The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	584769	721832	2750603	tRNA,portal,tail,plate,capsid,protease	Escherichia_phage(25.0%)	112	NA	NA
WP_024748950.1|584769_585267_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.0	3.7e-06
WP_051247983.1|585274_585757_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_024748951.1|585922_587341_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_004088071.1|587847_588612_-	arginyltransferase	NA	NA	NA	NA	NA
WP_020852934.1|589035_589527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852933.1|589530_590382_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_042836387.1|591297_591618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836655.1|592748_595646_+	autotransporter domain-containing protein	NA	A0A2R3ZXQ7	Staphylococcus_phage	21.3	5.2e-07
WP_011097587.1|596504_596705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020851849.1|596937_598929_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_020851850.1|599575_602167_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_010893552.1|603209_603395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155244246.1|603560_603800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851852.1|604078_607105_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_020851853.1|607210_608653_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.1	4.4e-47
WP_024748955.1|609801_611109_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_020851856.1|612001_612706_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.3	7.9e-26
WP_038274322.1|612762_613917_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_024748956.1|613996_614788_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_020851859.1|614809_615292_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_020851860.1|615288_616305_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_020851861.1|616492_618847_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_020851862.1|618945_620280_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_020851863.1|620306_621491_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_020851864.1|621493_622348_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020851865.1|622344_623112_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	35.6	2.5e-17
WP_024748959.1|623114_623672_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_020851867.1|624463_625807_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_024748961.1|626038_626719_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_020851869.1|626830_627151_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_020851870.1|628030_628255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851871.1|628363_629095_-	UMP kinase	NA	NA	NA	NA	NA
WP_024748963.1|629540_629789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851872.1|630504_631164_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_020851873.1|631275_633168_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_020851874.1|633307_634027_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_020851875.1|634023_635037_-	glucokinase	NA	NA	NA	NA	NA
WP_024748964.1|635033_636467_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.2	9.9e-68
WP_024748965.1|636795_637890_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.4	5.5e-26
WP_020851878.1|638034_638952_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011097601.1|639122_639341_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_024748967.1|639398_639794_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004085197.1|639790_640174_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_020851880.1|640181_641972_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_020851881.1|641992_642778_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004089280.1|642898_643147_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011097604.1|643169_643550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851882.1|643575_644817_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155244247.1|644848_645532_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.9	1.2e-34
WP_020851884.1|645878_648356_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_020851885.1|648340_649003_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|649007_649445_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_020851886.1|649462_651211_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.2	1.5e-49
WP_020851887.1|651207_652227_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_020850949.1|652635_653718_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	9.7e-92
WP_020850950.1|653708_653927_-|tail	phage tail X	tail	A0A1W6JT40	Escherichia_phage	48.6	6.8e-13
WP_020850952.1|654406_656626_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	44.9	7.8e-96
WP_012337638.1|656752_657040_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_004086986.1|657042_657552_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_020850953.1|657551_658730_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.4	4.5e-135
