The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	662069	702671	3139412	protease	Bodo_saltans_virus(25.0%)	33	NA	NA
WP_025314829.1|662069_663173_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	26.8	1.1e-21
WP_025314830.1|663404_664421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314831.1|664864_666565_+	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_025314832.1|666593_668195_+	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_025314833.1|668412_670431_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025314834.1|670610_671825_+	MFS transporter	NA	NA	NA	NA	NA
WP_158413567.1|673034_675770_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.6	7.3e-19
WP_025314836.1|675772_676612_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_025314837.1|676615_679312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314838.1|679312_680413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314839.1|680433_681540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314840.1|681559_682660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314841.1|682680_683781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314842.1|683800_684901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314843.1|684921_685116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314844.1|685663_686563_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_025314845.1|686577_689010_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2H4YEI2	Aeromonas_phage	44.8	1.7e-06
WP_025314846.1|689100_689976_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_025314847.1|690311_691187_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_025314848.1|691522_692383_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_025314849.1|692719_693580_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_025314850.1|694048_694792_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025314851.1|695393_695675_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
WP_025314852.1|695863_696259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314853.1|696384_696864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314854.1|696905_697385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314855.1|697426_697906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314856.1|697947_698427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314857.1|698468_698948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314858.1|698989_699469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314859.1|699510_699990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314860.1|700031_700517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314861.1|700880_702671_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2L0V0F4	Agrobacterium_phage	28.4	5.2e-42
>prophage 2
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	841114	851307	3139412		Enterobacteria_phage(33.33%)	8	NA	NA
WP_025314974.1|841114_843400_-	glycosyltransferase	NA	A0A1V0SDW6	Indivirus	24.8	2.9e-13
WP_025314975.1|843580_844648_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_025314976.1|844664_845531_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.2	2.3e-104
WP_025314977.1|845539_846070_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	62.6	1.8e-59
WP_025314978.1|846078_846945_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.1	3.5e-44
WP_025314979.1|846965_847976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025314980.1|847981_848998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025314981.1|849570_851307_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	32.9	1.7e-58
>prophage 3
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	1351788	1391024	3139412	transposase,terminase,capsid,tail,portal,protease,tRNA,integrase,head	uncultured_Caudovirales_phage(47.06%)	44	1356476:1356491	1383656:1383671
WP_080692447.1|1351788_1352592_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.2	1.2e-65
WP_025315404.1|1352630_1353137_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_025315405.1|1353181_1354315_-	MFS transporter	NA	NA	NA	NA	NA
WP_025315406.1|1355052_1355895_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.1	2.0e-15
WP_158413583.1|1355910_1356066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025315407.1|1356230_1357163_-	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
1356476:1356491	attL	CCAACAATAAGCGACC	NA	NA	NA	NA
WP_080692449.1|1358230_1358548_-	DMT family transporter	NA	NA	NA	NA	NA
WP_025315410.1|1358988_1359897_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025315411.1|1360116_1361025_+	DMT family transporter	NA	NA	NA	NA	NA
WP_110287302.1|1361398_1361512_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025315412.1|1361643_1362183_+	HPP family protein	NA	NA	NA	NA	NA
WP_025315413.1|1362901_1363564_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_025315414.1|1363619_1363892_-	DksA/TraR family C4-type zinc finger protein	NA	E5EYQ9	Acinetobacter_phage	46.7	2.9e-13
WP_025315415.1|1364055_1364589_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_025315416.1|1364601_1365129_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_025315417.1|1365173_1365617_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_025315418.1|1365835_1366900_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_025315419.1|1366911_1368012_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_038517287.1|1368150_1369632_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.5	1.5e-55
WP_025315420.1|1369649_1370105_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_025315421.1|1370424_1371267_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_025315422.1|1371263_1372118_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_025315423.1|1372122_1372971_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_025315424.1|1373165_1376024_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.3	6.9e-145
