The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	581378	587219	5241638		Enterobacteria_phage(100.0%)	8	NA	NA
WP_032436598.1|581378_581945_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	2.5e-59
WP_004185270.1|581962_582208_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_032436600.1|582204_582942_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.9	5.8e-72
WP_032436602.1|583512_583779_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_077254644.1|583775_584333_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	4.0e-33
WP_032436604.1|584329_584557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032436606.1|584553_584874_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032436608.1|584885_587219_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.2	0.0e+00
>prophage 2
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	1705023	1783035	5241638	head,portal,plate,tail,capsid,integrase,protease,tRNA,holin,terminase	Cronobacter_phage(50.0%)	80	1697197:1697214	1728707:1728724
1697197:1697214	attL	TCCATCGGCGGAATGCTG	NA	NA	NA	NA
WP_187095030.1|1705023_1706004_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.7	2.9e-95
WP_004178082.1|1706488_1707976_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178082.1|1708397_1709885_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032428730.1|1709973_1710345_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	8.0e-30
WP_042920085.1|1710322_1711396_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	40.2	2.8e-67
WP_032411930.1|1711422_1712502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042920088.1|1712528_1713140_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	35.2	6.6e-29
WP_032411932.1|1713273_1713495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042920091.1|1713527_1714031_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	71.3	6.6e-59
WP_071889490.1|1714040_1714235_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_042920094.1|1714224_1714653_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	51.6	6.2e-26
WP_042920098.1|1714652_1715054_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	5.1e-38
WP_042920101.1|1715120_1715354_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_077254988.1|1715388_1717455_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	57.4	1.9e-200
WP_038431884.1|1717759_1718083_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	90.4	4.4e-48
WP_042920105.1|1718079_1719129_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.6	9.9e-158
WP_042920108.1|1719125_1720904_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	85.1	4.7e-293
WP_042920110.1|1721076_1721871_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	53.0	2.8e-64
WP_042920113.1|1721933_1722956_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.1e-158
WP_042920116.1|1722959_1723661_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	63.4	7.0e-83
WP_042920119.1|1723757_1724210_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	78.0	1.8e-60
WP_042920123.1|1724206_1724710_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	66.5	3.2e-61
WP_042920125.1|1724709_1725426_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	73.5	5.8e-93
WP_042920128.1|1725412_1726531_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	71.2	2.6e-148
WP_038431874.1|1726527_1726986_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	73.3	1.5e-57
WP_042920132.1|1726995_1727286_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	50.6	8.8e-16
WP_042920134.1|1727282_1727624_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	95.0	5.3e-52
WP_042920137.1|1727623_1727956_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	3.3e-35
WP_042920140.1|1728102_1728366_+|tail	putative phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_042920143.1|1728553_1730437_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	60.9	8.9e-226
1728707:1728724	attR	TCCATCGGCGGAATGCTG	NA	NA	NA	NA
WP_042920146.1|1730433_1730763_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	70.6	7.1e-38
WP_042920149.1|1730759_1731944_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	76.0	1.6e-172
WP_042920150.1|1731936_1732575_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	71.5	1.3e-72
WP_042921384.1|1733625_1735122_+	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	34.5	8.0e-60
WP_187095025.1|1735123_1735291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042920152.1|1735339_1736062_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	46.5	5.9e-53
WP_042920154.1|1736033_1736591_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	64.5	1.7e-55
WP_042920156.1|1736587_1738267_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	64.1	1.1e-185
WP_042921386.1|1738854_1739016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147745.1|1739332_1741018_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_002896351.1|1741284_1741668_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_002896352.1|1741674_1741938_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_023279664.1|1742140_1742428_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004179133.1|1742411_1743134_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896363.1|1743248_1744151_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|1744239_1744719_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|1745066_1746179_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|1746342_1747476_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|1747486_1748440_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|1748436_1749282_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|1749339_1749828_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|1749869_1750997_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_004183506.1|1751075_1751792_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|1751788_1753261_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|1753347_1754079_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023279662.1|1754262_1754931_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_032442301.1|1754930_1755647_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|1755653_1756385_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896392.1|1756405_1757134_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|1757360_1757876_-	lipoprotein	NA	NA	NA	NA	NA
WP_023328696.1|1758753_1759893_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_016947000.1|1759924_1760755_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|1760751_1761765_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896401.1|1761852_1763295_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004176702.1|1763305_1764307_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_023286191.1|1764345_1766064_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_012068500.1|1766215_1766650_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016529505.1|1766861_1767830_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_004176696.1|1767840_1769493_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147773.1|1769636_1770536_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896434.1|1770651_1771347_-	aquaporin Z	NA	NA	NA	NA	NA
WP_004176693.1|1771766_1773425_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896440.1|1773571_1774687_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1774683_1776624_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1776700_1776922_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1777247_1777565_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1777595_1779875_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1779995_1780214_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1780567_1781269_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_023279659.1|1781313_1783035_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	2020410	2064666	5241638	head,portal,tail,capsid,integrase,protease,tRNA,holin,terminase	Salmonella_phage(14.63%)	57	2013840:2013856	2045799:2045815
2013840:2013856	attL	CGGCGTAGCGCTGGCTG	NA	NA	NA	NA
WP_004150803.1|2020410_2021517_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2021573_2022032_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032411259.1|2022048_2022699_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2022939_2024190_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_008806033.1|2024302_2025445_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_008806034.1|2025434_2025671_-	excisionase	NA	NA	NA	NA	NA
WP_008806035.1|2026077_2026347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032701050.1|2026343_2026808_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.1	1.0e-10
WP_008806037.1|2026935_2027721_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
WP_032701051.1|2027713_2027914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049866772.1|2027913_2028393_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.2	3.6e-54
WP_008806039.1|2028584_2029415_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	81.0	1.0e-125
WP_023322336.1|2029467_2029839_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	78.7	1.0e-48
WP_042920217.1|2031057_2031702_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.2	2.2e-38
WP_042920219.1|2031796_2032006_+	cell division protein	NA	NA	NA	NA	NA
WP_094285075.1|2032248_2032719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038808209.1|2032798_2033347_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.5	2.7e-66
WP_023322342.1|2033519_2033699_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_038808207.1|2033688_2034600_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	78.4	7.0e-51
WP_042920228.1|2034596_2035052_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064735406.1|2035039_2036422_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.8	5.2e-106
WP_038808201.1|2038394_2038871_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	60.3	6.1e-14
WP_038808200.1|2038867_2039266_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.6e-44
WP_049866773.1|2039355_2040177_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	66.2	8.1e-91
WP_077255000.1|2040258_2041245_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	49.2	4.0e-92
WP_042920231.1|2041263_2042094_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.5	1.4e-58
WP_020805698.1|2042303_2042495_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
WP_042920236.1|2042644_2043694_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.4	2.0e-166
WP_042920238.1|2044388_2044778_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	79.1	4.5e-47
WP_015874667.1|2044767_2045046_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	1.8e-34
WP_042920239.1|2045045_2045672_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.8	9.9e-89
WP_012967894.1|2045679_2045856_+	hypothetical protein	NA	NA	NA	NA	NA
2045799:2045815	attR	CGGCGTAGCGCTGGCTG	NA	NA	NA	NA