WP_024748652.1|658794_660387_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	36.1	3.2e-83
WP_020852723.1|660394_660952_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	1.5e-51
WP_020850956.1|660944_661838_-|plate	baseplate assembly protein J	plate	V9IQV9	Stenotrophomonas_phage	46.4	5.1e-70
WP_004088650.1|661837_662176_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_020853122.1|662325_662589_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_020853121.1|662575_662857_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_024748577.1|662893_663481_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_020850961.1|663477_664020_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.6	4.0e-38
WP_020850962.1|663995_664517_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.9	1.6e-12
WP_020850963.1|664513_664837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850964.1|664836_665097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850965.1|665114_666989_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.8	1.1e-162
WP_020850966.1|666985_667618_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.7	3.3e-47
WP_020850968.1|668129_668408_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	98.9	7.8e-46
WP_020850970.1|668769_669186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850972.1|670007_670649_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	40.7	2.0e-12
WP_020850973.1|670676_671153_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_020850974.1|671157_671730_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024749016.1|671726_673685_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_024749015.1|674617_675007_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155266647.1|675807_675948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850978.1|676293_676779_-	L-asparaginase	NA	NA	NA	NA	NA
WP_004089979.1|677021_677621_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_011097631.1|678195_679380_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.3	8.2e-52
WP_020850980.1|679571_680147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850981.1|681013_681223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089989.1|681500_681794_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_020850982.1|681878_684650_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.8	2.6e-64
WP_155244251.1|685016_685163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850983.1|685299_686013_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_024749013.1|686210_687335_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.7	1.4e-08
WP_020850985.1|687536_690779_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_004089996.1|690775_691252_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_020850986.1|691259_692180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850987.1|692149_693991_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_100206163.1|694634_695759_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	1.2e-07
WP_020850988.1|695941_697462_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.1	3.8e-86
WP_020850989.1|697599_698697_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_020850990.1|698737_700891_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.6	5.0e-47
WP_020850991.1|700913_701786_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_020850992.1|702065_704672_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_004090028.1|704762_706124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850993.1|706104_707511_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_020850994.1|708517_709480_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_020850995.1|709533_710361_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_024749011.1|710850_711579_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024749010.1|711697_712267_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024749009.1|712267_713761_+	ribonuclease G	NA	NA	NA	NA	NA
WP_051404208.1|713890_717751_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_020852533.1|717875_719333_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_020852531.1|719835_720405_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_020852530.1|720464_721832_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 2
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	964769	1001562	2750603	integrase	Xylella_phage(84.38%)	38	968172:968187	1003714:1003729
WP_024749247.1|964769_967712_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.5	1.1e-262
968172:968187	attL	TGTTTTCAATACATCA	NA	NA	NA	NA
WP_020852652.1|968274_969336_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	57.2	2.7e-102
WP_020852651.1|969347_969584_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	52.6	1.9e-08
WP_042836408.1|969580_970975_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	98.0	7.7e-267
WP_020852000.1|971059_971386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851999.1|971387_971666_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	97.8	8.7e-45
