The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	490241	523499	5293301	integrase,protease,tail,capsid,head,portal,terminase,tRNA	uncultured_Caudovirales_phage(75.0%)	34	507849:507866	523844:523861
WP_002919147.1|490241_491189_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|491203_491713_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|491841_492966_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|492937_493411_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|493436_493979_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|493983_494556_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|494559_495378_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|495374_495632_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|495607_496162_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|501957_502179_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|502472_505583_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|505595_506735_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|507113_507764_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
507849:507866	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|508039_509266_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|509358_510300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|510481_510766_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|510776_511556_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|512007_512277_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|512269_512458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|512450_512765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|512761_513130_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|513126_513492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|513491_515627_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|515969_516305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|516353_516866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|517129_518296_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|518347_518908_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|518909_520151_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|520147_520483_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|520479_520779_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|520778_521222_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|521214_521367_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|521497_521854_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|521837_523499_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
523844:523861	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	1280464	1354600	5293301	integrase,plate,tail,lysis,capsid,portal,head,terminase,tRNA	Salmonella_phage(78.26%)	81	1278758:1278804	1315325:1315371
1278758:1278804	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1280464_1281490_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1281492_1282122_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1282244_1282487_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1282519_1283029_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1283036_1283237_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1283200_1283539_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1283606_1283840_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1283839_1284067_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1284063_1284915_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1284911_1287296_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1287458_1287647_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1287658_1287892_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1287987_1288671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1288657_1289737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1289736_1290738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1291259_1291529_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1291585_1292629_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1292628_1294392_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1294532_1295366_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1295382_1296435_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1296438_1297092_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1297187_1297652_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1297651_1297855_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1297858_1298074_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1298054_1298564_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1298568_1298952_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1298948_1299377_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1299351_1299510_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1299472_1299895_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1299887_1300334_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1300356_1301223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1301317_1301890_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1301886_1302249_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1302235_1303144_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1303136_1303808_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1303809_1305759_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1305768_1306887_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1306938_1308012_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1308160_1309333_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1309342_1309858_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1309910_1310210_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1310224_1310344_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1310336_1312967_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1312963_1313449_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1313445_1314540_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1314606_1314825_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1314852_1315230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1315833_1316316_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1315325:1315371	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1316426_1316903_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1316892_1317183_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1317249_1317591_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1317738_1319400_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1319486_1320365_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1320489_1321080_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1321199_1322486_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1322505_1323297_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1323460_1324825_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1325084_1325333_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1325351_1325900_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1325931_1326699_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1326738_1327086_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914119.1|1327205_1327664_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914118.1|1327720_1329091_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914117.1|1329099_1329582_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1329595_1330819_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1330811_1331321_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1331663_1332734_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_002914113.1|1332743_1333865_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914112.1|1333927_1334800_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1334796_1335957_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1336057_1336105_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_002914111.1|1336211_1336547_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|1336817_1337555_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1337686_1338667_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002914109.1|1338663_1339395_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1339524_1342098_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914097.1|1348063_1349362_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_002914095.1|1349365_1349689_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914094.1|1349730_1351086_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004151994.1|1351206_1353867_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1353901_1354600_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	1765152	1772059	5293301	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1765152_1766016_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1766026_1766800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1767042_1767939_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1768181_1769543_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1769861_1770584_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1770580_1772059_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	1808626	1816251	5293301		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1808626_1810033_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1810257_1811322_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1811348_1812218_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1812249_1813140_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1813154_1813709_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1813889_1815056_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1815249_1816251_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 5
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	2057082	2113568	5293301	protease,transposase,plate	Staphylococcus_phage(16.67%)	55	NA	NA
