The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG939456	Streptococcus agalactiae COH1	2065074	36644	48708	2065074		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042246.1|36644_40370_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.0	4.3e-38
WP_000220678.1|40603_42058_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	5.4e-53
WP_001291333.1|42085_43108_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
WP_000685108.1|43274_43823_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
WP_000780023.1|43845_44598_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166553.1|44617_46165_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
WP_001045908.1|46357_47257_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783413.1|47403_48708_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_HG939456	Streptococcus agalactiae COH1	2065074	504633	567376	2065074	integrase,transposase,protease,tRNA	Streptococcus_phage(33.33%)	62	530954:530971	578916:578933
WP_000882544.1|504633_506895_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
WP_000443582.1|507192_507423_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|507563_508256_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230129.1|508248_508983_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001106849.1|509269_510964_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.3	7.7e-128
WP_000137498.1|511102_511957_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634982.1|511953_512790_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286946.1|512915_514256_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.0	2.0e-38
WP_001280898.1|514233_514449_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256277.1|514448_515321_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041038.1|515313_516141_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000747940.1|516127_516601_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923611.1|516612_518271_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034835.1|518383_519220_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|519212_520052_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|520026_520629_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|520731_521007_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
WP_001290370.1|521203_521401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254068.1|521444_522377_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.4	1.9e-64
WP_001185383.1|522564_523800_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000285517.1|523818_525030_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527082.1|525042_526278_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200660.1|526262_527075_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003542.1|527146_528463_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209457.1|528526_528925_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|529268_531953_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
530954:530971	attL	TATTATTGATGCAAATGA	NA	NA	NA	NA
WP_000064641.1|533009_534941_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_000351633.1|535030_536155_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|536223_537321_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|537340_538033_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|538016_538946_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165694720.1|539019_540364_+|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	2.8e-64
WP_001022577.1|540434_541145_-	thioesterase	NA	NA	NA	NA	NA
WP_001115859.1|541141_541840_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048142.1|542007_542772_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458617.1|542879_545387_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	1.4e-218
WP_000221828.1|545472_546666_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038473.1|546686_548033_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.7e-56
WP_000167485.1|548072_548630_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001031103.1|548626_549610_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000965178.1|549855_550269_-	OsmC family protein	NA	NA	NA	NA	NA
WP_001278845.1|550422_551313_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	7.4e-05
WP_001231102.1|551309_552284_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	9.8e-144
WP_000011316.1|552280_553192_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.4e-107
WP_000752455.1|553206_554604_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_001227397.1|554745_556266_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_000710757.1|556378_556639_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000583233.1|556747_557683_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_000189636.1|557949_558972_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001162136.1|559030_559474_+	flavodoxin	NA	NA	NA	NA	NA
WP_000418127.1|559550_559826_+	chorismate mutase	NA	NA	NA	NA	NA
WP_000595706.1|559818_561015_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
WP_001068667.1|561598_561946_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|562090_562705_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|562707_562974_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|562973_563378_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|563539_563740_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|563761_564022_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|564147_564357_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|564529_564691_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|565432_566710_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|566719_567376_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
578916:578933	attR	TATTATTGATGCAAATGA	NA	NA	NA	NA
>prophage 3
NZ_HG939456	Streptococcus agalactiae COH1	2065074	916025	937891	2065074	integrase	Streptococcus_phage(88.89%)	24	930048:930062	945684:945698
WP_000421280.1|916025_916340_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	76.7	7.0e-43
WP_001234189.1|916360_916738_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	77.2	5.6e-47
WP_000185760.1|916747_917521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130247.1|917542_918946_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	67.2	2.3e-178
WP_000426691.1|919127_920312_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	67.6	1.0e-158
WP_000055367.1|920308_920581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009054.1|920577_920799_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000678782.1|920840_921620_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_000421245.1|921681_922182_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	61.1	5.4e-53
WP_000234705.1|922253_923279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723886.1|923349_923745_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	75.0	1.7e-49
WP_000941001.1|923728_926182_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	79.1	0.0e+00
WP_000192390.1|926178_928206_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.7	1.8e-195
WP_000768374.1|928202_929225_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	1.4e-132
WP_000584387.1|929241_930171_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
930048:930062	attL	AAAAGATAACCAAGT	NA	NA	NA	NA
WP_001791010.1|930415_930532_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691737.1|930547_932467_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
WP_032506803.1|932564_932753_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_001227349.1|932810_933164_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	90.5	1.3e-53
WP_000804878.1|933695_934118_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	70.0	1.0e-49
WP_000845144.1|934114_934345_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	7.9e-28
WP_000633909.1|934840_935041_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000237798.1|935067_936261_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.0	2.4e-43
WP_000129871.1|936328_937891_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	4.9e-20
945684:945698	attR	AAAAGATAACCAAGT	NA	NA	NA	NA
>prophage 4
NZ_HG939456	Streptococcus agalactiae COH1	2065074	1136094	1215981	2065074	integrase,transposase,protease,tRNA	Bacillus_phage(30.77%)	60	1180547:1180564	1224599:1224616
WP_088186184.1|1136094_1137440_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_000129278.1|1137515_1138283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022110.1|1138291_1139002_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000254651.1|1138985_1140242_-	chloride channel protein	NA	NA	NA	NA	NA