WP_012967895.1|2045877_2046060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042920244.1|2046145_2046439_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	1.2e-31
WP_141828104.1|2046847_2046967_-	small membrane protein	NA	NA	NA	NA	NA
WP_042921403.1|2047518_2047878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184480.1|2049150_2049396_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	1.6e-34
WP_162823012.1|2049848_2050205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040241924.1|2050136_2050478_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	5.4e-49
WP_042920256.1|2050661_2051126_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	2.4e-47
WP_025713389.1|2051079_2052816_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
WP_032423087.1|2052822_2054142_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
WP_025713387.1|2054117_2054825_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
WP_042920261.1|2054834_2056055_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	3.7e-140
WP_038808150.1|2056100_2056355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|2056360_2056693_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_042920264.1|2056705_2057044_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	2.1e-37
WP_025713382.1|2057040_2057490_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	1.3e-63
WP_042920267.1|2057486_2057834_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.4e-31
WP_004177142.1|2057889_2058594_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_042920269.1|2058624_2059029_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	5.0e-33
WP_021313621.1|2059031_2059337_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	5.6e-29
WP_071889494.1|2059391_2059676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042920273.1|2059736_2063315_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	63.7	9.5e-253
WP_004177132.1|2063336_2063810_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_023302606.1|2063796_2064273_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_042920277.1|2064285_2064666_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	82.5	2.9e-59
>prophage 4
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	2071611	2080291	5241638		Klebsiella_phage(28.57%)	8	NA	NA
WP_042920286.1|2071611_2073558_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.4	1.6e-52
WP_042920289.1|2073648_2074227_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.3	6.1e-93
WP_040206344.1|2074277_2074700_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004179627.1|2075249_2075669_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_042920291.1|2075670_2076936_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	2.5e-208
WP_042920294.1|2077020_2078379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042920298.1|2078557_2079235_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.1e-80
WP_071889495.1|2079481_2080291_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	82.9	1.8e-138
>prophage 5
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	2258280	2329112	5241638	head,portal,plate,tail,transposase,capsid,integrase,protease,holin,terminase	Klebsiella_phage(41.67%)	72	2254125:2254139	2262542:2262556
2254125:2254139	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_009310076.1|2258280_2259261_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_049866778.1|2259953_2260466_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032442238.1|2260698_2261880_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	6.2e-201
WP_009309074.1|2261860_2262052_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_032442237.1|2262173_2262692_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	1.4e-93
2262542:2262556	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_032439898.1|2262796_2263624_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
WP_009309071.1|2263620_2263815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439899.1|2263811_2264237_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
WP_004177208.1|2264233_2264452_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_029602968.1|2264423_2264678_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_023304721.1|2264670_2265036_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_032442236.1|2265036_2265261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304722.1|2265443_2265857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|2266020_2266680_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_049245616.1|2266835_2267069_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_071889496.1|2267787_2269446_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.6	0.0e+00
WP_071889497.1|2269447_2270410_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	98.8	2.4e-182
WP_032439905.1|2270406_2270883_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
WP_032439906.1|2270879_2271662_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.1	2.7e-112
WP_004184721.1|2271815_2272073_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_071889498.1|2271978_2272425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148673901.1|2273036_2273336_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	6.4e-46
WP_004206700.1|2273332_2273872_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_004190674.1|2273868_2274213_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2274209_2274485_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_123618920.1|2274796_2275009_+	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	71.4	7.8e-22
WP_032442233.1|2275443_2275689_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	3.5e-34
WP_032442232.1|2275744_2276086_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_004177162.1|2276268_2276733_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_032442231.1|2276686_2278429_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	7.4e-142
WP_029603007.1|2278428_2279736_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_032442230.1|2279748_2280597_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	7.8e-129
WP_032422768.1|2280606_2281824_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	4.8e-196
WP_032442228.1|2281866_2282100_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
WP_032442227.1|2282099_2282426_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	2.0e-40
WP_032442226.1|2282437_2282776_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	1.6e-40
WP_019705270.1|2282772_2283222_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|2283218_2283566_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|2283622_2284327_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_040200637.1|2284357_2284762_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	3.8e-33
WP_032415151.1|2284764_2285070_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	8.1e-28
WP_032415149.1|2285144_2285528_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_042920366.1|2285595_2289006_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.3	1.1e-194
WP_004177132.1|2289026_2289500_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|2289486_2289963_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|2289975_2290356_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_032442220.1|2295540_2296299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442218.1|2296368_2297778_-	hypothetical protein	NA	A0A1D8KTD3	Synechococcus_phage	27.6	9.3e-18
WP_032442217.1|2297787_2299932_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	67.5	7.2e-38
WP_032442216.1|2300023_2300572_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.1	1.2e-90
WP_025714816.1|2300649_2301072_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.1	9.5e-27
WP_032442215.1|2301618_2301900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2302122_2302371_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_004176434.1|2303216_2303708_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023287555.1|2303750_2305295_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_017880148.1|2305304_2306648_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|2306644_2307334_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032426289.1|2307330_2309031_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2309035_2309527_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_032442214.1|2309791_2312446_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	1.7e-97
WP_074185965.1|2312447_2314817_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	1.4e-18
WP_004214314.1|2314817_2315597_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_031591189.1|2315660_2316191_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004176425.1|2316259_2316787_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_029497430.1|2316854_2317385_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_032442212.1|2317372_2319814_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|2319834_2320092_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_019705248.1|2320088_2321228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591184.1|2321211_2324640_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032410973.1|2324636_2326229_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021469289.1|2326308_2328063_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004224389.1|2328026_2329112_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	2541444	2547874	5241638		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|2541444_2542065_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|2542057_2543323_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_032442188.1|2544498_2545260_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_023280043.1|2545280_2546141_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|2546438_2546699_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2546785_2547874_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 7
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	3181858	3266882	5241638	head,portal,tail,transposase,capsid,protease,tRNA,terminase,holin,plate	Klebsiella_phage(41.51%)	94	NA	NA
WP_002910404.1|3181858_3183115_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004145431.1|3183385_3183997_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_162921929.1|3183996_3184845_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3185028_3185976_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|3186100_3187780_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_042920667.1|3187780_3188827_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042920671.1|3189048_3189324_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3189596_3190181_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004148779.1|3190298_3191390_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_042920676.1|3191471_3191801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910453.1|3191884_3192799_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042920678.1|3192930_3194346_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|3194365_3194809_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004184604.1|3194811_3195348_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_162921928.1|3195328_3196345_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042920683.1|3196374_3198138_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029499423.1|3202917_3203175_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_071844754.1|3203200_3203608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889521.1|3204100_3204880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889501.1|3205011_3207039_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.3	4.5e-74
