The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	315304	423752	2609404	tail,capsid,terminase,plate,integrase,head,tRNA,portal	Acidithiobacillus_phage(14.29%)	108	316540:316557	430962:430979
WP_012230659.1|315304_315991_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
316540:316557	attL	ACATAAATATATTTTTGT	NA	NA	NA	NA
WP_012230660.1|316885_317914_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_012230662.1|317963_318569_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_012230664.1|318600_318924_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_012230666.1|318938_320879_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	34.7	1.7e-41
WP_012230668.1|321715_322120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230670.1|322666_323530_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_012230672.1|323526_324258_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012230679.1|324362_324926_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_012230681.1|325819_326614_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_012230683.1|326701_327640_+	glutathione synthase	NA	NA	NA	NA	NA
WP_012230685.1|327779_328826_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.4	1.6e-62
WP_012230688.1|328902_330363_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012230690.1|330359_331649_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_012230692.1|331700_332459_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.0e-15
WP_012230694.1|332480_333203_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012230696.1|333805_334642_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012230698.1|334819_336067_+	aminopeptidase	NA	NA	NA	NA	NA
WP_012230700.1|336346_337222_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	32.2	2.6e-26
WP_012230701.1|337307_338702_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012230702.1|338694_339315_+	ribonuclease D	NA	U3REX2	uncultured_virus	31.7	1.8e-13
WP_038473220.1|340748_341066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038473222.1|342596_343430_+	porin family protein	NA	O11861	Bartonella_henselae_phage	57.1	4.0e-77
WP_038473224.1|343767_344640_+	porin family protein	NA	O11861	Bartonella_henselae_phage	53.0	6.7e-75
WP_012230705.1|346047_347682_+	outer membrane beta-barrel protein	NA	O11861	Bartonella_henselae_phage	48.3	3.6e-21
WP_012230706.1|347931_350847_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.6	5.2e-63
WP_038473227.1|351024_351516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230713.1|352171_352618_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_012230715.1|352885_354286_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012230716.1|354266_354833_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012230724.1|355632_356079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230726.1|357572_358904_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_038473230.1|358890_359694_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_012230730.1|359739_359985_+	DUF4170 domain-containing protein	NA	NA	NA	NA	NA
WP_012230731.1|361214_362537_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_012230734.1|362526_363567_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012230735.1|363586_363823_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_012230736.1|363934_365788_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.2	1.7e-107
WP_012230737.1|366061_367150_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_012230738.1|368233_369385_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_049776822.1|371697_371943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038473233.1|373584_373812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230743.1|373808_374471_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	64.9	9.0e-48
WP_122364081.1|375565_376186_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	56.9	5.1e-53
WP_038473237.1|376615_377773_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	40.5	3.6e-76
WP_012230746.1|378045_378636_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	52.0	3.9e-26
WP_012230747.1|378755_379031_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012230749.1|379043_379325_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_012230750.1|379449_379662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230751.1|379790_380018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230752.1|380014_380677_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	61.5	1.2e-47
WP_012230755.1|380783_381107_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.2e-15
WP_012230757.1|381118_381430_+	addiction module antidote protein	NA	NA	NA	NA	NA
WP_012230759.1|381502_382810_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.9	1.1e-70
WP_012230761.1|382806_383031_-|tail	tail protein X	tail	Q8H9M2	Vibrio_phage	44.6	9.8e-07
WP_012230762.1|383027_383408_-|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	46.3	3.4e-23
WP_012230763.1|383413_385549_-|tail	tail protein	tail	NA	NA	NA	NA
WP_120100553.1|385545_385659_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012230764.1|385655_385943_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012230765.1|385944_386451_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	40.0	5.5e-29
WP_012230766.1|386450_387662_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	D5LGY7	Escherichia_phage	53.2	5.5e-128
WP_012230767.1|388048_388780_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	41.5	6.9e-49
WP_012230777.1|388776_389055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230778.1|389100_389430_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012230779.1|389517_389697_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	60.7	9.6e-13
WP_038473240.1|391390_394534_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	32.0	1.2e-150
WP_012230791.1|394535_395642_-	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	35.8	1.7e-19
WP_012230798.1|395641_396469_-|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	34.1	8.9e-37
WP_038473244.1|396465_396807_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	60.6	6.0e-32
WP_012230800.1|396803_397469_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	33.1	9.1e-16
WP_012230801.1|397449_397992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230802.1|398045_398360_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	32.3	9.9e-05
WP_012230805.1|398376_398673_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	36.4	9.0e-08
WP_012230806.1|398719_398998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230810.1|400109_401195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230813.1|401577_402654_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	34.7	2.7e-54
WP_012230814.1|402666_403035_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	46.7	1.3e-11
WP_038474435.1|403031_403376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473247.1|403294_404359_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	48.3	2.8e-67
WP_012230821.1|404348_405920_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	39.3	3.1e-91
WP_012230825.1|405919_406168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230826.1|406171_408100_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	4.3e-167
WP_012230827.1|408130_408682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473250.1|408766_409033_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_012230834.1|409010_409316_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_012230838.1|409368_409647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230839.1|409643_410384_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	37.0	2.0e-24
WP_012230840.1|410982_411561_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	33.8	1.2e-08
WP_012230843.1|411564_411906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473253.1|412257_412440_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012230844.1|412460_412883_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	36.6	1.3e-15
WP_012230845.1|412885_413428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230846.1|413438_413885_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	54.8	5.1e-31