WP_042836409.1|971662_973843_-	DNA polymerase	NA	C8CLG0	Xylella_phage	96.7	0.0e+00
WP_020851997.1|973844_975011_-	BRO, N-terminal	NA	C8CLG1	Xylella_phage	78.4	1.3e-161
WP_020851996.1|975136_975703_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	98.9	2.6e-104
WP_042836411.1|975699_976980_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.2	3.4e-229
WP_020851993.1|977461_977656_-	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.3e-26
WP_020851992.1|977687_977882_-	hypothetical protein	NA	C8CLG6	Xylella_phage	87.5	1.8e-25
WP_020851991.1|977878_978280_-	hypothetical protein	NA	C8CLG7	Xylella_phage	94.7	9.8e-66
WP_042836412.1|978276_978747_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_080702464.1|978743_979277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836414.1|979458_980214_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	31.1	1.3e-29
WP_024748600.1|980296_980533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024748599.1|980522_980756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836415.1|980861_981245_+	hypothetical protein	NA	C8CLH2	Xylella_phage	98.4	3.2e-66
WP_155266656.1|981247_981508_+	hypothetical protein	NA	C8CLH4	Xylella_phage	85.9	3.1e-36
WP_020852982.1|981504_982098_+	phage-related protein	NA	C8CLH5	Xylella_phage	56.4	4.7e-48
WP_020852983.1|982233_984780_+	phage/plasmid primase P4	NA	C8CLH6	Xylella_phage	95.6	0.0e+00
WP_020852984.1|985238_985961_+	hypothetical protein	NA	C8CLH7	Xylella_phage	91.2	1.9e-115
WP_020852985.1|986136_986637_+	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	56.0	6.0e-28
WP_011097940.1|986647_986959_+	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	44.0	7.0e-19
WP_020850868.1|987286_987601_+	hypothetical protein	NA	C8CLI2	Xylella_phage	97.1	1.8e-51
WP_024749224.1|987600_987927_+	hypothetical protein	NA	C8CLI3	Xylella_phage	96.3	2.3e-52
WP_020850869.1|987835_989251_+	Protein of unknown function DUF264	NA	C8CLI4	Xylella_phage	99.6	2.5e-281
WP_020850872.1|992232_993459_+	hypothetical protein	NA	C8CLI7	Xylella_phage	97.3	2.4e-224
WP_020850873.1|993479_993887_+	hypothetical protein	NA	C8CLI8	Xylella_phage	97.8	1.8e-67
WP_020850874.1|993883_995812_+	hypothetical protein	NA	C8CLI9	Xylella_phage	95.8	0.0e+00
WP_020850875.1|995781_996027_+	hypothetical protein	NA	C8CLJ0	Xylella_phage	97.2	1.6e-34
WP_020850876.1|996057_996765_+	hypothetical protein	NA	C8CLJ1	Xylella_phage	78.7	1.7e-92
WP_020850877.1|996768_997965_+	hypothetical protein	NA	C8CLJ2	Xylella_phage	94.8	2.4e-208
WP_128283847.1|999734_999938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024749188.1|1000046_1000481_-	DUF2335 domain-containing protein	NA	C8CLJ5	Xylella_phage	76.6	3.2e-38
WP_020850879.1|1000446_1000692_-	hypothetical protein	NA	C8CLJ6	Xylella_phage	90.1	2.7e-34
WP_020850880.1|1000779_1001562_+	hypothetical protein	NA	C8CLJ7	Xylella_phage	90.0	7.9e-128
1003714:1003729	attR	TGTTTTCAATACATCA	NA	NA	NA	NA
>prophage 3
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	1047446	1139567	2750603	tRNA,terminase,portal,tail,plate,integrase,capsid,protease	Xylella_phage(31.91%)	99	1082503:1082517	1141173:1141187
WP_020850915.1|1047446_1048586_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004083752.1|1048582_1049041_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004083751.1|1049220_1049541_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.0	4.2e-11
WP_020850916.1|1049673_1051950_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.7	3.2e-169
WP_004083749.1|1052298_1052517_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_020850917.1|1052633_1053365_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024749288.1|1053376_1054510_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020850919.1|1054937_1055903_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	4.5e-64
WP_011097738.1|1056171_1058526_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.1	3.1e-82
WP_020850921.1|1058710_1060621_+	DUF3857 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_012382518.1|1061180_1061825_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_020850922.1|1061955_1063323_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.1	5.4e-71
WP_020850923.1|1063483_1063885_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_020850924.1|1064558_1066055_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	36.1	2.1e-07
WP_024749287.1|1066180_1066696_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_020850926.1|1066706_1067444_-	pteridine reductase	NA	NA	NA	NA	NA
WP_024749286.1|1067524_1068709_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020850928.1|1068696_1069113_+	VanZ like protein	NA	NA	NA	NA	NA
WP_020850929.1|1069132_1070137_-	glucokinase	NA	NA	NA	NA	NA
WP_024749285.1|1070548_1070734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850931.1|1070825_1072115_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
