2911925_2912141_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003573002.1|2912137_2913067_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	3.6e-34
WP_003662136.1|2913063_2913825_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003573004.1|2914138_2916322_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.9	6.6e-257
WP_016366216.1|2916548_2917244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662132.1|2917258_2917867_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003574021.1|2918986_2919907_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_025376349.1|2920369_2920594_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003599410.1|2920603_2921533_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_080687539.1|2921944_2922181_+	diadenosine tetraphosphatase	NA	NA	NA	NA	NA
WP_025376351.1|2922862_2923879_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	1.6e-35
>prophage 1
NZ_CP007125	Lactobacillus paracasei N1115 plasmid unnamed, complete sequence	58511	5811	11735	58511	transposase	Lactobacillus_phage(33.33%)	8	NA	NA
WP_025376393.1|5811_6921_+	SIS domain-containing protein	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	27.7	1.4e-08
WP_191980081.1|7266_8166_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	82.1	4.2e-133
WP_025376395.1|8162_8414_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	81.9	7.6e-32
WP_025376396.1|8498_8882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376397.1|8878_10171_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	40.0	2.7e-80
WP_025376398.1|10163_10520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376399.1|10558_10915_-	DUF5388 domain-containing protein	NA	F0PIG7	Enterococcus_phage	28.8	3.9e-05
WP_025376400.1|10928_11735_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	43.6	7.8e-54