WP_012230847.1|414027_414402_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012230849.1|414427_415300_-	DNA adenine methylase	NA	A7YGS0	Campylobacter_phage	22.3	2.7e-07
WP_038474438.1|415434_415950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230851.1|415936_416293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230856.1|416456_416876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230859.1|416868_417942_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	50.0	4.4e-12
WP_012230860.1|417931_418411_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	62.7	3.1e-50
WP_038473256.1|418472_418784_-	hypothetical protein	NA	A0A076G8E5	Sinorhizobium_phage	50.0	1.6e-10
WP_012230862.1|418834_419485_+	helix-turn-helix transcriptional regulator	NA	A0A076G6G1	Sinorhizobium_phage	45.3	8.9e-08
WP_012230863.1|419647_420022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230865.1|420090_420483_+	Rha family transcriptional regulator	NA	A0A067YYV5	Escherichia_phage	39.6	3.8e-14
WP_012230867.1|420492_421251_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	38.6	1.3e-39
WP_012230869.1|421608_422199_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	50.8	2.3e-23
WP_012230871.1|422350_423127_+	ERF family protein	NA	A0A125RNR3	Pseudomonas_phage	29.1	1.3e-16
WP_012230877.1|423128_423752_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	46.0	1.6e-46
430962:430979	attR	ACAAAAATATATTTATGT	NA	NA	NA	NA
>prophage 2
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	476795	562029	2609404	tail,capsid,terminase,plate,integrase,head,portal	Acidithiobacillus_phage(13.04%)	98	495292:495314	572279:572301
WP_012230948.1|476795_477095_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	34.2	1.6e-07
WP_012230950.1|477152_478190_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.8	4.9e-32
WP_012230952.1|478192_478441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230954.1|478552_479176_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	46.5	7.2e-47
WP_038473282.1|479177_479984_-	ERF family protein	NA	A0A0U2C0X9	Paracoccus_phage	30.3	4.5e-17
WP_012230958.1|480057_480600_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	52.6	6.7e-09
WP_012230960.1|480593_481085_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	54.4	7.7e-12
WP_012230962.1|481088_481703_-	hypothetical protein	NA	A0A0A7NNQ1	Lactobacillus_phage	58.7	9.3e-07
WP_012230964.1|481714_482032_-	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	63.0	2.5e-11
WP_012230966.1|482044_482776_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	34.9	1.4e-25
WP_012230968.1|482848_483205_-	antA/AntB antirepressor family protein	NA	NA	NA	NA	NA
WP_012230972.1|483798_484401_-	helix-turn-helix transcriptional regulator	NA	A0A1X9HW95	Ruegeria_phage	43.5	2.0e-17
WP_038474456.1|484502_484748_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012230977.1|485259_486405_+	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	52.9	2.1e-12
WP_038474459.1|486568_486775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230985.1|488613_488940_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_012230987.1|488936_489161_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_012230988.1|489383_489830_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	55.7	1.2e-32
WP_012230989.1|489883_490384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230990.1|490436_490694_+	antitoxin	NA	NA	NA	NA	NA
WP_012230991.1|490690_491017_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_007346764.1|491227_491455_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_012230995.1|491438_491708_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	44.4	5.9e-14
WP_012231000.1|492256_492700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081458153.1|494846_495371_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	67.5	8.5e-09
495292:495314	attL	ACATCATCAAAATCTCTTAAAGC	NA	NA	NA	NA
WP_038473291.1|495505_496084_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	55.2	3.4e-11
WP_012231005.1|496165_496846_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	55.4	2.0e-10
WP_038473297.1|503229_503409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038473299.1|503714_505331_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_007347209.1|506325_506526_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012231012.1|508497_510552_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_012231013.1|510568_511465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231014.1|511562_512705_+|capsid	N4-gp56 family major capsid protein	capsid	A0A1Y0SUD3	Pseudomonas_phage	29.8	8.3e-33
WP_012231015.1|512724_513183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231020.1|513257_513956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231022.1|513955_515413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231024.1|515454_515838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231026.1|515839_516895_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_038473305.1|516894_518844_+	hypothetical protein	NA	C8CLJ2	Xylella_phage	26.1	1.7e-06
WP_012231029.1|518836_521047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231031.1|521770_522928_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	40.3	6.1e-76
WP_012231033.1|523199_523757_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	50.5	1.0e-20
WP_012231039.1|524516_524795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230747.1|524914_525190_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012230749.1|525202_525484_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_012230750.1|525608_525821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231042.1|525949_526177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231043.1|526173_526836_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	62.1	5.3e-48
WP_006589072.1|526995_527298_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	3.4e-18
WP_012231054.1|527284_527605_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.2	2.6e-16
WP_012231055.1|527648_527927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231056.1|527923_528649_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	36.9	4.0e-25
WP_012231057.1|528950_530258_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.7	2.5e-70
WP_012230761.1|530254_530479_-|tail	tail protein X	tail	Q8H9M2	Vibrio_phage	44.6	9.8e-07
WP_012230762.1|530475_530856_-|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	46.3	3.4e-23
WP_012230763.1|530861_532997_-|tail	tail protein	tail	NA	NA	NA	NA
WP_120100553.1|532993_533107_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012230764.1|533103_533391_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012230765.1|533392_533899_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	40.0	5.5e-29
WP_012230766.1|533898_535110_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	D5LGY7	Escherichia_phage	53.2	5.5e-128
WP_012230767.1|535496_536228_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	41.5	6.9e-49
WP_012230777.1|536224_536503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231059.1|536548_536890_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012231060.1|536900_537179_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012231061.1|537412_537664_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012231062.1|537656_538043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231063.1|538052_538349_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012230779.1|538436_538616_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	60.7	9.6e-13
WP_012230782.1|540309_543453_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	32.0	5.4e-151
WP_012230791.1|543454_544561_-	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	35.8	1.7e-19
WP_012230798.1|544560_545388_-|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	34.1	8.9e-37
WP_038473244.1|545384_545726_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	60.6	6.0e-32
WP_012231064.1|545722_546388_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	30.3	8.0e-12
WP_012230801.1|546368_546911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231065.1|546960_547233_+	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	65.0	1.2e-06