WP_002910830.1|2057082_2057829_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2058267_2059254_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2059246_2060047_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2060033_2060207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2060504_2060648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2060824_2061766_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2061859_2062849_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2062874_2064206_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_025380791.1|2064233_2065442_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2065470_2067765_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2067816_2067963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2068252_2069311_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2069420_2070335_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2070344_2071622_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2071618_2072494_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2072490_2073210_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2073215_2074109_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2074392_2076036_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2076085_2076562_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2076660_2077587_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2077890_2079186_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2079197_2080007_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2079981_2080881_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2080990_2081473_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2081663_2082362_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2082387_2082927_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2083041_2083371_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2083939_2085280_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2085276_2085930_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2085933_2087631_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2090594_2091950_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2091950_2092460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2092456_2092963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2093057_2093210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2093199_2093709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2095314_2096283_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2096424_2096607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2096603_2096933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2096929_2097436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|2097895_2098927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2098950_2099256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2099277_2100171_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2100216_2100333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2100354_2101248_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2101273_2101402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2101423_2102317_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2102492_2103383_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2103719_2104700_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2104757_2105060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2105320_2105506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2105803_2106070_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2106073_2107231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2107214_2110625_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2110758_2112522_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2112551_2113568_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	2780988	2791875	5293301		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2780988_2784096_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2784150_2785416_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2785446_2786535_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2786621_2786882_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2787179_2788040_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2788060_2788822_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2789082_2789985_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2789996_2791262_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2791254_2791875_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	2980567	3053370	5293301	holin,integrase,plate,transposase,terminase	uncultured_Caudovirales_phage(35.29%)	84	3044483:3044497	3050492:3050506
WP_002902268.1|2980567_2981653_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2981616_2983371_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2985042_2988468_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2988451_2989591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2989587_2989845_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2989889_2992307_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2992294_2992825_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2992892_2993423_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2993491_2994022_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2994089_2994620_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2994688_2995219_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2995282_2996062_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2996062_2998432_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2998433_3001088_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3001352_3001844_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|3001848_3003555_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3003551_3004241_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|3004237_3005581_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3005590_3007135_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|3007177_3007669_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|3008514_3008763_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3008985_3009270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3009374_3009584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3009580_3010312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3010322_3011051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|3013401_3013599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|3013598_3014465_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3014464_3015238_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3015234_3016431_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3016430_3016784_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3016785_3017439_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3017492_3018059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3018101_3018284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3018333_3018675_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3018674_3019697_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3019699_3019927_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|3020002_3020602_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3020601_3022605_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3022594_3022747_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3022782_3023208_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3023534_3024726_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3024667_3024958_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3024968_3026114_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3026117_3026558_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3026652_3027039_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3027038_3027545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3027541_3027961_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3027929_3028211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3028250_3029192_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3029203_3029698_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3029701_3030904_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3030955_3031504_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3031559_3033011_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3033248_3034649_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3034599_3035088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3035453_3035774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3036008_3036398_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3036394_3036925_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3036927_3037176_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3037581_3038364_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3038360_3038837_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3038833_3039796_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3039797_3041456_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3042032_3042254_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3042351_3043020_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3043190_3043505_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3043497_3043686_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3043855_3044221_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3044213_3044468_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3044439_3044658_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3044483:3044497	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3044654_3045080_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3045076_3045271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3045267_3046095_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3046199_3046718_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3046723_3047434_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3047423_3047648_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3047644_3047857_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3048099_3048333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3048405_3048552_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3048511_3048754_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3048734_3049916_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3050112_3050661_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3050492:3050506	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3050859_3052392_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3052608_3053370_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	3465073	3558020	5293301	integrase,protease,plate,tail,lysis,capsid,head,portal,terminase,tRNA	Salmonella_phage(59.65%)	93	3520599:3520617	3558095:3558113
WP_002898139.1|3465073_3466366_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3466456_3467800_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3467808_3468420_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3468542_3472796_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_020314624.1|3472931_3473426_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3473958_3474927_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3475041_3476808_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3476808_3478530_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3478574_3479276_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3479629_3479848_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3479968_3482248_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3482278_3482596_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3482921_3483143_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3483219_3485160_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3485156_3486272_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3486418_3488077_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3488496_3489192_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3489307_3490207_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3490350_3492003_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3492013_3492982_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3493193_3493628_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3493779_3495498_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3495536_3496538_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3496548_3497991_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3498078_3499092_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3499088_3499919_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3499950_3501090_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3501967_3502483_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3502709_3503438_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3503458_3504190_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3504196_3504913_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3504912_3505581_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3505764_3506496_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_002896382.1|3506538_3508011_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3508007_3508724_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3508802_3509930_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3509971_3510460_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3510517_3511363_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3511359_3512313_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3512323_3513457_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3513620_3514733_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3515081_3515561_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3515649_3516552_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3517373_3517661_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3517863_3518127_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3518133_3518517_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3518783_3520469_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3520599:3520617	