The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007629	Brucella canis strain SVA13 chromosome 1, complete sequence	2106955	463270	528551	2106955	protease,transposase	Tupanvirus(16.67%)	56	NA	NA
WP_004691967.1|463270_464683_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002963624.1|464824_465451_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_004690614.1|465851_466739_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_004691966.1|466876_468535_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	36.3	3.2e-09
WP_004683128.1|468762_469710_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_004683131.1|469709_469895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004690616.1|469914_470520_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_002963630.1|470728_471607_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_004688061.1|471720_472104_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_004690618.1|472958_473999_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004690619.1|474004_474985_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002963635.1|474981_475446_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.6	1.7e-40
WP_002963636.1|475475_475961_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	46.8	3.0e-24
WP_004690620.1|476140_476941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683145.1|477075_477678_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_004690621.1|477775_480670_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002963640.1|480666_481287_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004690622.1|481457_482750_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	28.1	1.1e-33
WP_004690623.1|482803_484195_-	threonine synthase	NA	NA	NA	NA	NA
WP_004690624.1|484274_484526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004690625.1|484676_485255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004691963.1|485568_487203_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004690627.1|487331_487517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004688072.1|487558_488245_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004688073.1|488392_490183_-	chloride channel protein	NA	NA	NA	NA	NA
WP_004689516.1|490519_491653_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	30.4	4.7e-28
WP_002963651.1|491735_492353_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006133229.1|492349_493426_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002971552.1|493391_493538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004689517.1|493699_494227_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002971551.1|494464_495118_+	DsbA family protein	NA	NA	NA	NA	NA
WP_004690629.1|495196_498655_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_006133230.1|498677_499571_+	cation transporter	NA	NA	NA	NA	NA
WP_002967466.1|499680_500022_-	glyoxalase	NA	NA	NA	NA	NA
WP_004691957.1|500285_502949_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.6	7.0e-91
WP_004690635.1|504980_505769_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_005969743.1|505769_506675_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002967469.1|506875_507475_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_004688080.1|507628_508138_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_004690637.1|508149_508506_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_004690638.1|508576_509413_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	45.2	2.5e-39
WP_012219621.1|509901_511587_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.0	7.2e-17
WP_129171622.1|512335_512608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004691954.1|513112_513931_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_077281772.1|514542_514893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002963675.1|516327_517107_-	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_004691951.1|517133_517988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963677.1|517984_518743_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004683211.1|518739_519522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004690643.1|519536_520640_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	2.0e-44
WP_024767981.1|520647_521739_-	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	68.9	4.5e-137
WP_029097245.1|522861_523800_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_002963682.1|524999_526118_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077281774.1|526874_527027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006072314.1|527069_527624_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098944111.1|527788_528551_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	8.0e-24
>prophage 3
NZ_CP007629	Brucella canis strain SVA13 chromosome 1, complete sequence	2106955	853636	865563	2106955	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_002968731.1|853636_854488_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_004690782.1|854480_855206_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.1e-43
WP_002964012.1|855351_855570_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_004686803.1|855680_856262_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_004690783.1|856258_857083_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	40.7	1.7e-43
WP_004690784.1|857159_858443_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	3.5e-104
WP_004683703.1|858591_859359_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|859355_860024_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|860168_860354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004690785.1|860402_861701_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_004691896.1|861749_862616_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|862775_863117_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_012219638.1|863235_865563_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.1	4.0e-50
>prophage 4
NZ_CP007629	Brucella canis strain SVA13 chromosome 1, complete sequence	2106955	937255	947290	2106955	transposase,integrase	Brucella_phage(37.5%)	15	937138:937178	952253:952293
937138:937178	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_002966804.1|937255_938281_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	38.2	4.3e-49
WP_004690812.1|938267_938471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971459.1|938473_938689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|938685_938889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006072696.1|938938_939658_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.6e-05
WP_002964091.1|939654_939885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|939881_940157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683738.1|940179_940767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|941001_941712_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002964095.1|942059_942230_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_002964097.1|942577_942892_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	43.4	6.9e-06
WP_004688321.1|942891_943137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080723468.1|943977_944734_+|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_006132649.1|944735_945509_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.3	2.9e-122
WP_004689673.1|945643_947290_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	62.0	1.3e-175
952253:952293	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