WP_012231066.1|547222_547540_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012231067.1|547585_547858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231068.1|547928_548237_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_012231069.1|548233_548482_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_012231070.1|548576_548933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231071.1|548934_550011_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	35.2	5.0e-56
WP_012230814.1|550023_550392_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	46.7	1.3e-11
WP_038474435.1|550388_550733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473315.1|550651_551719_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	48.3	2.8e-67
WP_012230821.1|551708_553280_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	39.3	3.1e-91
WP_012230825.1|553279_553528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230826.1|553531_555460_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	4.3e-167
WP_012230827.1|555490_556042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473250.1|556126_556393_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_012230834.1|556370_556676_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_012230838.1|556728_557007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230839.1|557003_557744_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	37.0	2.0e-24
WP_012231073.1|558342_558921_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	35.0	5.5e-09
WP_012231074.1|558924_559239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473319.1|559553_559736_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012231075.1|559756_560179_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	35.7	2.4e-14
WP_081458154.1|560182_560689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231077.1|560862_562029_+|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	40.8	3.1e-75
572279:572301	attR	GCTTTAAGAGATTTTGATGATGT	NA	NA	NA	NA
>prophage 3
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	578410	591239	2609404		Lactobacillus_phage(16.67%)	18	NA	NA
WP_012231087.1|578410_578890_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	62.7	2.8e-51
WP_038473333.1|578968_579406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122364095.1|579529_579895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473334.1|579994_580270_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004856665.1|580364_581018_+	helix-turn-helix domain-containing protein	NA	A0A076G6G1	Sinorhizobium_phage	55.3	2.5e-50
WP_012231089.1|581038_582094_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	38.3	3.5e-62
WP_012231090.1|582502_582877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231091.1|582945_583338_+	Rha family transcriptional regulator	NA	A0A067YYV5	Escherichia_phage	39.6	2.2e-14
WP_012231093.1|583347_584106_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	39.0	4.6e-40
WP_012230964.1|584118_584436_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	63.0	2.5e-11
WP_012230962.1|584447_585062_+	hypothetical protein	NA	A0A0A7NNQ1	Lactobacillus_phage	58.7	9.3e-07
WP_012230960.1|585065_585557_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	54.4	7.7e-12
WP_012230958.1|585550_586093_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	52.6	6.7e-09
WP_038473337.1|586166_586928_+	ERF family protein	NA	A0A0U2C0X9	Paracoccus_phage	30.3	5.5e-17
WP_012231098.1|586929_587553_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	46.0	2.1e-46
WP_007347214.1|587631_587835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012231100.1|588410_589568_+	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_012231101.1|589949_591239_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	36.3	4.3e-38
>prophage 4
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	935743	1013986	2609404	tail,protease,tRNA	Tupanvirus(11.76%)	60	NA	NA
WP_012231439.1|935743_937018_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	7.8e-133
WP_012231441.1|937202_939629_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.8	1.1e-204
WP_012231443.1|939860_940139_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	57.3	9.0e-18
WP_012231445.1|941137_942562_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_012231446.1|942947_944375_+	trigger factor	NA	NA	NA	NA	NA
WP_012231448.1|944500_946000_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_012231450.1|946180_946579_+	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_012231452.1|946664_947081_+	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_012231454.1|948305_949037_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012231456.1|949033_949864_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012231465.1|950439_951615_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	24.2	1.4e-11
WP_012231467.1|951971_952184_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012231469.1|952204_952735_+	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	31.7	1.3e-12
WP_012231471.1|952884_953313_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_012231473.1|953317_954022_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_012231475.1|954379_954898_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_012231477.1|954999_955371_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012231479.1|955657_959809_+	DNA-directed RNA polymerase subunit beta	NA	R4TQG3	Phaeocystis_globosa_virus	30.0	2.5e-26
WP_012231481.1|959979_964191_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	1.3e-67
WP_012231485.1|965349_966039_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	33.0	1.7e-25
WP_012231486.1|966377_967769_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_012231487.1|969648_969927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231488.1|969959_971309_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.2	1.9e-28
WP_012231489.1|971542_971914_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.6e-15
WP_012231491.1|971920_974272_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	45.0	1.1e-180
WP_012231492.1|974297_974720_-	HIT family protein	NA	NA	NA	NA	NA
WP_012231493.1|974853_975315_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	43.1	3.7e-24
WP_012231494.1|975457_976294_+	cell envelope integrity EipB family protein	NA	NA	NA	NA	NA
WP_038473465.1|976462_977263_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_012231496.1|977366_978290_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_012231497.1|978446_979166_+	UMP kinase	NA	NA	NA	NA	NA
WP_012231499.1|979203_979764_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_012231501.1|980490_981306_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038473468.1|981321_982470_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012231505.1|982674_985071_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_012231507.1|985139_986186_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012231508.1|986187_986655_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_012231509.1|986679_987492_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_012231510.1|987506_988379_+	UDP-2,3-diacylglucosamine diphosphatase LpxI	NA	NA	NA	NA	NA
WP_012231511.1|988371_989568_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_012231512.1|989588_990362_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.2e-32
WP_012231513.1|990442_991150_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012231516.1|991146_991869_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012231518.1|991946_992699_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012231520.1|993127_993880_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012231522.1|994722_996018_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_012231524.1|996282_997713_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012231526.1|997827_1000137_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_012231527.1|1000433_1001138_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012231528.1|1001235_1001793_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_012231530.1|1001998_1003390_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	5.1e-45
WP_012231532.1|1003461_1004841_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_012231534.1|1004968_1006630_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.3	6.9e-97