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3520688_3520907_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3520998_3522099_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3522095_3522581_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3522577_3525205_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3525197_3525317_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3525331_3525631_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3525683_3526199_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3526208_3527381_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3527519_3528596_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3528625_3528829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3528825_3529557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3529560_3530295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3532513_3533113_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3533105_3534014_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3534000_3534363_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3534359_3534932_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3535026_3535719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3535715_3536162_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3536154_3536586_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3536548_3536695_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3536681_3537110_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3537106_3537490_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3537494_3538004_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3537984_3538200_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3538203_3538407_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3538406_3538871_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3538966_3539617_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3539620_3540679_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3540695_3541529_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3541671_3543438_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3543437_3544463_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3544524_3546267_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3546542_3547220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3547334_3547568_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3547578_3547767_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3547920_3550335_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3550331_3551189_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3551185_3551413_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3551412_3551646_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3551713_3552055_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3552018_3552219_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3552226_3552736_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3552768_3552990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3553135_3554014_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3554025_3554970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342959.1|3557039_3558020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3558095:3558113	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	3818728	3858789	5293301	integrase,holin,tail,terminase	Salmonella_phage(44.0%)	55	3810303:3810318	3860385:3860400
3810303:3810318	attL	CAGGCGCTGCTGGCGG	NA	NA	NA	NA
WP_004152707.1|3818728_3819211_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|3819207_3819837_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|3819826_3820132_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|3820118_3820523_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|3820646_3820799_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004207261.1|3820807_3823174_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152452.1|3823330_3823627_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004152453.1|3823717_3823975_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|3823978_3824176_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152433.1|3824551_3825241_+	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|3825326_3825710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|3825852_3828618_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|3828617_3830528_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|3830527_3833359_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|3833369_3833909_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|3833908_3834373_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|3834372_3836871_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|3836870_3837476_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|3837475_3837799_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|3837849_3838191_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|3838201_3838639_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152444.1|3838692_3839679_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152445.1|3839693_3840374_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|3840376_3840673_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|3840669_3842352_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|3842366_3842573_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|3843374_3843686_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|3843752_3845228_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|3845224_3845809_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|3845886_3846144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|3846218_3846557_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|3846556_3846796_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|3846788_3847457_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|3847453_3847666_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|3847666_3847837_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|3847836_3848580_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|3848576_3849002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|3848998_3849190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|3849173_3849584_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|3849776_3850124_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|3850243_3851029_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|3851025_3851793_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|3851792_3852002_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|3852148_3852382_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|3852535_3853117_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|3853337_3853487_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|3853483_3853783_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|3853779_3854679_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|3854688_3855711_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|3855762_3856011_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|3856120_3856414_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|3856406_3856565_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|3856561_3857155_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152548.1|3857330_3857522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|3857538_3858789_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
3860385:3860400	attR	CCGCCAGCAGCGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	4228012	4239665	5293301	integrase	Enterobacteria_phage(70.0%)	12	4228462:4228476	4251518:4251532
WP_004144574.1|4228012_4229116_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4228462:4228476	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4229126_4230380_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4230732_4231923_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4231910_4232861_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889930.1|4233853_4234420_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4234437_4234683_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4234679_4235417_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4235958_4236225_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4236221_4236779_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4236775_4237003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4236999_4237320_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4237331_4239665_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4251518:4251532	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP006918	Klebsiella pneumoniae 30684/NJST258_2 chromosome, complete genome	5293301	4707910	4713735	5293301		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4707910_4710244_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4710258_4710579_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4710575_4710803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4710799_4711348_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4711344_4711611_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4712171_4712909_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4712905_4713151_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4713168_4713735_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP006922	Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence	86232	5748	12946	86232	transposase	Aeromonas_phage(28.57%)	10	NA	NA
WP_020314639.1|5748_6702_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|6822_7089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|7108_7729_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644718.1|8326_8953_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|8997_9225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|9399_10674_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_046960466.1|10685_11135_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314635.1|11131_11377_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_020314631.1|11580_11811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314651.1|12244_12946_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
