The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	832330	905302	4998910	plate,transposase,protease,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001520521.1|832330_833683_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|833712_836145_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|836266_836752_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_025210202.1|836755_837781_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|837885_838341_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|838344_839133_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_025210203.1|839132_840281_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569440.1|840277_840874_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.3e-26
WP_025210204.1|840910_844393_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	3.7e-209
WP_000055741.1|844405_845365_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001601040.1|845462_847604_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_001577743.1|847660_848050_+	VOC family protein	NA	NA	NA	NA	NA
WP_001577744.1|848114_849413_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_001295788.1|849461_849716_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|849708_849909_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185302.1|850074_850620_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|850616_851039_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239189.1|851052_851763_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360446.1|851792_852617_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|852669_854388_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094026.1|854498_855206_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|855202_855607_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|855724_856540_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|856579_857233_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|857225_858257_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_025210205.1|858444_859017_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|864778_865582_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|865578_866493_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|866733_867534_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001521855.1|867611_868382_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|868428_869787_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|869858_870614_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|870647_871370_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|871366_871834_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|871898_872630_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_099110574.1|872518_872749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|873168_873954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051529907.1|874102_874534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|874578_875493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|875536_876019_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_025210206.1|876042_877395_-	membrane protein	NA	NA	NA	NA	NA
WP_077768579.1|877405_880612_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|880948_882361_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088867.1|882365_883109_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_025210207.1|883105_885889_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.6	2.3e-81
WP_025210208.1|886662_887994_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|887996_888521_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113717.1|888517_889798_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_025210209.1|889822_890905_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025210210.1|890868_892719_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025210211.1|892722_893136_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|893142_894618_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|894668_894893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037390.1|894927_895428_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001366125.1|896674_896812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550647.1|896851_898993_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_025210212.1|899068_903568_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	2.1e-23
WP_001077735.1|903567_903945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428173.1|904165_905302_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	1236481	1332699	4998910	integrase,transposase,head,tRNA,protease,portal,terminase,tail,lysis,capsid	Enterobacteria_phage(48.39%)	102	1246633:1246679	1295741:1295787
WP_000912355.1|1236481_1237867_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
WP_001143546.1|1237902_1238424_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|1238531_1238744_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1238745_1239612_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1240082_1240625_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1240844_1241537_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_025210268.1|1241567_1244177_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691065.1|1244189_1245197_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001309313.1|1245207_1245723_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|1245725_1246358_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1246633:1246679	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|1246692_1247856_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|1247711_1248083_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1248054_1248333_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|1248380_1248599_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_077248689.1|1248697_1248979_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	2.1e-46
WP_000129285.1|1248989_1249547_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1249539_1249701_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1249697_1250378_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1250374_1251160_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|1251165_1251462_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1251537_1251744_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1252339_1253095_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1253133_1253364_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1253432_1253972_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147893.1|1253968_1254988_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788815.1|1254984_1255686_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_025210269.1|1255682_1255985_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	3.3e-42