WP_042920694.1|3207041_3209669_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	7.8e-18
WP_042920697.1|3210127_3211825_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004175498.1|3211828_3212482_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_023287772.1|3212478_3213819_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|3214387_3214717_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001300563.1|3214892_3216005_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_002910652.1|3216180_3216720_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|3216745_3217444_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|3217634_3218117_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_040200683.1|3219060_3219612_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	99.5	3.7e-95
WP_042920282.1|3221778_3222594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042920284.1|3222657_3223257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042920286.1|3223498_3225445_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.4	1.6e-52
WP_042920704.1|3225519_3228597_-	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_032408661.1|3228593_3228974_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_004864228.1|3228986_3229463_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|3229449_3229923_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_032442222.1|3229943_3233333_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	58.0	1.3e-304
WP_016530182.1|3233393_3233627_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032442224.1|3233701_3234007_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
WP_032442225.1|3234009_3234414_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.4	3.2e-32
WP_023313062.1|3234444_3235149_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_016530186.1|3235205_3235553_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|3235549_3235999_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_042920709.1|3235991_3236333_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.2	7.9e-40
WP_032442227.1|3236344_3236671_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	2.0e-40
WP_032442228.1|3236670_3236904_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
WP_032422768.1|3236946_3238164_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	4.8e-196
WP_032442230.1|3238173_3239022_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	7.8e-129
WP_029603007.1|3239034_3240342_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_032442231.1|3240341_3242084_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	7.4e-142
WP_004177162.1|3242037_3242502_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_042920712.1|3242684_3243026_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	1.2e-48
WP_004177166.1|3243081_3243327_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_004177168.1|3243724_3243925_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_004177172.1|3244235_3244508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|3244640_3244925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409976.1|3245015_3245210_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	6.9e-25
WP_004177178.1|3245160_3245436_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.7	8.4e-08
WP_004177180.1|3245432_3245780_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	83.5	1.9e-41
WP_004177182.1|3245776_3246316_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_148673902.1|3246312_3246612_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	6.4e-46
WP_042920723.1|3247095_3248142_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.6	3.0e-05
WP_031280381.1|3248326_3248773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|3248678_3248936_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_042920726.1|3249089_3249872_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.7	6.1e-112
WP_031592532.1|3249868_3250237_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
WP_042920731.1|3250223_3251603_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.5	1.4e-159
WP_009309062.1|3251599_3252478_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.1e-85
WP_009309063.1|3252489_3253320_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	70.3	2.0e-84
WP_032409419.1|3253316_3253505_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_104471468.1|3253598_3253817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309064.1|3254178_3254895_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	71.3	1.2e-98
WP_032409574.1|3255064_3255271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309066.1|3255267_3255444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032730700.1|3255448_3255862_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	51.7	9.6e-08
WP_025714643.1|3255924_3256188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071889502.1|3256300_3256510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048264118.1|3256550_3256826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309070.1|3256829_3257087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177208.1|3257058_3257277_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_040186814.1|3257273_3257714_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_032422926.1|3257754_3258273_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_042920740.1|3258278_3259004_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	97.5	1.3e-129
WP_023317194.1|3258993_3259218_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_004152150.1|3259214_3259427_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_032451986.1|3259484_3259718_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	100.0	1.6e-39
WP_004145342.1|3259773_3261027_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	100.0	1.5e-245
WP_101974243.1|3260999_3261293_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074184415.1|3261267_3262077_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042920751.1|3262088_3263384_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	2.1e-61
WP_040224102.1|3263687_3264614_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|3264712_3265189_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|3265238_3266882_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
>prophage 8
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	3532020	3538929	5241638	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_019705218.1|3532020_3533499_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3533495_3534218_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3534536_3535898_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|3536140_3537037_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|3537281_3538055_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3538065_3538929_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 9
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	3884485	3993546	5241638	head,portal,tail,capsid,integrase,protease,tRNA,holin,terminase	Klebsiella_phage(18.64%)	111	3882712:3882730	3994516:3994534
3882712:3882730	attL	TCGAGCAGCGCCTGCGGCG	NA	NA	NA	NA
WP_002913894.1|3884485_3885652_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004144312.1|3886010_3886442_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
WP_023280408.1|3886602_3888927_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_023280409.1|3888927_3893877_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_002913950.1|3894082_3894940_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_023280410.1|3895166_3896009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913952.1|3896079_3896856_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_002913953.1|3896955_3898242_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|3898312_3898513_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|3898514_3898850_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004149343.1|3898851_3900702_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_002913974.1|3900717_3901233_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|3901307_3901631_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|3901648_3902035_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|3902061_3903276_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
WP_002913993.1|3903454_3903946_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_002913994.1|3904180_3904915_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002913995.1|3905035_3905839_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_004174831.1|3905885_3906722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174830.1|3906821_3907802_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_004151988.1|3907792_3908431_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_009485450.1|3908555_3909833_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_004144329.1|3909829_3910966_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004174827.1|3911048_3911882_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_042921020.1|3911881_3913318_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_042921022.1|3913387_3916663_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_004174823.1|3916775_3917972_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914024.1|3918044_3918467_+	DoxX family protein	NA	NA	NA	NA	NA
WP_002914027.1|3918522_3919776_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_004899880.1|3920101_3921292_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|3921366_3921705_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|3921770_3923108_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914033.1|3923094_3923781_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|3923810_3925232_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_032417412.1|3925822_3929710_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
WP_004144346.1|3929885_3931502_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004890375.1|3931498_3932041_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|3932070_3932706_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004144349.1|3932919_3933768_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042921025.1|3933979_3934306_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	3.3e-27