WP_025315425.1|1376086_1376758_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_025315426.1|1377264_1378497_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	7.4e-104
WP_025315427.1|1378931_1379792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315428.1|1379887_1380067_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_025315429.1|1380077_1380365_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_025315430.1|1380351_1380891_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	55.2	7.6e-45
WP_170115381.1|1381082_1381256_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	41.5	2.4e-05
WP_158092576.1|1381302_1381608_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_025315432.1|1381600_1381837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315433.1|1381829_1382051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315434.1|1382037_1384398_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.5	1.1e-151
1383656:1383671	attR	GGTCGCTTATTGTTGG	NA	NA	NA	NA
WP_025315435.1|1384402_1384723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315436.1|1384949_1386107_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.0	1.4e-141
WP_025315437.1|1386138_1386693_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	56.5	6.6e-52
WP_025315438.1|1386695_1387895_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	64.7	2.9e-153
WP_025315439.1|1387891_1388224_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	46.4	1.3e-18
WP_025315440.1|1388216_1388510_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	66.3	2.0e-28
WP_025315441.1|1388517_1388886_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	50.9	6.3e-27
WP_025315442.1|1389028_1389373_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.5	3.7e-45
WP_025315443.1|1389356_1391024_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	72.9	8.4e-252
>prophage 4
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	1477952	1566816	3139412	transposase,lysis,tail,tRNA,holin,integrase	Salmonella_phage(22.58%)	81	1492828:1492857	1511174:1511203
WP_038517313.1|1477952_1479296_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	76.1	1.3e-162
WP_025315514.1|1479350_1480604_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.5e-96
WP_025315515.1|1480849_1481266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110287324.1|1481291_1482395_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.3	1.1e-61
WP_038517319.1|1482427_1483684_-	esterase FrsA	NA	NA	NA	NA	NA
WP_025315517.1|1483701_1484235_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025315518.1|1484385_1485849_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_025315519.1|1486066_1487077_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_025315520.1|1487166_1487946_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_025315521.1|1488053_1489367_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_025315522.1|1489536_1490910_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_025315523.1|1491076_1492162_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.9	3.7e-83
WP_025315524.1|1492224_1492584_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
1492828:1492857	attL	ACTCATAATCGATTGGTCACTGGTTCAAGT	NA	NA	NA	NA
WP_080692454.1|1493084_1493303_-	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	44.3	3.0e-08
WP_025315525.1|1493932_1494526_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	35.4	1.3e-26
WP_025315404.1|1494547_1495054_+	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_080692447.1|1495092_1495896_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.2	1.2e-65
WP_025315526.1|1495983_1497414_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	34.4	2.8e-54
WP_080692531.1|1497871_1498363_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	36.0	7.2e-26
WP_025315527.1|1498491_1499901_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	35.4	3.7e-59
WP_038517322.1|1500358_1500964_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	36.1	8.0e-27
WP_025315529.1|1500978_1502418_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	36.2	1.1e-55
WP_025315530.1|1502440_1502650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025315531.1|1503139_1503427_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_025315532.1|1503426_1503801_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	38.9	5.3e-13
WP_025315533.1|1503805_1504009_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_025315534.1|1504414_1504762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025315535.1|1504758_1505199_-	hypothetical protein	NA	H6BJ73	Methylophilales_phage	45.6	2.8e-29
WP_025315536.1|1505687_1505870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025315537.1|1506089_1508243_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	44.3	1.3e-151
WP_025315538.1|1508259_1508466_-	TraR/DksA family transcriptional regulator	NA	A0A193GYU8	Escherichia_phage	48.2	9.6e-09
WP_025315539.1|1508465_1508681_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_025315540.1|1508699_1509005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158413586.1|1509086_1509236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110287325.1|1509237_1509474_-	regulator	NA	NA	NA	NA	NA
WP_025315542.1|1509619_1509976_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	44.1	1.2e-11
WP_025315543.1|1510000_1511002_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	63.7	3.3e-118
WP_025315544.1|1511640_1512570_-	hypothetical protein	NA	NA	NA	NA	NA
1511174:1511203	attR	ACTCATAATCGATTGGTCACTGGTTCAAGT	NA	NA	NA	NA