WP_001070442.1|1256052_1256385_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_021537018.1|1256639_1258166_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_001445652.1|1258630_1259182_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1259191_1259989_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1260105_1260207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|1260203_1260659_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|1260658_1260829_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1260821_1261112_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099716.1|1261108_1261471_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_001307651.1|1261467_1261608_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001204783.1|1261693_1262077_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_025210270.1|1262266_1263349_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	6.0e-166
WP_000839596.1|1263922_1264138_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135256.1|1264137_1264635_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000092273.1|1264631_1265099_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|1265086_1265239_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001390120.1|1265380_1265545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000079510.1|1265590_1266001_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_032231044.1|1266058_1266292_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000583869.1|1266439_1266541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453580.1|1266680_1267226_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1267200_1269126_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_025210271.1|1269122_1269329_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_051529908.1|1269368_1270928_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	4.4e-303
WP_000123248.1|1270908_1272228_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|1272237_1272570_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|1272625_1273651_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158878.1|1273692_1274088_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000785282.1|1274099_1274453_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|1274464_1275043_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|1275039_1275435_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_025210272.1|1275442_1276183_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	3.4e-128
WP_000479193.1|1276198_1276621_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1276602_1277037_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025210273.1|1277029_1279591_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000847345.1|1279587_1279917_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|1279916_1280615_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_038428179.1|1280620_1281364_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.9e-147
WP_110093302.1|1284052_1284340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110093303.1|1285518_1288332_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.6	0.0e+00
WP_001228252.1|1288399_1288999_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_025210275.1|1289063_1291421_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001544317.1|1291420_1291690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210276.1|1291702_1292386_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	60.0	1.1e-56
WP_000355609.1|1292396_1292690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|1293365_1294115_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025210277.1|1294363_1295317_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001443680.1|1295720_1295837_-	hypothetical protein	NA	NA	NA	NA	NA
1295741:1295787	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001177464.1|1295830_1296592_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001308464.1|1296648_1296861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224574.1|1296774_1297665_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_025210278.1|1297665_1300638_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_025210279.1|1300624_1302862_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_021523035.1|1303059_1304196_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000769435.1|1304576_1305134_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_001328511.1|1305145_1305844_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	3.1e-14
WP_001038643.1|1305873_1306236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260286.1|1306732_1306948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522501.1|1307559_1307991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154314.1|1308482_1309016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210280.1|1309012_1313842_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.8	2.2e-18
WP_001160804.1|1313861_1314323_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103213.1|1314350_1316252_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	7.1e-29
WP_025210281.1|1316988_1318437_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	5.1e-11
WP_000770953.1|1318426_1319110_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_025210282.1|1319266_1320649_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709869.1|1320672_1321005_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717111.1|1321020_1322244_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_025210283.1|1322255_1325399_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	3.7e-59
WP_000786320.1|1325500_1326877_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153132.1|1326944_1328192_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000360954.1|1329046_1329415_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|1329479_1329728_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_025210284.1|1329793_1330912_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_085948682.1|1331330_1332699_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 3
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	2086284	2187768	4998910	integrase,holin,transposase,head,tRNA,terminase,tail,lysis	Escherichia_phage(57.5%)	103	2088135:2088151	2186083:2186099
WP_001361837.1|2086284_2087517_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2087771_2088755_+	zinc transporter ZntB	NA	NA	NA	NA	NA
2088135:2088151	attL	CGCAAAGTGCTGGCGCT	NA	NA	NA	NA
WP_001296046.1|2089029_2089203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599773.1|2089232_2090606_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2090734_2091670_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_001516465.1|2091721_2092957_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	8.4e-241
WP_000079604.1|2092958_2093174_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001605349.1|2093273_2093462_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_032159264.1|2093454_2093649_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	1.3e-31
WP_001004422.1|2093712_2094765_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.6	8.5e-117
WP_001605350.1|2094776_2097848_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.0	0.0e+00