WP_042921027.1|3934654_3935206_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.2	1.9e-91
WP_148673900.1|3937575_3938187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042920284.1|3938250_3938850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042920286.1|3939090_3941037_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.4	1.6e-52
WP_042921032.1|3941110_3944188_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_032408661.1|3944184_3944565_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_004864228.1|3944577_3945054_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004884312.1|3945040_3945514_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_042921035.1|3945534_3949116_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	60.8	2.1e-252
WP_042921037.1|3949178_3949700_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	2.2e-09
WP_042921039.1|3949774_3950080_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	2.1e-28
WP_032415153.1|3950082_3950487_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	6.5e-33
WP_032415154.1|3950517_3951222_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_016530186.1|3951278_3951626_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|3951622_3952072_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_032415156.1|3952068_3952407_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_032415158.1|3952418_3952745_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	70.4	2.8e-42
WP_023317647.1|3952744_3952951_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.3e-10
WP_042921043.1|3952993_3954211_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.6	9.0e-195
WP_023317649.1|3954220_3955069_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.6	3.0e-136
WP_004177155.1|3955082_3956390_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	4.9e-215
WP_032422769.1|3956389_3958132_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.3e-141
WP_004177162.1|3958085_3958550_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_042921045.1|3958702_3959074_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.3e-47
WP_004177166.1|3959129_3959375_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_004177168.1|3959772_3959973_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_004177172.1|3960283_3960556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|3960688_3960973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071889508.1|3961063_3961258_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	79.7	1.2e-21
WP_042921047.1|3961208_3961484_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	1.2e-25
WP_042921050.1|3961486_3962116_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	4.2e-87
WP_071603196.1|3962115_3962397_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_042921052.1|3962383_3962770_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	89.8	1.0e-56
WP_004104264.1|3962979_3963384_-	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	9.4e-32
WP_004104266.1|3963373_3964018_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.3	2.4e-82
WP_049866809.1|3964014_3964659_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	43.2	1.7e-38
WP_042921057.1|3964628_3965600_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	61.2	8.7e-108
WP_029497188.1|3965596_3967126_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_042921059.1|3967118_3967394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042921061.1|3967869_3968340_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	1.7e-61
WP_071889509.1|3968365_3968563_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	53.3	3.1e-12
WP_042921063.1|3968658_3969312_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	59.9	1.7e-70
WP_042921064.1|3969673_3969949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104278.1|3970611_3970971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042921070.1|3971014_3971827_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_042921073.1|3971908_3972769_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	54.7	1.0e-72
WP_077254995.1|3973083_3973308_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	1.1e-13
WP_042921078.1|3973776_3974460_+	hypothetical protein	NA	Q6UAU0	Klebsiella_phage	90.7	1.4e-125
WP_042921079.1|3974456_3974717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042921080.1|3974718_3975276_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	63.6	4.7e-66
WP_071839937.1|3975295_3975496_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_042921081.1|3975492_3976890_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032426451.1|3977104_3977365_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	2.2e-18
WP_004144351.1|3977377_3977758_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004180923.1|3977757_3978489_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_002914062.1|3978500_3979238_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|3979249_3980155_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|3980151_3980832_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|3981081_3982056_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|3982071_3983871_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_004144354.1|3984056_3984536_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_002914070.1|3984532_3985489_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_002914072.1|3985488_3986139_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_002914074.1|3986171_3986747_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_121980491.1|3986743_3986839_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_032417414.1|3987167_3988787_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_032417415.1|3988771_3989509_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|3989640_3990972_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|3991017_3991401_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|3991713_3992403_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|3992460_3993546_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3994516:3994534	attR	CGCCGCAGGCGCTGCTCGA	NA	NA	NA	NA
>prophage 10
NZ_CP007731	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 chromosome, complete genome	5241638	4022075	4050917	5241638	tail,transposase,tRNA,holin,plate	Cronobacter_phage(73.33%)	32	NA	NA
WP_002914147.1|4022075_4022843_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4022874_4023423_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4023441_4023690_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4023949_4025314_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4025477_4026269_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4026288_4027575_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4027694_4028285_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4028409_4029288_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_042921091.1|4029374_4031036_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4031183_4031525_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|4031591_4031882_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029497287.1|4031871_4032348_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4032458_4032941_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_042921093.1|4033708_4034731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042921094.1|4035399_4037052_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	69.6	3.5e-194
WP_042921096.1|4037053_4037602_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	64.3	5.0e-52
WP_042921097.1|4037573_4038299_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	48.1	2.7e-53
WP_042921099.1|4038313_4038808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042921102.1|4038808_4040182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|4040323_4041349_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023279773.1|4041643_4042612_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_049866811.1|4042637_4043825_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	62.5	7.6e-98
WP_042921105.1|4043833_4044472_-	protein phage	NA	F1BUK5	Cronobacter_phage	72.6	1.6e-73
WP_042921107.1|4044464_4045649_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	76.5	3.8e-174
WP_042921110.1|4045645_4045975_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.1	1.6e-34
WP_042921111.1|4045971_4047945_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	57.3	3.1e-213
WP_042921114.1|4048135_4048399_-|tail	putative phage tail assembly chaperone	tail	A0A0U4B0P2	Pseudomonas_phage	36.5	1.0e-07
WP_042921116.1|4048545_4048890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042921117.1|4048889_4049231_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	3.3e-46
WP_042921119.1|4049217_4049517_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	51.1	4.4e-18
WP_042921121.1|4049526_4049982_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	67.3	9.2e-52
WP_077254996.1|4049978_4050917_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	71.4	4.7e-119
>prophage 1
NZ_CP007732	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence	268334	22947	62574	268334	transposase,integrase	Escherichia_phage(23.53%)	39	22932:22991	64114:65072
22932:22991	attL	AGAGTCTGATTCGAAATTATCCTGTGTAATTTGATAATCTTGCGATTCGTCTCGTGAAGA	NA	NA	NA	NA
WP_019706040.1|22947_23784_-|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000262467.1|24349_25144_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
WP_000349358.1|25170_25530_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
WP_019706001.1|25692_26640_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_016809943.1|26722_27871_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
WP_016809945.1|29387_30350_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_041445713.1|30961_31909_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	2.3e-41
WP_071843640.1|32630_32834_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001067855.1|32867_33572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|34144_34510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|34509_37746_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_017787123.1|37952_38969_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_041445714.1|38973_40473_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|40474_40891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020319858.1|41674_41812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|41820_42537_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|42538_42907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|43199_43433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|43543_43864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|43918_44098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|44983_45223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|45232_45637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|45694_46120_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000861760.1|46534_46975_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|46962_48228_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|48378_49170_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000057569.1|49184_49526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|50085_50805_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|52761_53331_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|53723_54737_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|54892_55366_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|55586_55853_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|55995_56760_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|57020_58235_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|58268_59672_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|60083_60290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|60294_60783_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|61032_61737_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001173919.1|61998_62574_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