WP_012231536.1|1006640_1008014_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.8	2.8e-11
WP_012231541.1|1008074_1009478_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.4e-50
WP_012231543.1|1009621_1010395_-	NAD kinase	NA	NA	NA	NA	NA
WP_012231545.1|1011174_1012353_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_081458177.1|1012720_1012876_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_012231548.1|1013017_1013344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231550.1|1013500_1013986_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 5
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1018888	1028729	2609404		Mannheimia_phage(10.0%)	18	NA	NA
WP_012231565.1|1018888_1019170_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	46.2	4.5e-17
WP_007346872.1|1019185_1019473_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012231568.1|1019517_1019796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231569.1|1019792_1020506_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	35.1	1.2e-34
WP_012231073.1|1021101_1021680_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	35.0	5.5e-09
WP_012231570.1|1021683_1022004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231571.1|1022477_1022873_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012231574.1|1022869_1023070_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	47.4	2.7e-08
WP_012231576.1|1023134_1023671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473476.1|1023681_1024128_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	56.5	2.1e-32
WP_038473479.1|1024368_1024560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231580.1|1024629_1025058_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	34.4	1.3e-10
WP_012231582.1|1025106_1025655_-	antA/AntB antirepressor family protein	NA	A0A0N6WET9	Escherichia_phage	50.8	2.8e-23
WP_012231584.1|1025868_1026246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231586.1|1026407_1026827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231587.1|1026819_1027923_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	51.4	1.6e-12
WP_012231588.1|1027912_1028260_-	YdaU family protein	NA	A0A223W0C2	Agrobacterium_phage	40.0	6.2e-08
WP_012231589.1|1028252_1028729_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.8	1.5e-49
>prophage 6
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1033038	1111325	2609404	integrase,portal,terminase	Edwardsiella_phage(25.0%)	57	1069637:1069670	1126089:1126122
WP_012231595.1|1033038_1033356_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	61.1	2.5e-11
WP_012231596.1|1033367_1033937_+	hypothetical protein	NA	K4PWT3	Edwardsiella_phage	55.0	7.1e-09
WP_038473484.1|1034010_1034832_+	ERF family protein	NA	Q9MC70	Pseudomonas_phage	28.4	1.9e-15
WP_012231598.1|1034833_1035457_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	42.9	1.5e-44
WP_012231599.1|1035535_1035739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012231600.1|1035932_1036970_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.7	1.5e-33
WP_012231601.1|1036978_1037197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231602.1|1037318_1037942_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	44.6	9.3e-47
WP_012231603.1|1037943_1038759_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	45.9	1.2e-41
WP_012231605.1|1039369_1039837_-	hypothetical protein	NA	A0A0A7NP48	Lactobacillus_phage	58.2	4.7e-11
WP_012231606.1|1039851_1040598_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	45.7	5.5e-54
WP_012231607.1|1040646_1041066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473488.1|1041294_1041627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473490.1|1041733_1042051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171815237.1|1042610_1042949_+	hypothetical protein	NA	S5MLS6	Pseudoalteromonas_phage	56.6	2.0e-19
WP_038473493.1|1042963_1043179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231610.1|1043222_1043699_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	63.0	1.2e-49
WP_012231611.1|1043685_1044063_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_012231612.1|1044052_1045141_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_171815238.1|1045100_1045553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122364086.1|1045746_1046136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231615.1|1046429_1046945_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	59.6	7.8e-23
WP_012231616.1|1047025_1047685_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	50.8	5.7e-10
WP_038473503.1|1050215_1050995_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	47.6	3.7e-08
WP_012231619.1|1051100_1051679_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	55.2	5.9e-11
WP_012231620.1|1051760_1052534_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.3	1.9e-09
WP_012231621.1|1052615_1053347_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	63.6	1.1e-11
WP_038473506.1|1054961_1059920_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	26.7	3.5e-43
WP_012231623.1|1060451_1060853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038474548.1|1061306_1061618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231625.1|1061823_1062129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231626.1|1062579_1062729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007347430.1|1062826_1063027_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012231627.1|1063235_1064402_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	38.8	2.3e-75
WP_012231628.1|1064825_1065350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231629.1|1065351_1066086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231630.1|1067942_1068722_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	49.2	1.6e-08
WP_012231631.1|1068835_1069414_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	55.2	2.6e-11
WP_012231632.1|1069496_1070159_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	51.7	5.7e-10
1069637:1069670	attL	AGATTTTTGCATTGCCATAAACAGAGCCATAAAC	NA	NA	NA	NA
WP_012231633.1|1070239_1070875_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	52.8	7.9e-09
WP_012231635.1|1078048_1079536_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_169309787.1|1079507_1079657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007347430.1|1079963_1080164_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012231636.1|1080372_1081539_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	38.8	6.8e-75
WP_012231638.1|1081940_1083269_+|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	57.8	1.7e-146
WP_012231639.1|1083253_1085215_+|portal	phage portal protein	portal	H2DE37	Erwinia_phage	24.0	6.2e-36
WP_012231640.1|1086707_1087487_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	50.8	2.5e-09
WP_012231641.1|1087603_1088182_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	55.2	3.4e-11
WP_012231642.1|1088264_1088906_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	52.8	1.0e-08
WP_012231643.1|1090629_1095573_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	26.8	1.7e-45
WP_038473519.1|1096611_1098399_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_012231645.1|1098423_1106469_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.4	2.1e-29
WP_012231646.1|1106489_1106906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038473522.1|1106997_1107474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231649.1|1109127_1109532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231650.1|1109747_1109948_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012231651.1|1110158_1111325_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	38.2	3.5e-71
1126089:1126122	attR	GTTTATGGCTCTGTTTATGGCAATGCAAAAATCT	NA	NA	NA	NA
>prophage 7
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1242368	1363935	2609404	tail,plate,tRNA,transposase,holin	Ochrobactrum_phage(77.59%)	116	NA	NA
WP_012231741.1|1242368_1243928_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	42.3	1.1e-101