WP_001344816.1|2097949_2098225_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2098299_2098470_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2098469_2098691_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_099481753.1|2098819_2099098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312793.1|2099132_2099621_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2099617_2099773_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2099783_2099963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551043.1|2100226_2100703_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|2100826_2101123_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_025210427.1|2101145_2101568_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.4e-67
WP_001396581.1|2101645_2102434_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788969.1|2102440_2103187_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
WP_077768598.1|2103158_2103971_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	4.5e-118
WP_001605354.1|2103986_2104409_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
WP_000365100.1|2104827_2105073_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2105504_2106656_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2106623_2107613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2107612_2109004_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|2109503_2110103_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_001605357.1|2110102_2110393_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	8.2e-46
WP_000506936.1|2111975_2112404_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2112575_2112950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2113201_2113417_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|2113416_2113914_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|2114130_2114316_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|2114512_2115970_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001349572.1|2115908_2116190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210428.1|2116107_2116899_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	39.8	8.2e-48
WP_001204037.1|2116891_2117824_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|2117801_2118011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2118014_2119109_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2119089_2120391_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2120393_2121800_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|2121783_2122896_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|2123000_2123765_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|2123863_2125003_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|2125225_2125621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2125620_2126004_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2126004_2126385_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2126381_2126774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051529909.1|2126800_2127751_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.0	5.8e-56
WP_000470330.1|2127824_2128274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|2128381_2128582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001605364.1|2128747_2131981_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.4e-114
WP_000024051.1|2131973_2132312_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001605366.1|2132311_2133010_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.5e-125
WP_001311619.1|2133657_2134329_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
WP_025210431.1|2139906_2143335_+	lytic transglycosylase domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	94.5	0.0e+00
WP_000002800.1|2143334_2143691_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_025210432.1|2143687_2145121_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	2.0e-270
WP_025210433.1|2145120_2145957_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.3e-152
WP_025210434.1|2146035_2146470_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	96.5	3.4e-72
WP_025210437.1|2148973_2149591_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.4	5.9e-86
WP_038428224.1|2149554_2150100_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000887652.1|2151116_2151446_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|2151442_2151886_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_025210438.1|2151872_2152475_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	6.0e-99
WP_025210439.1|2152476_2154396_+	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
WP_023351539.1|2154392_2154758_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	3.0e-45
WP_025210440.1|2154770_2157758_+	hypothetical protein	NA	A0A077SK08	Escherichia_phage	97.3	0.0e+00
WP_001165936.1|2157747_2158056_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_025210441.1|2158084_2158873_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.2	5.7e-142
WP_025210442.1|2158879_2159557_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	98.2	4.9e-126
WP_025210443.1|2159571_2159754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210444.1|2159754_2160243_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	3.2e-87
WP_025210445.1|2160412_2160970_+	lysozyme	NA	Q71TF3	Escherichia_phage	99.5	2.7e-106
WP_071550067.1|2161105_2161276_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	93.1	2.5e-26
WP_000132937.1|2161255_2162275_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001312284.1|2162387_2163518_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
WP_025210446.1|2163550_2165272_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_000224043.1|2170200_2170641_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|2170637_2170886_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_025210447.1|2170924_2171647_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025210448.1|2171895_2172585_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025210449.1|2172638_2173283_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.3e-96
WP_072262119.1|2173472_2173859_-	Ref family protein	NA	Q71TG3	Escherichia_phage	93.7	8.0e-57
WP_000691857.1|2174077_2174854_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000104482.1|2174869_2175859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071595431.1|2177063_2177171_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
WP_016246567.1|2177363_2177675_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	96.1	8.8e-46
WP_001312283.1|2177791_2177905_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|2177923_2178019_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|2177984_2178194_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|2178304_2179156_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_000124159.1|2180868_2182353_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_025210451.1|2182352_2183546_-	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	91.9	7.2e-189