WP_025315545.1|1513557_1514379_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025315546.1|1514696_1516061_+	MFS transporter	NA	NA	NA	NA	NA
WP_025315547.1|1518802_1519273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315548.1|1519442_1521194_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	3.3e-33
WP_025315549.1|1521193_1522951_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.7e-30
WP_025315550.1|1523375_1523981_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148296400.1|1525804_1526880_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.0	1.8e-74
WP_025315555.1|1529147_1529702_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_025315556.1|1529809_1531645_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_038517326.1|1531646_1532324_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_025315558.1|1532333_1533065_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_025315559.1|1533198_1533933_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025315560.1|1533954_1534683_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	33.8	5.3e-25
WP_025315561.1|1534820_1535468_-	YdcF family protein	NA	NA	NA	NA	NA
WP_025315562.1|1535469_1536159_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_025315563.1|1536155_1536614_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_025315564.1|1536717_1538151_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_025315565.1|1538499_1539219_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	65.0	4.1e-22
WP_080692532.1|1539938_1540733_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	63.8	2.3e-21
WP_025315567.1|1541464_1542181_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	63.5	3.8e-20
WP_038517330.1|1542838_1543345_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_025315568.1|1543345_1544974_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_025315569.1|1545127_1545820_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_025315570.1|1545979_1546195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038517333.1|1546365_1546545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315572.1|1546609_1547497_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_025315573.1|1547784_1549710_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	8.5e-131
WP_025315574.1|1549737_1550277_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.0	6.7e-17
WP_025315575.1|1550361_1550559_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_024496189.1|1550591_1550945_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_025315576.1|1551155_1552139_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.0	1.4e-36
WP_025315577.1|1552155_1554543_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_025315578.1|1554548_1554842_+	integration host factor subunit alpha	NA	M4SRV7	Rhodobacter_phage	39.0	3.9e-11
WP_025315579.1|1555171_1556314_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_025315580.1|1556347_1557247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025315581.1|1557246_1558050_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025315582.1|1558049_1558709_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.3e-11
WP_025315583.1|1558726_1560820_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_025315584.1|1561214_1562411_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_025315585.1|1562412_1563501_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_025315586.1|1563540_1565400_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_025315587.1|1565427_1566132_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	30.8	1.8e-09
WP_025315588.1|1566534_1566816_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	1791650	1798742	3139412		Pseudomonas_phage(42.86%)	10	NA	NA
WP_025315759.1|1791650_1792157_-	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	40.6	1.1e-29
WP_025315760.1|1792167_1792569_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	49.6	2.2e-25
WP_025315761.1|1792876_1793086_-	DUF5406 family protein	NA	NA	NA	NA	NA
WP_158413593.1|1793078_1793222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025315762.1|1793224_1793746_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	60.2	1.4e-51
WP_025315763.1|1794021_1794390_-	DUF2528 family protein	NA	NA	NA	NA	NA
WP_051516259.1|1794389_1795622_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	49.0	3.4e-93
WP_051516260.1|1797423_1798128_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	53.1	2.6e-21
WP_051516261.1|1798143_1798425_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	52.3	2.2e-11
WP_025315765.1|1798436_1798742_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	56.0	3.8e-25
>prophage 6
NZ_CP007445	Gilliamella apicola strain wkB1 chromosome, complete genome	3139412	2865086	2878529	3139412	protease	Escherichia_phage(50.0%)	10	NA	NA
WP_025316611.1|2865086_2866961_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	44.9	3.1e-122
WP_025316612.1|2867076_2867913_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.5	6.7e-16
WP_051516288.1|2868157_2868481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025316614.1|2868629_2869460_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_038517583.1|2869577_2870162_-	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	50.0	3.7e-37
WP_025316615.1|2870215_2871055_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.0	1.5e-23
WP_025316616.1|2871056_2871680_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	64.5	9.6e-84
WP_025316617.1|2871690_2874147_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	52.4	4.7e-251
WP_025316618.1|2874386_2876276_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.8e-92
WP_025316619.1|2876303_2878529_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	7.9e-88