WP_012231742.1|1243917_1244691_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012231743.1|1244701_1245511_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012231744.1|1245623_1245983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012231745.1|1246387_1246801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231746.1|1246797_1247844_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_038473576.1|1247868_1248687_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_012231748.1|1248866_1250093_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_012231749.1|1251117_1251462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038473579.1|1251439_1251796_+	membrane protein	NA	NA	NA	NA	NA
WP_012231751.1|1252233_1252761_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	56.5	2.2e-49
WP_012231752.1|1253373_1254312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231753.1|1254752_1257503_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_012231754.1|1257526_1259167_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	46.2	1.4e-97
WP_012231755.1|1259224_1259626_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012231756.1|1259618_1260863_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.8	3.4e-96
WP_012231757.1|1260873_1262139_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012231758.1|1262150_1262906_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.1	1.8e-07
WP_012231759.1|1263066_1264578_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012231760.1|1264748_1265894_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012231761.1|1266055_1266736_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012231762.1|1267023_1268277_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.9	5.6e-67
WP_012231763.1|1268489_1268975_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_122364087.1|1269331_1270460_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_012231765.1|1270628_1273094_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_038473585.1|1273263_1274493_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	27.1	1.4e-09
WP_012231767.1|1275088_1277704_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_012231768.1|1277773_1278385_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_012231769.1|1280751_1281621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231770.1|1281871_1285372_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012231771.1|1285377_1285665_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_012231772.1|1285731_1286412_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	2.1e-23
WP_012231773.1|1286411_1287680_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012231774.1|1287691_1289017_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038474588.1|1289218_1290895_-	ribonuclease J	NA	NA	NA	NA	NA
WP_012231776.1|1290941_1291751_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_012231777.1|1291750_1293205_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_012231778.1|1293222_1294692_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_012231779.1|1294688_1296656_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_012231780.1|1296662_1296971_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_012231781.1|1296985_1297606_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_004860049.1|1297702_1298194_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_012231782.1|1298208_1299255_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_012231783.1|1299277_1301347_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_012231784.1|1301412_1302720_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_012231785.1|1302821_1303493_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_012231786.1|1303492_1304683_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_012231787.1|1304803_1305415_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_012231788.1|1305429_1306011_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_012231789.1|1306001_1306367_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_012231790.1|1308380_1309202_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_012231791.1|1309344_1310328_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.8	5.4e-89
WP_038473589.1|1310327_1310582_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	1.8e-12
WP_012231793.1|1310578_1311049_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038473591.1|1311205_1313542_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	49.2	1.5e-113
WP_012231795.1|1313673_1314087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231796.1|1314096_1314615_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	65.3	2.9e-62
WP_038474594.1|1314611_1315901_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	61.7	3.0e-148
WP_012231798.1|1316046_1316259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231799.1|1316268_1317585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473595.1|1317599_1320743_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	31.9	2.7e-150
WP_038473599.1|1320744_1321851_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	35.3	6.8e-16
WP_012231802.1|1321850_1322717_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	1.9e-45
WP_012231803.1|1322703_1323090_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	53.4	4.2e-29
WP_012231804.1|1323093_1323294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231805.1|1323306_1323900_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_038473602.1|1323896_1324418_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	50.6	7.6e-42
WP_038473605.1|1324414_1324909_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	56.1	5.1e-40
WP_012231808.1|1324910_1325336_-	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	47.5	1.6e-26
WP_012231809.1|1325351_1326317_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	61.4	1.2e-109
WP_012231810.1|1326329_1326671_-	DUF2190 family protein	NA	A0A219VH82	Ochrobactrum_phage	46.4	4.4e-14
WP_038473607.1|1326667_1327717_-	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	43.3	6.8e-66
WP_012231812.1|1328328_1329534_-	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	53.4	8.5e-129
WP_012231813.1|1329526_1331104_-	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	56.5	7.3e-173
WP_038473610.1|1331116_1332739_-	phage protein	NA	A0A219VH72	Ochrobactrum_phage	65.2	6.8e-182
WP_012231815.1|1332731_1333313_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	47.5	9.0e-36
WP_012231816.1|1333275_1333632_-	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	46.9	1.5e-17
WP_012231817.1|1333628_1333943_-	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	39.4	3.4e-13
WP_038473613.1|1333952_1334177_-	hypothetical protein	NA	A0A219VHE3	Ochrobactrum_phage	52.3	2.1e-09
WP_012231818.1|1334142_1334484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231819.1|1334476_1334764_-	hypothetical protein	NA	A0A219VHD7	Ochrobactrum_phage	57.6	2.8e-14
WP_012231820.1|1334760_1335342_-	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	51.8	1.1e-44
WP_012231821.1|1335428_1335836_-	helix-turn-helix domain-containing protein	NA	A0A219VHE2	Ochrobactrum_phage	48.8	2.4e-27
WP_038473614.1|1335842_1336460_-	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	44.7	7.6e-41
WP_012231823.1|1336470_1337094_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	63.2	7.1e-71
WP_012231825.1|1337356_1337626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473618.1|1337622_1338654_-	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	53.1	1.5e-89
WP_038473623.1|1339011_1340982_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A219VHD4	Ochrobactrum_phage	60.5	1.9e-162
WP_012231828.1|1340978_1341437_-	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	64.3	2.7e-43
WP_012231829.1|1341433_1342450_-	ParB N-terminal domain-containing protein	NA	A0A219VHB6	Ochrobactrum_phage	46.7	3.6e-72
WP_038473628.1|1342449_1342848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815226.1|1342831_1342969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473706.1|1343044_1343338_-	helix-turn-helix domain-containing protein	NA	A0A219VHB8	Ochrobactrum_phage	65.3	2.3e-19
WP_012231832.1|1343490_1344021_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012231790.1|1344601_1345423_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_012231791.1|1345565_1346549_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.8	5.4e-89
WP_012231792.1|1346548_1346803_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	1.8e-12