WP_001326849.1|2183631_2184084_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_025210452.1|2184172_2185216_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	1.1e-206
WP_025210453.1|2185243_2185423_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	7.8e-23
WP_025210454.1|2185427_2185808_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	7.4e-63
WP_001190712.1|2185807_2186029_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_025210455.1|2186211_2187768_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	8.4e-105
2186083:2186099	attR	AGCGCCAGCACTTTGCG	NA	NA	NA	NA
>prophage 4
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	2192479	2243302	4998910	plate,tail	Escherichia_phage(68.75%)	51	NA	NA
WP_025210458.1|2192479_2192986_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	7.0e-93
WP_025210460.1|2194323_2194542_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	98.6	2.2e-35
WP_025210461.1|2195322_2196000_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	99.1	2.9e-134
WP_000484111.1|2195996_2196623_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	1.0e-122
WP_012817939.1|2196520_2197183_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000096174.1|2197124_2197280_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943607.1|2197346_2197925_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000840931.1|2197927_2198173_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|2198319_2198697_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_025210462.1|2198706_2199924_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	5.4e-224
WP_000896806.1|2199927_2200656_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_015974270.1|2200642_2201428_+	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000535202.1|2202439_2203072_+|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_001198665.1|2203118_2204117_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	100.0	1.1e-195
WP_025210463.1|2204116_2205481_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	99.6	1.2e-251
WP_000234830.1|2205948_2206113_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	96.3	5.0e-16
WP_000900641.1|2206112_2206538_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	99.3	2.4e-70
WP_000660977.1|2208192_2211480_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.7	0.0e+00
WP_025210464.1|2211476_2212382_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	97.0	6.5e-158
WP_001177864.1|2212374_2212659_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_001311689.1|2212933_2213113_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_025210465.1|2213121_2213910_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	99.2	4.0e-119
WP_025210466.1|2213949_2214372_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	96.4	2.3e-57
WP_001281116.1|2214549_2214942_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001113742.1|2215277_2216162_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154687.1|2216454_2217264_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|2217432_2218629_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2218645_2219647_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_025210467.1|2219872_2221579_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	98.1	0.0e+00
WP_025210468.1|2221639_2223229_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.4	2.1e-305
WP_000041756.1|2223238_2224054_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
WP_025210469.1|2224089_2224671_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.0	8.6e-103
WP_001615627.1|2224682_2225192_+	hypothetical protein	NA	A0A077SK14	Escherichia_phage	100.0	1.7e-91
WP_025210470.1|2225363_2225960_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	99.0	9.1e-108
WP_038428554.1|2226142_2226373_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	92.0	8.2e-33
WP_025210472.1|2226453_2226969_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	100.0	6.4e-94
WP_025210473.1|2227064_2227907_-	hypothetical protein	NA	A0A1B0VAC8	Salmonella_phage	98.9	2.7e-150
WP_025210475.1|2228763_2228988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071849758.1|2229384_2230185_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	68.8	8.8e-98
WP_071849748.1|2230772_2230994_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	98.6	7.4e-39
WP_001313463.1|2231027_2231198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110093306.1|2231375_2234492_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	88.6	0.0e+00
WP_001228228.1|2234559_2235159_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_000741766.1|2235223_2237599_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|2237598_2237880_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_025210478.1|2237889_2238930_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	5.4e-124
WP_000355601.1|2238972_2239266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210479.1|2239493_2240084_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	3.6e-24
WP_000836768.1|2240400_2240634_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001295593.1|2241593_2242028_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|2242168_2243302_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 5
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	2907499	2913805	4998910		Enterobacteria_phage(50.0%)	7	NA	NA
WP_025210617.1|2907499_2908045_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	8.4e-52
WP_025210618.1|2908049_2908928_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.5e-106
WP_001023641.1|2908985_2909885_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_025210619.1|2909884_2910970_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.0e-101
WP_071847121.1|2911042_2911306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183060.1|2911342_2912236_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_025210620.1|2912410_2913805_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 6
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	2960454	3000563	4998910	integrase,holin,head,tRNA,portal,terminase,tail,lysis,plate,capsid	Escherichia_phage(59.52%)	51	2964743:2964770	2998748:2998775
WP_000675144.1|2960454_2961858_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|2961854_2962577_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2962756_2963089_+	YegP family protein	NA	NA	NA	NA	NA
WP_025210639.1|2963236_2964598_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.2e-216
2964743:2964770	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000035493.1|2964870_2965125_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
WP_000882931.1|2965170_2966334_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_025210640.1|2966333_2966813_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	3.3e-84
WP_025210641.1|2966827_2969275_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	95.2	0.0e+00