WP_020850932.1|1072118_1073195_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_020850933.1|1073191_1074232_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_020850934.1|1074231_1075389_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_004089081.1|1076079_1076976_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_004089079.1|1076972_1078319_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011097744.1|1078407_1079262_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_020850935.1|1079258_1080404_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004083726.1|1080916_1081246_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_004089067.1|1081349_1082600_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	37.4	1.6e-82
1082503:1082517	attL	TTTCCGTGTACGTGG	NA	NA	NA	NA
WP_020850937.1|1082587_1083856_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024749283.1|1083855_1084692_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.6	1.9e-10
WP_024749282.1|1084838_1086296_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004089061.1|1086316_1086778_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_004083722.1|1086958_1087426_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_020850940.1|1088267_1090385_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	37.1	3.7e-26
WP_080702467.1|1090381_1090690_+	lipoprotein	NA	NA	NA	NA	NA
WP_020850942.1|1090699_1091554_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_020850943.1|1091550_1092222_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024749281.1|1092245_1093130_+	tyrosine recombinase XerC	NA	A0A0K0N6I5	Gordonia_phage	32.5	7.1e-16
WP_020850945.1|1093643_1094195_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_020850946.1|1094262_1095642_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.5	4.9e-40
WP_020850947.1|1095861_1097217_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_020850948.1|1097734_1097932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850949.1|1098172_1099255_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	9.7e-92
WP_020850950.1|1099245_1099464_-|tail	phage tail X	tail	A0A1W6JT40	Escherichia_phage	48.6	6.8e-13
WP_012337638.1|1102292_1102580_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_004086986.1|1102582_1103092_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_020850953.1|1103091_1104270_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.4	4.5e-135
WP_024748652.1|1104334_1105927_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	36.1	3.2e-83
WP_020852723.1|1105934_1106492_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	1.5e-51
WP_020850956.1|1106484_1107378_-|plate	baseplate assembly protein J	plate	V9IQV9	Stenotrophomonas_phage	46.4	5.1e-70
WP_004088650.1|1107377_1107716_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004087029.1|1107849_1108164_+	hypothetical protein	NA	O64357	Escherichia_phage	30.4	1.6e-07
WP_004087027.1|1108165_1108447_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020850959.1|1108458_1108758_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_024748577.1|1108762_1109350_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_020850961.1|1109346_1109889_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.6	4.0e-38
WP_020850962.1|1109864_1110386_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.9	1.6e-12
WP_020850963.1|1110382_1110706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850964.1|1110705_1110966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850965.1|1110983_1112858_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.8	1.1e-162
WP_042836423.1|1112854_1114444_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.9	2.4e-131
WP_042836424.1|1114440_1114992_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	3.4e-40
WP_042836425.1|1114995_1116948_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	63.2	9.2e-250
WP_050765486.1|1116940_1117474_-	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	58.6	5.2e-46
WP_024748558.1|1117646_1117871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852852.1|1117872_1118334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097940.1|1118323_1118635_-	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	44.0	7.0e-19
WP_020852372.1|1118645_1119146_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	52.4	3.9e-27
WP_020852851.1|1119112_1119730_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	5.3e-26
WP_020852203.1|1120013_1122551_-	phage/plasmid primase P4	NA	C8CLH6	Xylella_phage	98.2	0.0e+00
WP_020852204.1|1122687_1123281_-	phage-related protein	NA	C8CLH5	Xylella_phage	57.4	4.3e-49
WP_020852205.1|1123277_1123664_-	phage-related protein	NA	C8CLH4	Xylella_phage	70.6	1.1e-40
WP_024749230.1|1124325_1124574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852207.1|1124570_1124759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382631.1|1125026_1125287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852208.1|1125371_1126130_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	39.4	5.0e-34