WP_012231793.1|1346799_1347270_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038473631.1|1347426_1349763_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	49.2	2.0e-113
WP_012231795.1|1349894_1350308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231796.1|1350317_1350836_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	65.3	2.9e-62
WP_038474594.1|1350832_1352122_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	61.7	3.0e-148
WP_012231798.1|1352267_1352480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473633.1|1352489_1353806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473636.1|1353820_1356964_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	32.0	1.2e-150
WP_012231835.1|1356965_1358072_-	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	35.3	3.1e-16
WP_012231802.1|1358071_1358938_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	1.9e-45
WP_012231803.1|1358924_1359311_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	53.4	4.2e-29
WP_012231804.1|1359314_1359515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231836.1|1359527_1360121_-|plate	phage baseplate assembly protein V	plate	A0A219VHA3	Ochrobactrum_phage	37.5	1.2e-27
WP_038473639.1|1360117_1360639_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	49.4	1.3e-41
WP_038473642.1|1360635_1361130_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	56.8	3.9e-40
WP_038473645.1|1361131_1361554_-	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	46.4	1.2e-26
WP_038473648.1|1361569_1362535_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	61.4	9.2e-110
WP_012231838.1|1362547_1362889_-	DUF2190 family protein	NA	A0A219VH82	Ochrobactrum_phage	47.3	3.3e-14
WP_038473607.1|1362885_1363935_-	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	43.3	6.8e-66
>prophage 8
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1449871	1520474	2609404	transposase,tail,plate,tRNA	Ochrobactrum_phage(78.95%)	64	NA	NA
WP_012231901.1|1449871_1451665_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012231902.1|1451797_1452952_+	ribonuclease D	NA	NA	NA	NA	NA
WP_012231903.1|1453434_1454952_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_012231904.1|1454958_1457139_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_012231905.1|1457463_1457712_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_012231906.1|1457758_1459006_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_038473666.1|1459183_1462672_-	DNA polymerase III subunit alpha	NA	A0A1C9LWI9	Streptomyces_phage	36.1	5.6e-181
WP_012231908.1|1463043_1465152_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012231909.1|1465553_1467377_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.6	6.9e-106
WP_012231910.1|1467549_1468914_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.3	5.2e-26
WP_012231911.1|1468928_1469714_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_049776891.1|1469763_1470726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231913.1|1470787_1471111_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.7e-20
WP_012231914.1|1471237_1472440_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_012231915.1|1472470_1474228_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012231916.1|1474378_1476907_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012231917.1|1477101_1477389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231918.1|1477675_1478785_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_012231919.1|1478894_1479881_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_012231920.1|1480017_1481334_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_012231921.1|1483513_1484728_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_012231790.1|1485674_1486496_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_012231791.1|1486638_1487622_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.8	5.4e-89
WP_038473674.1|1487621_1487876_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	1.4e-12
WP_012231793.1|1487872_1488343_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038473677.1|1488499_1490836_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	50.1	1.2e-115
WP_038473680.1|1490967_1491381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231796.1|1491390_1491909_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	65.3	2.9e-62
WP_038474594.1|1491905_1493195_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	61.7	3.0e-148
WP_012231798.1|1493340_1493553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473682.1|1493562_1494879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473595.1|1494893_1498037_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	31.9	2.7e-150
WP_038473599.1|1498038_1499145_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	35.3	6.8e-16
WP_012231802.1|1499144_1500011_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	1.9e-45
WP_012231803.1|1499997_1500384_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	53.4	4.2e-29
WP_012231804.1|1500387_1500588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231805.1|1500600_1501194_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_038473602.1|1501190_1501712_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	50.6	7.6e-42
WP_038473685.1|1501708_1502203_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	56.1	5.1e-40
WP_038473688.1|1502204_1502627_-	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	47.1	1.6e-26
WP_038473691.1|1502642_1503608_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	60.7	3.5e-109
WP_012231810.1|1503620_1503962_-	DUF2190 family protein	NA	A0A219VH82	Ochrobactrum_phage	46.4	4.4e-14
WP_038473693.1|1503958_1505008_-	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	43.3	1.2e-65
WP_038473696.1|1505619_1506825_-	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	53.2	9.4e-128
WP_012231813.1|1506817_1508395_-	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	56.5	7.3e-173
WP_038473610.1|1508407_1510030_-	phage protein	NA	A0A219VH72	Ochrobactrum_phage	65.2	6.8e-182
WP_012231815.1|1510022_1510604_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	47.5	9.0e-36
WP_012231816.1|1510566_1510923_-	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	46.9	1.5e-17
WP_012231817.1|1510919_1511234_-	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	39.4	3.4e-13
WP_038473613.1|1511243_1511468_-	hypothetical protein	NA	A0A219VHE3	Ochrobactrum_phage	52.3	2.1e-09
WP_012231818.1|1511433_1511775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231819.1|1511767_1512055_-	hypothetical protein	NA	A0A219VHD7	Ochrobactrum_phage	57.6	2.8e-14
WP_012231820.1|1512051_1512633_-	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	51.8	1.1e-44
WP_012231821.1|1512719_1513127_-	helix-turn-helix domain-containing protein	NA	A0A219VHE2	Ochrobactrum_phage	48.8	2.4e-27
WP_038473614.1|1513133_1513751_-	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	44.7	7.6e-41
WP_012231823.1|1513761_1514385_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	63.2	7.1e-71
WP_012231825.1|1514647_1514917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473618.1|1514913_1515945_-	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	53.1	1.5e-89
WP_038473623.1|1516302_1518273_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A219VHD4	Ochrobactrum_phage	60.5	1.9e-162
WP_038473698.1|1518269_1518728_-	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	64.3	2.7e-43
WP_038473700.1|1518724_1519585_-	ParB/RepB/Spo0J family partition protein	NA	A0A219VHB6	Ochrobactrum_phage	51.4	3.0e-72
WP_038473703.1|1519584_1519983_-	hypothetical protein	NA	A0A219VHC3	Ochrobactrum_phage	59.1	1.5e-29
WP_169309789.1|1519966_1520104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473706.1|1520180_1520474_-	helix-turn-helix domain-containing protein	NA	A0A219VHB8	Ochrobactrum_phage	65.3	2.3e-19
>prophage 9
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1527907	1536353	2609404		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_012231932.1|1527907_1528420_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.9	1.7e-46
WP_012231933.1|1528438_1529041_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	53.0	2.5e-44