64114:65072	attR	TCTTCACGAGACGAATCGCAAGATTATCAAATTACACAGGATAATTTCGAATCAGACTCTAAGAGAAGCCCGACGTGCAGAAAGGGCTGAACGACCAAGCAATGAGCCTCCCTCAGTGGATGAACTCCGTGAGCGCCAGCAACAAAACACAGAAAGAGAACCGGTGGTTGTCAGCTCATCAGCTCCGGCACCAAAGGTGCAAAAGGAAGAGCCAATCGAAGTACAGCCAGGCAAGCGCAAAATTATTTTGGATTAGTGGGGTCGGTTATGAGCAAAAAGCGCATCGTAATCAAAAATGGTGAGGTCTGCGGGTTTGCCGATGAGGTTTCCTTCAAAGGCCTTGAAGTGCAGGAATACAGTAAAACAAGGGTTTCGCGCATCGTGCCGACGAGCGGCATTCTAATGATTGCGTTCTATGTTATTCGCGGACTTTGTTCAGACGAGTCAAAGATTGCGGCATGGACTCGTGTTTGGCGTTGCCAGTGGAAGGTGCTGATCGACGGTAAAAGCTATGGCCCATTCAGCAGTCGTGCGGATGCTATCTCGTTCGAGAAGGACGAGATCTACAAACAAGGCAAATTCTTTGCCGATGCCACTCACGAGGCGGCAGTATGATGACACGGGCGGCTATGGCCGCTCTGTTATCCGCGTTGGTAATAGGCCTTGTGTCTGATTTGGCCGCACAAGAGCTGGTGGTAAGCCCGGTGGCTATAGACAAGTCCACTGAGGTGGAGAAAGAAGCTACCTTCCACAACCGCAAGTGGGTGTTAAGGACGGGGCAGGTTAGTGGATTCTTCATCTGCCAAGGAGATAACAAAGACATTTACTACCGGCATGACAGGGTGGGCGCTCACTGCCAGAAGACATCGACTGGGTGGCGCAATGTACTGGGTCTCAGGGACGATGTTCCGGAAGTTGAGCTGAGCGTGTACCTGGGGACCGTTGAAGGTGTCCCCGTG	NA	NA	NA	NA
>prophage 2
NZ_CP007732	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence	268334	66955	75691	268334	transposase	Acidithiobacillus_phage(33.33%)	11	NA	NA
WP_000268395.1|66955_67894_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_001096362.1|68328_68571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|68573_68936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|68928_69141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|69200_69956_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|69970_71512_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|71756_72791_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|72804_73254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|73235_73547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|73720_74506_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|74509_75691_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 3
NZ_CP007732	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence	268334	143931	231837	268334	transposase,integrase	Escherichia_phage(45.95%)	68	167194:167253	231920:232043
WP_011191341.1|143931_145206_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_000122923.1|145219_146947_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|146933_147212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|147284_147524_+	permease	NA	NA	NA	NA	NA
WP_000338626.1|147533_147650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|147770_148145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|148258_148984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138073.1|152100_155073_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|155075_155633_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|155938_156952_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|157097_157631_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000679427.1|157787_158135_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|158128_158968_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|159142_159907_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|160083_160788_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|161237_162713_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|162768_163653_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|163736_164441_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000946487.1|165392_166244_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_000376623.1|166371_166872_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
167194:167253	attL	ATGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCA	NA	NA	NA	NA
WP_001067855.1|167631_168336_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|169244_172142_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|172236_172842_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004152397.1|173155_174475_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|174724_175606_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|176130_176835_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_007897923.1|176958_178206_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040113334.1|178192_179959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|179946_182064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|182067_182496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314856.1|183821_184151_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023279877.1|184225_185350_-	alkene reductase	NA	NA	NA	NA	NA
WP_158002126.1|185610_186543_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384065.1|186625_187501_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023279882.1|187607_188459_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023279881.1|188534_189371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007897903.1|189665_190325_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022649401.1|191410_191737_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_022651297.1|192168_193302_+	glutathione-independent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
WP_012561117.1|194242_196894_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
WP_001189111.1|198868_200377_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_101743360.1|201079_202060_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_040113343.1|203359_204289_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_000654811.1|204492_205461_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_040113342.1|205622_206420_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
WP_077255001.1|206681_207650_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
WP_023205627.1|207748_209140_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040113331.1|209975_210998_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|211160_211865_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210516.1|212576_213197_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_011117368.1|213189_214455_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002210514.1|214466_215369_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210513.1|215629_216391_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_011117369.1|216411_217272_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|217569_217830_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|217916_219005_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001067855.1|219977_220682_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|220823_221837_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|221997_222552_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_002089484.1|222627_223092_+	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_000679427.1|223297_223645_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|223638_224478_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|224605_225106_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|225281_226067_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|226053_227577_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|227699_229244_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|229294_230155_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|230157_231837_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
231920:232043	attR	TGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGTTTGGTCACGGGCATCATC	NA	NA	NA	NA
>prophage 4
NZ_CP007732	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence	268334	241428	250910	268334	transposase,integrase	uncultured_Caudovirales_phage(33.33%)	9	240171:240186	253042:253057
240171:240186	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000543934.1|241428_242439_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_044489169.1|242443_243073_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	43.3	4.1e-18
WP_011787801.1|243524_245015_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|245049_245904_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|245994_246327_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787804.1|246444_247065_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|247234_247495_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|247494_247806_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|247829_250910_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
253042:253057	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP007733	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence	80411	19230	59550	80411	protease,transposase,integrase	Escherichia_phage(22.22%)	50	23391:23450	64467:65288
WP_001553819.1|19230_22128_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|22222_22828_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
23391:23450	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|23454_24159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040119756.1|24517_24697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119757.1|25304_26588_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	41.2	1.5e-62
WP_040119758.1|26651_26918_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206910.1|26962_27412_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_004187371.1|27533_27896_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_004206908.1|27917_28181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119759.1|28298_28709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187375.1|28737_29217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725064.1|29209_29455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119730.1|29833_30385_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.0	1.7e-20
WP_011154451.1|30394_30838_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_011091047.1|30840_31815_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