WP_042836427.1|1126291_1126831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749157.1|1126868_1127186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266649.1|1127403_1127823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851629.1|1127928_1128381_+	hypothetical protein	NA	C8CLG9	Xylella_phage	36.4	6.6e-10
WP_020851628.1|1128377_1128734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749160.1|1128730_1129144_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_020851627.1|1129140_1129542_+	hypothetical protein	NA	C8CLG7	Xylella_phage	94.7	3.7e-65
WP_012382634.1|1129538_1129730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851626.1|1129753_1129945_+	hypothetical protein	NA	C8CLG6	Xylella_phage	73.4	6.8e-17
WP_020851625.1|1129976_1130171_+	hypothetical protein	NA	C8CLG5	Xylella_phage	93.8	1.4e-25
WP_020851624.1|1130225_1130657_+	hypothetical protein	NA	C8CLG4	Xylella_phage	91.6	3.2e-46
WP_020851623.1|1130653_1131934_+	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	92.3	3.6e-226
WP_020851622.1|1131930_1132497_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	98.4	5.8e-104
WP_020851621.1|1132622_1133786_+	BRO, N-terminal	NA	C8CLG1	Xylella_phage	90.1	9.5e-194
WP_020851620.1|1133787_1135968_+	DNA-directed DNA polymerase	NA	C8CLG0	Xylella_phage	98.5	0.0e+00
WP_020850968.1|1135964_1136243_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	98.9	7.8e-46
WP_020851619.1|1136244_1136571_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_020851618.1|1136655_1138074_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	98.9	1.9e-276
WP_020851617.1|1138070_1138310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749236.1|1138296_1138620_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051404224.1|1138991_1139567_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1141173:1141187	attR	CCACGTACACGGAAA	NA	NA	NA	NA
>prophage 4
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	1298178	1387704	2750603	tRNA,terminase,head,plate,tail,capsid	Xylella_phage(22.22%)	120	NA	NA
WP_020852005.1|1298178_1299459_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	1.9e-94
WP_020852004.1|1299580_1300276_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_042836467.1|1301924_1303343_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	97.7	1.2e-272
WP_020851668.1|1303427_1303811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851667.1|1303812_1304091_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	97.8	3.9e-45
WP_020852574.1|1306268_1307435_-	hypothetical protein	NA	C8CLG1	Xylella_phage	77.7	2.1e-161
WP_020851996.1|1307560_1308127_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	98.9	2.6e-104
WP_042836469.1|1308123_1309404_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.4	2.4e-230
WP_020852576.1|1309400_1309919_-	hypothetical protein	NA	C8CLG4	Xylella_phage	74.4	1.3e-38
WP_016024078.1|1309908_1310103_-	hypothetical protein	NA	C8CLG5	Xylella_phage	100.0	3.3e-27
WP_042836474.1|1310134_1310326_-	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	8.1e-18
WP_024749277.1|1310349_1310541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836676.1|1310840_1311323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748570.1|1311379_1311847_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_024748571.1|1311843_1312266_-	hypothetical protein	NA	C8CLG9	Xylella_phage	39.6	1.3e-07
WP_042836678.1|1312517_1312868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836476.1|1312921_1313131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836477.1|1313153_1313672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051604008.1|1313726_1314464_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042836479.1|1314502_1314718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836481.1|1314738_1315020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085135.1|1315399_1315588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836483.1|1315584_1315833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850863.1|1316725_1317526_+	hypothetical protein	NA	A4PE61	Ralstonia_virus	45.9	6.2e-19
WP_020850864.1|1317677_1320209_+	phage/plasmid primase P4	NA	C8CLH6	Xylella_phage	74.3	0.0e+00
WP_020853009.1|1320556_1321174_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_020853008.1|1321140_1321635_+	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	51.7	2.9e-27
WP_011097940.1|1321645_1321957_+	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	44.0	7.0e-19
WP_042836484.1|1321946_1322408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748558.1|1322409_1322634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050765457.1|1322806_1323340_+	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	58.6	4.0e-46
WP_042836487.1|1323332_1325285_+|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	62.9	2.5e-247
WP_020852854.1|1325288_1325840_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	4.4e-40
WP_020852856.1|1327422_1329297_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.8	5.5e-159