WP_012231934.1|1529043_1529550_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.2	1.0e-22
WP_038473713.1|1529574_1532358_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.3	1.7e-103
WP_012231936.1|1532598_1533105_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.4	1.9e-45
WP_012231937.1|1533437_1536353_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.8	0.0e+00
>prophage 10
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	1930765	1971991	2609404	transposase,tail,plate	Ochrobactrum_phage(82.05%)	51	NA	NA
WP_012232186.1|1930765_1931722_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.8	1.9e-62
WP_012232187.1|1931714_1932665_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012232188.1|1932661_1933420_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.1	3.6e-16
WP_012231790.1|1933784_1934606_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_012231791.1|1934748_1935732_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.8	5.4e-89
WP_038473674.1|1935731_1935986_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	1.4e-12
WP_012231793.1|1935982_1936453_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012231794.1|1936609_1938946_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	49.2	2.0e-113
WP_012231795.1|1939077_1939491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473858.1|1939500_1940019_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	64.1	5.0e-62
WP_038474660.1|1940015_1941305_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	61.0	9.6e-147
WP_012231798.1|1941450_1941663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473862.1|1941672_1942989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231800.1|1943003_1946147_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	32.0	5.4e-151
WP_038473599.1|1946148_1947255_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	35.3	6.8e-16
WP_012231802.1|1947254_1948121_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	1.9e-45
WP_012231803.1|1948107_1948494_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	53.4	4.2e-29
WP_012231804.1|1948497_1948698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231805.1|1948710_1949304_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_038473602.1|1949300_1949822_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	50.6	7.6e-42
WP_038473642.1|1949818_1950313_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	56.8	3.9e-40
WP_038473645.1|1950314_1950737_-	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	46.4	1.2e-26
WP_038473691.1|1950752_1951718_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	60.7	3.5e-109
WP_012231810.1|1951730_1952072_-	DUF2190 family protein	NA	A0A219VH82	Ochrobactrum_phage	46.4	4.4e-14
WP_038473866.1|1952068_1953118_-	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	43.3	1.2e-65
WP_038473696.1|1953729_1954935_-	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	53.2	9.4e-128
WP_012231813.1|1954927_1956505_-	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	56.5	7.3e-173
WP_038473869.1|1956517_1958140_-	phage protein	NA	A0A219VH72	Ochrobactrum_phage	65.2	6.8e-182
WP_012231815.1|1958132_1958714_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	47.5	9.0e-36
WP_012232190.1|1958676_1959033_-	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	48.0	1.5e-17
WP_012232191.1|1959029_1959344_-	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	40.4	1.2e-13
WP_038473872.1|1959327_1959579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232192.1|1959544_1959886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232193.1|1959878_1960166_-	hypothetical protein	NA	A0A219VHD7	Ochrobactrum_phage	56.1	6.2e-14
WP_012232194.1|1960162_1960744_-	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	51.3	1.8e-44
WP_012232195.1|1960830_1961238_-	helix-turn-helix domain-containing protein	NA	A0A219VHE2	Ochrobactrum_phage	48.8	4.1e-27
WP_012232196.1|1961244_1961862_-	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	43.1	2.5e-36
WP_038473875.1|1961884_1962508_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	61.7	6.0e-70
WP_171815229.1|1962491_1962773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231825.1|1962769_1963039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231826.1|1963035_1964067_-	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	53.1	1.9e-89
WP_038473878.1|1964424_1966404_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A219VHD4	Ochrobactrum_phage	60.5	1.9e-162
WP_012232200.1|1966400_1966859_-	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	64.3	6.0e-43
WP_038473882.1|1966855_1967716_-	ParB/RepB/Spo0J family partition protein	NA	A0A219VHB6	Ochrobactrum_phage	51.2	2.6e-71
WP_038473885.1|1967715_1968114_-	hypothetical protein	NA	A0A219VHC3	Ochrobactrum_phage	59.1	1.1e-29
WP_169309790.1|1968097_1968235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005864619.1|1968308_1968614_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	43.8	2.7e-07
WP_038473888.1|1968766_1969297_+	helix-turn-helix transcriptional regulator	NA	A0A219VHC1	Ochrobactrum_phage	39.5	2.1e-23
WP_012231790.1|1969789_1970611_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_038474666.1|1970753_1971737_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	53.1	1.1e-89
WP_012232099.1|1971736_1971991_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	8.0e-13
>prophage 11
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	2239977	2257742	2609404	tail,portal,capsid,terminase	Brucella_phage(20.0%)	18	NA	NA
WP_012232354.1|2239977_2241108_-|tail	tail fiber protein	tail	B2ZY49	Ralstonia_phage	39.7	2.6e-18
WP_012232355.1|2241115_2242129_-|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	45.5	5.3e-15
WP_012232356.1|2242137_2243139_-|tail	tail fiber protein	tail	F6LQE6	Bdellovibrio_phage	34.5	6.6e-18
WP_012232357.1|2243151_2243805_-	transglycosylase SLT domain-containing protein	NA	L7TQZ1	Rhizobium_phage	49.4	1.3e-30
WP_012232358.1|2243842_2246032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232359.1|2246045_2247341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232360.1|2247375_2248227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232361.1|2248228_2248654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232362.1|2248653_2250111_-	hypothetical protein	NA	A0A1B1IQM4	uncultured_Mediterranean_phage	27.0	6.0e-36
WP_012232363.1|2250112_2250820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232364.1|2250885_2251194_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.3	2.1e-15
WP_012232365.1|2251174_2251459_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	49.4	2.6e-12
WP_012232366.1|2251494_2251875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232367.1|2251885_2252266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232368.1|2252288_2253416_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	32.4	3.9e-43
WP_012232369.1|2253509_2254397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232370.1|2254410_2256429_-|portal	phage portal protein	portal	H2DE37	Erwinia_phage	24.0	6.3e-36
WP_012231638.1|2256413_2257742_-|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	57.8	1.7e-146
>prophage 12
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	2264381	2272027	2609404	integrase	Acidithiobacillus_phage(16.67%)	11	2266429:2266444	2272305:2272320
WP_012232380.1|2264381_2264849_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	60.7	2.0e-46
WP_012232381.1|2264924_2265635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012232383.1|2266215_2266497_-	hypothetical protein	NA	NA	NA	NA	NA
2266429:2266444	attL	ATCTCTTTGCACTATA	NA	NA	NA	NA
WP_012232384.1|2266617_2266947_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012232385.1|2267209_2267629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012232386.1|2267677_2268424_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	42.4	9.2e-49
WP_122364100.1|2268439_2268907_+	hypothetical protein	NA	A0A0A7NP48	Lactobacillus_phage	58.2	9.5e-12
WP_012232388.1|2269046_2269868_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	41.5	6.5e-40
WP_012232389.1|2269869_2270493_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.9	7.2e-47
WP_012232390.1|2270574_2270850_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012232391.1|2270854_2272027_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	41.0	3.6e-76