WP_004187383.1|32055_32796_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_040119731.1|32814_33063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119732.1|33059_33545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119733.1|33541_34129_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_040119734.1|34121_34370_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	56.9	1.2e-10
WP_040119735.1|34366_34828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302505.1|34963_35509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119736.1|35661_36069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302504.1|36070_36649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119737.1|36626_36983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045342057.1|37509_38784_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_040119738.1|38800_39484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091034.1|39528_39747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|39749_39959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049866823.1|40425_40665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187415.1|40809_41130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119740.1|41132_41981_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	6.6e-27
WP_040119741.1|42003_43269_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.8	4.4e-112
WP_049866821.1|43256_43691_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	2.1e-29
WP_020277900.1|43783_44149_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187429.1|44117_44375_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_040119742.1|44467_45121_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032451295.1|45200_45584_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004187436.1|45688_46084_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_040119761.1|46128_47391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206886.1|47401_48352_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004187443.1|48364_50452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381802.1|51131_51665_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000027057.1|52060_52921_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|53103_53661_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_071881521.1|53822_54128_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	97.9	7.3e-21
WP_001067855.1|54018_54723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|54859_55720_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|55740_56502_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_000608644.1|58287_59550_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
64467:65288	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAATGGAGCGACACCACGCCAGATCAGGCCGAAACGGCTATTTCCCGCGTTATCGACGGAAAAATCTGGGATCGGCTGATGACGGAAACCGGTATGTATACGCTGATGAGCAACAAGCAACGTCAGGAATGGGATCGGCAGGTGGCAGGCAAAGAAATGCCGCCGATAACGCTGGATAACGTTATGAGTACGTTCCGGCACCTGAACGCAAGCAAGGCTGATACCTTCACGCAAGGGCTGATTGATATCTTTAAATCCCTGTCGTGGGATTATAAAACCAATAACCCCTGCATGTTTGGCAAGCGTATCATCATCGCGCCGTTGCTCGATGTCTGGCGCAGTGGCTGGGTGCGCTTCAGCTCAGACGGGCACACCAAAATTGACGATCTGGCGCGGCCGTTCTACGTGCTGGACGGGCGTAACGTGCCTGATTACCGTGTTTCTGACGGTGCCAAACTGGATGCCTTTTTCAGTGAAAACCAGTTCAACGGTAAGGTGTTCGAGTGTGATTACTTCAGCGTGCGATATTACAAAAAGGGCAGCGCGCACATTACGTTTAAACGCCCGGATCTGGTTGAGAAGATCAATAATCTGGTTGCCAGTCACTATCCTGGGATGTTACCCCCTCGCGTGTAATGCAGACGGCAGGCCGCATTTGCGGCCTGAAATATAAACAGGGAAAGGAAGTATTCCCCGGCCTGAGAAAATCACGCCGGGCATGAATTTATTGCTTGATTAATATGGCTCGTTAGACGTATGATAAT	NA	NA	NA	NA
>prophage 1
NZ_CP007734	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence	338850	496	56013	338850	transposase,integrase	Macacine_betaherpesvirus(21.74%)	52	50614:50673	62424:63557
WP_004196353.1|496_1837_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032442619.1|1985_3059_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_162837909.1|3390_5673_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_009310020.1|5878_6919_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_086937184.1|7088_8464_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_042922165.1|8664_9039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|9094_9421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|9417_10146_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|10142_10574_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|10618_12676_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_015065513.1|13041_13584_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.5	1.6e-50
WP_042922168.1|14412_14979_-	methyltransferase	NA	M4M9L8	Vibrio_phage	39.2	2.6e-19
WP_042922171.1|15026_16382_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|16433_16664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|16755_16983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|17662_17983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|18017_18272_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|18459_18651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042015157.1|18693_19200_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.2	5.3e-08
WP_004152356.1|19242_19671_-	antirestriction protein	NA	NA	NA	NA	NA
WP_022631157.1|20351_21119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|21172_21592_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|21601_21823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|21822_22524_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|22960_23191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042015161.1|23253_23925_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_032425559.1|23927_24899_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_187095033.1|25147_26635_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	5.0e-30
WP_009309980.1|27037_27463_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|27462_28734_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|28812_29064_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|29117_29423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309982.1|30705_31677_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_042922183.1|31676_32843_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	8.8e-224
WP_000200070.1|33593_34604_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|35301_36042_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_023280912.1|36997_38074_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004118218.1|39534_39912_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_004114612.1|39908_40256_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_016808813.1|40305_41844_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.0	1.2e-273
WP_004187025.1|42015_42264_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_020804663.1|43352_44018_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000654811.1|44213_45182_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_023317262.1|45557_48041_+	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_009308594.1|48031_49027_+	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_002916122.1|49040_49676_+	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_025714822.1|49710_50427_-	EAL domain-containing protein	NA	NA	NA	NA	NA
50614:50673	attL	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCG	NA	NA	NA	NA
WP_009310076.1|50760_51741_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_000654811.1|53176_54145_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_014343462.1|54676_54790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310077.1|54918_55176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287113.1|55233_56013_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
62424:63557	attR	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCGGATCTGGGCCGATTTTTTTCCCGCAAACACATCGAATCAGCCTATTTAGGCTATTTTTTCCACCATTTCTGGCGTTATTTCCGGTTTTTACTGAGATCTCTCCCACTGACGTATCATTTGGTCCACCCGAAACAGGTTGGCCAGGGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAGCCCCCTGTATCTGGCTTTCACGAAGCCGAACTGCCGCTTGATGATGCGAAACGGGTGCTCCACCTTGGCACGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGCGGATGCTGCTTCAAGGTTTTTACCCTGCCGGGACGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCTCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGAAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTAGAGCTGGGTGCCTCAATGATGGTGGCATCCACCAAAGTGCCTTGGGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGACGGGCCAGTTGATGCTGCTCGAGCAGGTGGCGGAAATTCATGATGGTGGTGCGATCCGGCAGGGCGCTATCCAGGGATAATCGGGCAAACAGGCGCATGGAGGCGATTTCGTACAGGGCATCTTCCATGGCACCGTCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATACGCAGCATGGTCTCCAGCGGATAGGGCCGTCGGCCATTGCCCGCCTTGGGATAAAACGGCTCGATGACAGCGGTCATATTCTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCTGAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTC	NA	NA	NA	NA
>prophage 2
NZ_CP007734	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence	338850	62570	105233	338850	transposase	uncultured_Caudovirales_phage(36.84%)	45	NA	NA
WP_009310076.1|62570_63551_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_032425603.1|64774_65683_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|65868_66219_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_020803533.1|66366_66798_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|67048_68524_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|68516_69197_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|69386_70772_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|70800_71154_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|71267_72560_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|72570_75717_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_008322815.1|75803_76244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803531.1|76370_78818_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	5.8e-84
WP_000843497.1|78858_79056_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|79089_79827_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|80115_80565_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|80798_82616_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_020803534.1|82621_83512_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|83551_83932_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_020805562.1|83936_84866_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|84920_85601_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_002436614.1|85597_86998_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_004118347.1|87213_87648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118688.1|88026_88125_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|88111_88291_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_004118691.1|88604_88868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042922197.1|88864_89431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528789.1|89461_89956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150739.1|90016_90220_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|90268_90526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425571.1|90601_90856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804426.1|91031_91298_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004098919.1|91285_91768_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|91968_93372_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|93400_94033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065592.1|94209_95742_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_042922203.1|95831_97235_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_042922205.1|97267_97972_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	2.6e-85