WP_020852857.1|1329314_1329575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852858.1|1329574_1329898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850962.1|1329894_1330416_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.9	1.6e-12
WP_020850961.1|1330391_1330934_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.6	4.0e-38
WP_042836490.1|1330930_1331518_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_004085172.1|1331522_1331798_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_004085174.1|1331808_1332090_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.2	1.6e-14
WP_004090694.1|1332287_1332626_+|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	5.4e-33
WP_020852724.1|1332625_1333519_+|plate	baseplate assembly protein J	plate	V9IQV9	Stenotrophomonas_phage	46.4	1.5e-69
WP_020852723.1|1333511_1334069_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	1.5e-51
WP_020852722.1|1334076_1335669_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	35.9	2.7e-82
WP_020852721.1|1335733_1336912_+|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.7	2.0e-135
WP_004086986.1|1336911_1337421_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_020852720.1|1337423_1337711_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	4.0e-13
WP_020852719.1|1337837_1340057_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	45.8	8.1e-101
WP_020852718.1|1340053_1340536_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	1.5e-28
WP_004088371.1|1340532_1340751_+|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	51.4	2.1e-14
WP_020852717.1|1340741_1341824_+	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	9.7e-92
WP_020852716.1|1342064_1342262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749271.1|1344053_1344500_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	53.5	7.7e-35
WP_024749272.1|1344483_1344960_-	DUF5131 family protein	NA	NA	NA	NA	NA
WP_020852221.1|1344956_1345460_-	phage-related protein	NA	Q5QF30	Pseudomonas_virus	35.9	8.7e-27
WP_020852220.1|1345456_1346221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836493.1|1346249_1347911_-	hypothetical protein	NA	U6C712	Ralstonia_phage	36.5	1.4e-92
WP_024749275.1|1347907_1348834_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.4	1.7e-57
WP_020852217.1|1348849_1349671_-	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.0	4.7e-54
WP_020852216.1|1349692_1350055_-	hypothetical protein	NA	U5P4J6	Shigella_phage	44.8	4.9e-16
WP_020852215.1|1350075_1350267_-	hypothetical protein	NA	C8CLG6	Xylella_phage	75.0	8.9e-17
WP_024749277.1|1350290_1350482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852214.1|1350478_1350880_-	hypothetical protein	NA	C8CLG7	Xylella_phage	94.7	8.3e-65
WP_020852212.1|1351344_1351878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852211.1|1352147_1352531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155238083.1|1352584_1352758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852210.1|1352776_1353145_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_004086345.1|1353141_1353432_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_020851631.1|1353454_1353994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011098226.1|1354127_1354580_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	40.4	4.1e-12
WP_020851633.1|1354662_1354968_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	44.4	1.2e-07
WP_155244288.1|1354957_1355455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851634.1|1355515_1355704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749279.1|1355700_1355949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851635.1|1355945_1356233_+	hypothetical protein	NA	C8CLH4	Xylella_phage	80.9	1.2e-33
WP_020851636.1|1356229_1356820_+	hypothetical protein	NA	C8CLH5	Xylella_phage	92.7	4.8e-53
WP_042836694.1|1356922_1358071_+	hypothetical protein	NA	C8CLG1	Xylella_phage	80.2	7.2e-170
WP_020851956.1|1358049_1358328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853092.1|1358329_1359172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853093.1|1359168_1360629_+	replicative DNA helicase	NA	O80281	Escherichia_phage	39.5	9.8e-71
WP_020853094.1|1360634_1361060_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.0	2.5e-11
WP_020852371.1|1361169_1361868_+	phage-related protein	NA	C8CLH7	Xylella_phage	80.0	5.8e-98
WP_020852372.1|1362032_1362533_+	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	52.4	3.9e-27
WP_020852373.1|1362525_1362855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852374.1|1362844_1363306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038273669.1|1363283_1363520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852375.1|1363611_1364010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836495.1|1363960_1365511_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.3	1.6e-111
WP_080702534.1|1365591_1366896_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	39.1	1.3e-63
WP_020852378.1|1366944_1367226_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	45.2	1.2e-12