2272305:2272320	attR	ATCTCTTTGCACTATA	NA	NA	NA	NA
>prophage 13
NZ_HG969192	Bartonella tribocorum strain BM1374166	2609404	2462884	2557387	2609404	tail,protease,plate,tRNA,transposase	Ochrobactrum_phage(67.5%)	89	NA	NA
WP_012232545.1|2462884_2463583_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_012232546.1|2463884_2464430_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_012232547.1|2464561_2465383_+	SapC family protein	NA	NA	NA	NA	NA
WP_012232548.1|2465386_2466355_+	tyrosine recombinase XerC	NA	A0A0F6SJK8	Mycobacterium_phage	28.1	2.3e-15
WP_012232549.1|2466916_2467189_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012232550.1|2467313_2467934_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_012232551.1|2468139_2469120_+	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	34.0	1.5e-38
WP_012232552.1|2469135_2471046_+	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	30.1	1.3e-14
WP_012232553.1|2472160_2472844_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	35.9	1.8e-22
WP_012232554.1|2472991_2473309_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_012232555.1|2473588_2474386_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_012232556.1|2475532_2477152_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	1.8e-65
WP_012232557.1|2477501_2477654_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_012232558.1|2479141_2479339_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_012232559.1|2479716_2481462_-	heparinase II/III family protein	NA	NA	NA	NA	NA
WP_012232560.1|2481526_2482891_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_012232561.1|2482950_2484000_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_012232562.1|2484083_2484299_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_012232563.1|2484447_2484822_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_038474769.1|2484838_2485168_-	chorismate mutase	NA	NA	NA	NA	NA
WP_012232565.1|2485192_2486755_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_012232566.1|2487006_2487663_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_012232567.1|2487946_2492662_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_171815244.1|2494933_2495989_-	DUF2125 domain-containing protein	NA	NA	NA	NA	NA
WP_012232569.1|2496856_2497603_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_012232570.1|2497762_2499325_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012232571.1|2499336_2500521_-	membrane protein	NA	NA	NA	NA	NA
WP_012232572.1|2500897_2501992_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	45.9	7.8e-73
WP_012232573.1|2502670_2503099_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_012232574.1|2503995_2504676_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012232575.1|2505953_2506724_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038474775.1|2506949_2509361_-	TIGR02302 family protein	NA	NA	NA	NA	NA
WP_012232577.1|2509477_2510752_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012232578.1|2510761_2510944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232579.1|2510995_2512396_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_012232580.1|2512429_2513128_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_038474778.1|2513129_2513606_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_012232582.1|2513641_2514493_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_012232583.1|2515652_2516591_-	prephenate/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_158305319.1|2517116_2517260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012232584.1|2517551_2518592_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_012232585.1|2518596_2519391_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	20.6	5.1e-05
WP_012232586.1|2519383_2520280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012232587.1|2520342_2521320_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012231790.1|2521823_2522645_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	59.3	1.5e-81
WP_012231791.1|2522787_2523771_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.8	5.4e-89
WP_012231792.1|2523770_2524025_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	48.8	1.8e-12
WP_012231793.1|2524021_2524492_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038474374.1|2524648_2526985_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	49.2	2.0e-113
WP_012231795.1|2527116_2527530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231796.1|2527539_2528058_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	65.3	2.9e-62
WP_038474660.1|2528054_2529344_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	61.0	9.6e-147
WP_012231798.1|2529489_2529702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231799.1|2529711_2531028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473595.1|2531042_2534186_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	31.9	2.7e-150
WP_038473599.1|2534187_2535294_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	35.3	6.8e-16
WP_012231802.1|2535293_2536160_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	1.9e-45
WP_012231803.1|2536146_2536533_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	53.4	4.2e-29
WP_012231804.1|2536536_2536737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231805.1|2536749_2537343_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_038473602.1|2537339_2537861_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	50.6	7.6e-42
WP_038474377.1|2537857_2538352_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	56.8	3.0e-40
WP_038473645.1|2538353_2538776_-	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	46.4	1.2e-26
WP_038473691.1|2538791_2539757_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	60.7	3.5e-109
WP_012231810.1|2539769_2540111_-	DUF2190 family protein	NA	A0A219VH82	Ochrobactrum_phage	46.4	4.4e-14
WP_038473866.1|2540107_2541157_-	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	43.3	1.2e-65
WP_012231812.1|2541768_2542974_-	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	53.4	8.5e-129
WP_012231813.1|2542966_2544544_-	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	56.5	7.3e-173
WP_012231814.1|2544556_2546179_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	65.4	1.8e-182
WP_012231815.1|2546171_2546753_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	47.5	9.0e-36
WP_012232190.1|2546715_2547072_-	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	48.0	1.5e-17
WP_012232191.1|2547068_2547383_-	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	40.4	1.2e-13
WP_038473872.1|2547366_2547618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232192.1|2547583_2547925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232193.1|2547917_2548205_-	hypothetical protein	NA	A0A219VHD7	Ochrobactrum_phage	56.1	6.2e-14
WP_012232194.1|2548201_2548783_-	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	51.3	1.8e-44
WP_012232195.1|2548869_2549277_-	helix-turn-helix domain-containing protein	NA	A0A219VHE2	Ochrobactrum_phage	48.8	4.1e-27
WP_012232196.1|2549283_2549901_-	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	43.1	2.5e-36
WP_038473875.1|2549923_2550547_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	61.7	6.0e-70
WP_171815229.1|2550530_2550812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012231825.1|2550808_2551078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038473618.1|2551074_2552106_-	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	53.1	1.5e-89
WP_012232199.1|2552463_2554443_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A219VHD4	Ochrobactrum_phage	59.9	1.1e-160
WP_012232200.1|2554439_2554898_-	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	64.3	6.0e-43
WP_012232588.1|2554894_2555803_-	ParB/RepB/Spo0J family partition protein	NA	A0A219VHB6	Ochrobactrum_phage	49.2	6.1e-71
WP_038474380.1|2555802_2556201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815235.1|2556184_2556325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005864619.1|2556398_2556704_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	43.8	2.7e-07
WP_038474383.1|2556856_2557387_+	helix-turn-helix domain-containing protein	NA	R9U2Q5	Rhizobium_phage	48.4	5.9e-10