WP_000785970.1|2969267_2969387_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2969419_2969695_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2969751_2970270_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2970282_2971473_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_025210642.1|2971532_2972126_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	8.7e-103
WP_025210643.1|2972324_2972642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191231.1|2972785_2973280_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	60.4	3.7e-46
WP_025210644.1|2973279_2973882_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	3.5e-99
WP_001008234.1|2973853_2974297_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_025210645.1|2974317_2975517_-|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	97.0	2.0e-215
WP_016236406.1|2975513_2976125_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_025210646.1|2976117_2977026_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_025210647.1|2977030_2977378_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	5.0e-58
WP_025210648.1|2977374_2978010_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.4e-111
WP_025210649.1|2978110_2979463_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_025210650.1|2979473_2980013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210651.1|2980028_2980490_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	1.3e-45
WP_025210652.1|2980482_2980950_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	2.2e-80
WP_001440152.1|2980912_2981086_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_023278421.1|2981057_2981483_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.6e-66
WP_025210653.1|2981470_2981896_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	94.3	4.7e-58
WP_001144101.1|2981910_2982408_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2982407_2982689_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2982692_2982896_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2982895_2983405_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_025210654.1|2983504_2984248_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.4	7.3e-123
WP_038428305.1|2984303_2985326_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	100.0	4.6e-192
WP_025210655.1|2986172_2987945_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_025210656.1|2987944_2988979_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	4.6e-200
WP_106121066.1|2989290_2991183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548273.1|2991313_2991778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174129.1|2991791_2992700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210657.1|2992822_2995096_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_021540634.1|2995085_2995361_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
WP_001113264.1|2995357_2995582_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277954.1|2995581_2995884_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	6.5e-46
WP_000217670.1|2996171_2996672_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_038428309.1|2996849_2997125_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	98.9	2.8e-48
WP_001306384.1|2997239_2997539_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_025210659.1|2997654_2998668_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	3.1e-193
WP_038428311.1|2998794_2998944_-	hypothetical protein	NA	NA	NA	NA	NA
2998748:2998775	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_001303579.1|2998931_2999249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210660.1|2999663_3000563_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
>prophage 7
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	3037503	3046946	4998910		Enterobacteria_phage(85.71%)	10	NA	NA
WP_025210665.1|3037503_3038640_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	5.5e-162
WP_025210666.1|3038636_3040637_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3040761_3041223_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3041264_3041735_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001308766.1|3041781_3042501_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3042497_3044183_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3044404_3045136_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3045195_3045303_+	protein YohO	NA	NA	NA	NA	NA
WP_000783144.1|3045283_3046015_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001600159.1|3046019_3046946_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 8
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	3600507	3613227	4998910	integrase	Enterobacteria_phage(75.0%)	14	3596264:3596277	3603612:3603625
3596264:3596277	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|3600507_3600990_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|3601751_3602960_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183326.1|3602963_3604922_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	31.1	8.8e-67
3603612:3603625	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_025210772.1|3605139_3605712_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638629.1|3605785_3606286_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283029.1|3606282_3607017_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|3607568_3607835_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001244665.1|3608379_3608667_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025210773.1|3608659_3609115_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.0e-63
WP_001398476.1|3609539_3609695_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.0	3.5e-19
WP_001244665.1|3609687_3609975_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025210773.1|3609967_3610423_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.0e-63
WP_000856729.1|3610558_3610879_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025210774.1|3610893_3613227_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 9
NZ_CP007393	Escherichia coli strain ST2747, complete genome	4998910	4726070	4736093	4998910	integrase	Enterobacteria_phage(88.89%)	11	4721286:4721299	4736023:4736036
4721286:4721299	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218969.1|4726070_4727243_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	3.6e-209
WP_000022311.1|4727295_4728981_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	54.2	5.1e-180
WP_000446147.1|4729268_4729841_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000638628.1|4729914_4730415_-	transactivation protein	NA	NA	NA	NA	NA
WP_025210993.1|4730411_4731146_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_001149160.1|4731698_4731965_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025210994.1|4731961_4732561_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	2.5e-49
WP_001244665.1|4732553_4732841_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4732833_4733289_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4733424_4733745_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783658.1|4733759_4736093_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
4736023:4736036	attR	CCAACCTGACGCTG	NA	NA	NA	NA