WP_000941305.1|98058_98379_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|98424_99714_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|99726_100152_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|100211_101039_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|101057_102536_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_042922208.1|102911_104450_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_042922210.1|104499_104847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_131401800.1|104846_105233_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.8	1.3e-59
>prophage 3
NZ_CP007734	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence	338850	124310	193144	338850	protease,transposase,integrase	Stx2-converting_phage(21.43%)	55	115635:115649	160447:160461
115635:115649	attL	ATCGTCGAACTGGAC	NA	NA	NA	NA
WP_040209488.1|124310_125390_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.3	1.0e-40
WP_042922223.1|125389_126346_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042922225.1|126356_127580_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_042922227.1|127582_128041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026588.1|128520_129159_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|129183_129825_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_042922231.1|129825_130464_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|130556_131597_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_040209467.1|131596_133330_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004196935.1|133357_134857_+	kinase	NA	NA	NA	NA	NA
WP_042922379.1|135235_135718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|135993_136398_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|136945_137224_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004118064.1|137317_137530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922237.1|138503_138818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170918579.1|139060_139543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922381.1|141647_142304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026560.1|143139_144039_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_042922240.1|144359_145421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165813472.1|146276_147722_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.9	4.1e-29
WP_042922245.1|147807_148944_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071889527.1|149009_149297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196883.1|149349_149754_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_004196919.1|149750_150098_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_042922252.1|150146_151685_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.6e-294
WP_004197568.1|151939_152263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141769543.1|153824_154841_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_024196074.1|154839_155169_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917661.1|156076_157900_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_002917670.1|157912_158338_-	glycerol dehydratase small subunit DhaB3	NA	NA	NA	NA	NA
WP_002917672.1|158340_158925_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_002917676.1|158937_160605_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
160447:160461	attR	GTCCAGTTCGACGAT	NA	NA	NA	NA
WP_042922258.1|161018_161447_+	heme-binding protein	NA	NA	NA	NA	NA
WP_023336801.1|161468_162632_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
WP_042921244.1|162652_163006_+	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_004210508.1|163006_163537_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_042921246.1|163514_165440_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_042922263.1|165541_166639_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_032669186.1|169118_169802_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.1e-27
WP_032669185.1|169812_171501_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032669183.1|171484_172522_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_032669182.1|173618_174599_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_020077889.1|174963_176034_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372179.1|176044_176677_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_032669181.1|176687_178106_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_042922274.1|178180_179830_+	glycerone kinase	NA	NA	NA	NA	NA
WP_001067855.1|180394_181099_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152286.1|181662_182745_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_042922276.1|182866_185941_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_023280930.1|185992_187246_+	lactose permease	NA	NA	NA	NA	NA
WP_040215689.1|187716_189099_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_040210203.1|189229_190189_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_029497558.1|190185_190737_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_074185243.1|190855_191824_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_001101446.1|192118_193144_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007734	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence	338850	198302	251664	338850	protease,transposase,integrase	Stx2-converting_phage(20.0%)	47	191839:191898	232697:234088
191839:191898	attL	GATTTATTCATAGATGGTCGCCTCCTGTTTGCCAAGCTAAATATGTTGTGGTGGCTTTAC	NA	NA	NA	NA
WP_023205099.1|198302_198443_+|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_042922283.1|198530_198959_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_032427176.1|199011_199926_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_032732001.1|200028_200916_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_049866824.1|201005_201647_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_042922289.1|201695_202841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786814.1|202830_203271_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_040236986.1|203274_204990_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_042922294.1|204986_205484_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_042922295.1|206450_207602_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	37.1	1.2e-26
WP_042922297.1|208445_209441_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	4.1e-20
WP_001554382.1|209634_210063_+	GFA family protein	NA	NA	NA	NA	NA
WP_042922302.1|212427_213396_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	6.2e-13
WP_000333416.1|214055_214328_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_087785717.1|214734_215881_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.9e-146
WP_000005560.1|216940_218053_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|218049_218685_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_017145102.1|219232_219619_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	91.3	3.3e-58
WP_004114612.1|219615_219963_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_040190756.1|223786_225520_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|225527_226475_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|226519_228124_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|228136_229057_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|229056_229905_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|229901_230495_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_042922309.1|230491_231619_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|231903_232071_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_161989521.1|231999_232212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|232976_234002_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004118235.1|234547_235069_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
232697:234088	attR	GATTTATTCATAGATGGTCGCCTCCTGTTTGCCAAGCTAAATATGTTGTGGTGGCTTTACTGGTCATCGATTGCAGCCATAGATCCGGACTTTGCCGAGGTGATGTAAAATACCTCTGTCCCTGATGGAATACGCTGATGGAGGCCTCTATCAACAAAGCGCTCTTTCAGGAGCCTTGAATAAACCGGGTTTTCCCCATCGCGGTCTGACCTGTCTTGCCATCACTTCATGCTTGCCTGGGCAATCGGTGGTGTTGTTTCTGTCTTACTGATTAAGCAACTTAAGCGCTTATTATTGGTGCACAATACTCCCGCTCTTTGGCCAGGAGCGCCCACACAGTCCGCGCATTCTTGTTAGCCAATGCTACCGAGGCAATGTTGTTATTCCGGCGCGCCATTAGCTGGTTAGCCCAGCTCGATACGGCATCCTGTTTATGTTTGGCCGACTGCAATACCGCCCTGGCACCATGGATAAGCAAGGTCCTCAAATAGGTATCACCTCGCTTGCTTATCCCGAGCAGGACTTGTTTACCCCCACTGGAGTGCTGACGTGGAACCAATCCGAGCCAGGCAGCCAGTTGTCGGCCATTCTCGAAATTGTTGGCTTTACCAATGGTCGCAATCAGCGCGCTGGCGGTAACAGGGCCAATACCAGGGATCTTGCCGATACGCTGGCAGAGAGCATTTTGCCGATAGCACTGCTCAATCTGCTTGTCGAGTGTAGCGATGACATCGAACAGGTACGCCATGTGGTGCTGTAGTAGACTCAGCTGTGTACGAAACAGGACGGGTAACGGGTTATCCGCATCTTCCACGAGCTCAGGTAATCGTCGCTGTAGCTGCTGGATACCTCGGGGGACGACAATGCCAAATTCGGCCAATAACCCCCTGATTTGATTGGCTTGTGCGGTTCGCTGTTTGATGAAGCTCTGACGACTCCGGTGAAGTGCCAATACGGCTTGCTGCTCAGCGGTTTTGACCGGCACGAACCGCATGTTAGGTCGAGTGACGGCTTCACAAATAGCTTCAGCGTCTGCAGCATCATGCTTATTGGTTTTAACATAGGGTTTGACGAACTGAGGGGCCATCAGTTTGACATTATGGCCCATCGATATCAGTTTATTGGCCCAGAAATGAGCAGATGCACAGGCCTCCATGCCGATCAAACAGGGTGGGATGTTGGCAAAAAAGGAGGCCATTTGTGCCCGTCTGAGTTGTTTGTTGAACAACCGTTTTCCGTGCTCGTCAACCCCATGGATCTGGAAAACGTTTTTTGCCAAATCGATTCCAATAGTTTTAACGTTCATGATAGCAGCGCTCCGTTCAATGAGTGACGATTTATCGTCCCACTGTGGCACAAGAGATGGGAGGCGACCATTCCATTAACAAAGCC	NA	NA	NA	NA
WP_004118237.1|235065_236019_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|236104_238429_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|238473_239376_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|239372_240371_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|240367_241324_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|241324_242092_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|242190_242484_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|242814_243057_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|243354_244359_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_017901435.1|244437_244995_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.8	1.9e-59
WP_017901436.1|245017_245377_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_017901438.1|245527_245917_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_025999361.1|245913_246204_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_032673378.1|246360_249327_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.7	0.0e+00