WP_000173383.1|1140243_1141053_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000416957.1|1141091_1141499_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	52.3	7.7e-34
WP_000077191.1|1141549_1142761_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000343877.1|1142817_1143489_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_001259482.1|1143726_1144437_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000863793.1|1144526_1145315_-	esterase family protein	NA	NA	NA	NA	NA
WP_001280054.1|1145371_1147033_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000979970.1|1147329_1148091_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-12
WP_000587301.1|1148090_1148954_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000790858.1|1148966_1149971_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006716.1|1150329_1151985_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000005481.1|1152038_1152758_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140341.1|1152771_1154454_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934868.1|1154563_1155790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075588.1|1155779_1156970_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796047.1|1157061_1157523_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163512.1|1157512_1157995_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000403410.1|1158211_1161430_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000134275.1|1161481_1162528_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	6.6e-69
WP_000139163.1|1162734_1163328_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000676114.1|1163327_1164197_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000716829.1|1164255_1165359_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000647415.1|1165367_1166156_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000365673.1|1166145_1166829_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221656.1|1166932_1167613_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1167730_1168249_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_001247507.1|1168371_1170936_-	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_000622235.1|1171087_1173286_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
WP_000124585.1|1173282_1174044_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405388.1|1174045_1174975_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568320.1|1175016_1175664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573351.1|1175656_1176895_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001226480.1|1176985_1177876_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1177986_1178163_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_000823033.1|1179252_1183011_-	pullulanase	NA	NA	NA	NA	NA
1180547:1180564	attL	ATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
WP_001205490.1|1183179_1183914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130587.1|1183928_1184513_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150951.1|1184609_1186016_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_000670189.1|1186062_1186665_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000942623.1|1186834_1188616_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	2.1e-06
WP_088186184.1|1188672_1190018_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001003955.1|1190092_1191874_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567585.1|1192032_1192800_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285045.1|1192858_1194199_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000245056.1|1194298_1194715_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1194718_1195216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162278.1|1195437_1196034_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_088197863.1|1196222_1197327_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_000754588.1|1199161_1201630_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000755138.1|1201642_1202563_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_001227840.1|1204654_1208107_-	C5a peptidase ScpA/B	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
WP_000453221.1|1208760_1210095_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_000584204.1|1210202_1210751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863581.1|1210847_1211078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248015.1|1213363_1214599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157135.1|1214778_1215981_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1224599:1224616	attR	ATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
>prophage 5
NZ_HG939456	Streptococcus agalactiae COH1	2065074	1488859	1501120	2065074	transposase	Streptococcus_phage(90.91%)	13	NA	NA
WP_000767484.1|1488859_1489687_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287943.1|1489726_1490083_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1490084_1490561_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_001167085.1|1491838_1492387_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000587955.1|1492454_1493546_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
WP_000603277.1|1493678_1494314_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425856.1|1494583_1495453_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.9e-110
WP_000358198.1|1495452_1495779_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364562.1|1495808_1496672_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
WP_000715592.1|1496691_1497327_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_000160598.1|1497535_1498702_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_001144245.1|1498966_1499626_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
WP_001185986.1|1499644_1501120_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.1	8.2e-17
>prophage 6
NZ_HG939456	Streptococcus agalactiae COH1	2065074	2010017	2026188	2065074	integrase	Streptococcus_phage(71.43%)	26	2009184:2009203	2023591:2023610
2009184:2009203	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_000381996.1|2010017_2010524_-	DUF4065 domain-containing protein	NA	D7RWK7	Brochothrix_phage	48.8	3.0e-35
WP_000038828.1|2011017_2011404_-	ArpU family transcriptional regulator	NA	A0A141E173	Streptococcus_phage	32.8	1.8e-08
WP_000500996.1|2011378_2011741_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000661533.1|2012139_2012628_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
WP_001258770.1|2012712_2013318_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	47.3	1.4e-39
WP_001869738.1|2013398_2014220_-	DnaD domain protein	NA	R9QM95	Lactococcus_phage	68.7	1.2e-30
WP_000492119.1|2014388_2014661_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	69.8	2.5e-28
WP_000174504.1|2014653_2014995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206023.1|2014991_2015354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017645222.1|2015365_2015557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877495.1|2015556_2015889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259477.1|2015977_2016484_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	34.4	2.2e-06
WP_000130289.1|2016572_2016746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021393.1|2016844_2017483_-	Bro-N domain-containing protein	NA	NA	NA	NA	NA
WP_000648623.1|2017705_2017948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258617.1|2017974_2018595_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.8	2.2e-40
WP_000359663.1|2018618_2018819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001080841.1|2019024_2019639_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.7	2.6e-17
WP_000946250.1|2019650_2019938_+	DUF3102 domain-containing protein	NA	A0A286QMZ8	Streptococcus_phage	61.4	1.9e-10
WP_000876115.1|2020451_2020637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350953.1|2020648_2020990_+	hypothetical protein	NA	A0A1S5SDB5	Streptococcus_phage	59.7	2.2e-13
WP_000429449.1|2021016_2021982_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
WP_025194320.1|2022319_2023486_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.1	5.6e-154
WP_000092759.1|2023592_2024204_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2023591:2023610	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_001278152.1|2024533_2024821_-	Veg family protein	NA	NA	NA	NA	NA
WP_000230635.1|2024832_2026188_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