WP_000427623.1|249405_250410_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_187095034.1|250729_250954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|250959_251664_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP007735	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence	89770	3714	66831	89770	transposase,integrase	Escherichia_phage(27.27%)	57	6211:6231	61690:61710
WP_040213451.1|3714_4710_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.6	7.0e-20
WP_020806188.1|5340_6321_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
6211:6231	attL	CATATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_042922438.1|7747_8611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922442.1|8892_9996_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_042922444.1|10025_11156_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_042922447.1|11155_11437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048994308.1|11428_11767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006788213.1|12292_12511_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_004197633.1|12512_12818_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_023280892.1|12975_13659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049245386.1|13661_14438_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|14495_14753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|14881_14986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|15520_16387_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|16743_17013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|17427_18633_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_042922453.1|18632_19607_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	1.2e-88
WP_004118291.1|19688_20960_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_042922457.1|20959_21391_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_175102019.1|21797_23243_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.7	1.7e-30
WP_077255006.1|25405_26374_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
WP_001039464.1|26513_26900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255007.1|27491_28460_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_001101446.1|28778_29804_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088717641.1|30007_31128_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_101999299.1|31217_31856_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	39.6	4.2e-10
WP_042922470.1|32402_33311_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042922473.1|33410_34184_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_042922476.1|34186_35260_-	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_042922521.1|35297_36068_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014640837.1|36425_37442_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_023302488.1|37474_37831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302487.1|37922_38543_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032427337.1|38707_39862_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023302485.1|39858_40167_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023302484.1|40168_41584_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_023302483.1|41628_43020_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023302482.1|43087_43867_+	acetoin reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.7	5.7e-09
WP_074424873.1|44211_45180_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_001181218.1|45201_45879_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_023280897.1|46110_46920_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_001515701.1|46931_48194_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_001294851.1|48347_49148_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001112072.1|49389_50763_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_000148344.1|50759_51356_+	HutD family protein	NA	NA	NA	NA	NA
WP_000069054.1|51594_52581_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001087990.1|52592_53474_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_016240370.1|53473_54259_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_000741484.1|54373_55924_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_000993475.1|55967_57650_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_000135555.1|57708_58875_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_000217345.1|58871_60029_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_001148851.1|60062_61148_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024191312.1|61237_61549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008503529.1|61602_62583_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
61690:61710	attR	CATATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_077255008.1|64542_65511_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_001101446.1|65805_66831_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP007736	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence	113440	0	53574	113440	integrase,transposase	Shigella_phage(10.53%)	61	38120:38134	50067:50081
WP_020802749.1|839_1835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426054.1|1821_2325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802753.1|2321_4040_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	24.5	5.8e-22
WP_020802754.1|4068_4329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426055.1|4870_5353_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	37.5	6.6e-08
WP_032426056.1|5395_5713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071599372.1|5773_6082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089617520.1|6343_7550_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_042922548.1|7547_8315_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	42.3	9.4e-41
WP_042922549.1|9141_9975_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.7	5.3e-21
WP_004152750.1|10023_10170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804846.1|10264_10612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802391.1|10678_11059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801939.1|11780_12197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023292165.1|12193_12505_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_042922612.1|12611_12836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922554.1|12846_13053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152758.1|13689_14040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922555.1|14036_14309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804573.1|14666_15389_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804574.1|15385_15817_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_020802171.1|15862_17872_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	2.7e-26
WP_004152655.1|17940_18183_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020802172.1|18230_18743_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_032425974.1|19672_19885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922559.1|20072_20636_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	9.7e-19
WP_042922560.1|20683_22039_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_023317809.1|23005_23230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889537.1|24059_24479_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001568045.1|24611_25040_-	antirestriction protein	NA	NA	NA	NA	NA
WP_042922563.1|25542_26307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317805.1|26363_26783_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|26792_27014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922569.1|27013_27715_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	1.2e-26
WP_000880375.1|28626_28881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803887.1|28883_30923_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.3e-25
WP_000211823.1|30919_31906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089617520.1|32158_33366_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_140392697.1|33546_33783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801683.1|34140_34533_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_020801689.1|34536_35511_-	StbA protein	NA	A0A222YXF2	Escherichia_phage	44.2	1.5e-70
WP_017901448.1|35750_36125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901447.1|36124_36757_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
WP_001568031.1|37749_38505_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
38120:38134	attL	ACGCTGTAAAGCCCT	NA	NA	NA	NA
WP_020804422.1|39043_39409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801687.1|39426_40212_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
WP_074192992.1|40262_40655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801688.1|40763_41708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568018.1|42294_42543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568017.1|42539_43112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|43142_43637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|43869_44178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|44671_45220_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|45266_45701_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_015065592.1|45929_47462_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_001567368.1|47573_48977_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|49005_49638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567371.1|51088_51493_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	95.5	2.0e-66
50067:50081	attR	ACGCTGTAAAGCCCT	NA	NA	NA	NA
WP_001567372.1|51489_51837_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	5.7e-62
WP_086076726.1|51886_52042_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001067855.1|52869_53574_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP007736	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence	113440	62531	65088	113440	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_001067855.1|62531_63236_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042922577.1|63804_64386_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020277919.1|64390_64729_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|64758_65088_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
>prophage 3
NZ_CP007736	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence	113440	72078	72639	113440		Ralstonia_phage(100.0%)	1	NA	NA
WP_021242984.1|72078_72639_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
>prophage 4
NZ_CP007736	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence	113440	76432	77137	113440	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|76432_77137_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP007736	Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence	113440	81446	85468	113440	transposase	Wolbachia_phage(33.33%)	3	NA	NA
WP_077255011.1|81446_81827_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.6	9.8e-15
WP_000509966.1|81870_82476_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|82570_85468_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