WP_020852379.1|1367222_1367561_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020852380.1|1367633_1368479_+|head	phage head morphogenesis protein, SPP1 gp7	head	Q7Y5U5	Haemophilus_phage	33.8	3.7e-30
WP_024748896.1|1368478_1369687_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.7	1.6e-39
WP_020852382.1|1369696_1370179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748895.1|1370188_1371172_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.3	3.8e-50
WP_020852384.1|1371234_1371588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748894.1|1371587_1371956_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.9	7.5e-12
WP_024748893.1|1371952_1372432_+	hypothetical protein	NA	M4SN98	Psychrobacter_phage	28.7	2.7e-09
WP_038274217.1|1372418_1372787_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.3	2.2e-19
WP_024748892.1|1372767_1373244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852389.1|1373244_1374741_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.0	9.2e-125
WP_004087249.1|1374750_1375188_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	63.1	3.6e-45
WP_020851660.1|1375184_1375607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851659.1|1375754_1377644_+	phage-related protein	NA	D0UII2	Aggregatibacter_phage	27.7	2.9e-22
WP_024748528.1|1377654_1378059_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024748527.1|1378055_1378328_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020851656.1|1378487_1379258_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.2	1.3e-29
WP_020851655.1|1379257_1379575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851654.1|1379571_1380402_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.1	2.6e-76
WP_020851653.1|1380398_1381040_+	phage-related protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	8.7e-32
WP_020851652.1|1381036_1381390_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	51.3	3.3e-25
WP_004089254.1|1381400_1381706_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
WP_004089252.1|1381709_1382006_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.1	3.3e-26
WP_020851651.1|1382104_1383250_+|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	7.4e-98
WP_020851650.1|1383246_1383807_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	25.5	3.2e-06
WP_024748982.1|1383810_1385055_+|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.5e-08
WP_020852919.1|1385158_1385605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852918.1|1385863_1386832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852917.1|1386828_1387704_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.7e-09
>prophage 5
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	1429874	1464600	2750603	integrase	Xylella_phage(97.06%)	40	1428021:1428036	1439385:1439400
1428021:1428036	attL	CGTAGTGCGCGCGGCG	NA	NA	NA	NA
WP_020851670.1|1429874_1430894_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.3	1.1e-172
WP_011097965.1|1430883_1431141_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	87.1	4.7e-37
WP_042836467.1|1431294_1432713_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	97.7	1.2e-272
WP_024749221.1|1432797_1433103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852648.1|1433104_1433383_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	97.8	1.7e-45
WP_042836500.1|1433379_1435560_-	DNA polymerase	NA	C8CLG0	Xylella_phage	96.8	0.0e+00
WP_024749020.1|1435561_1436722_-	hypothetical protein	NA	C8CLG1	Xylella_phage	90.8	1.5e-199
WP_020852645.1|1436790_1437357_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	98.4	4.4e-104
WP_020852644.1|1437353_1438634_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	89.2	1.6e-218
WP_020852643.1|1438630_1439128_-	hypothetical protein	NA	C8CLG4	Xylella_phage	92.1	2.7e-49
WP_020852642.1|1439114_1439312_-	hypothetical protein	NA	C8CLG5	Xylella_phage	93.8	1.4e-25
WP_020852641.1|1439343_1439538_-	hypothetical protein	NA	C8CLG6	Xylella_phage	82.8	7.2e-22
1439385:1439400	attR	CGTAGTGCGCGCGGCG	NA	NA	NA	NA
WP_020852640.1|1439534_1439936_-	hypothetical protein	NA	C8CLG7	Xylella_phage	66.2	1.3e-44
WP_042836501.1|1439935_1440397_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_020852639.1|1440393_1440783_-	hypothetical protein	NA	C8CLG9	Xylella_phage	41.6	2.8e-09
WP_155244268.1|1441011_1441872_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	97.2	9.0e-157
WP_155244269.1|1441813_1442143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749173.1|1442132_1442462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852637.1|1442549_1442933_+	hypothetical protein	NA	C8CLH2	Xylella_phage	99.2	1.9e-66
WP_020852636.1|1443189_1443834_+	hypothetical protein	NA	C8CLH4	Xylella_phage	41.0	1.1e-23
WP_020852635.1|1443830_1444397_+	hypothetical protein	NA	C8CLH5	Xylella_phage	94.7	4.0e-97
WP_042836502.1|1444533_1447065_+	DNA primase	NA	C8CLH6	Xylella_phage	74.4	0.0e+00
WP_042836503.1|1447541_1448264_+	hypothetical protein	NA	C8CLH7	Xylella_phage	86.2	6.2e-111
WP_020852372.1|1448427_1448928_+	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	52.4	3.9e-27
WP_020852373.1|1448920_1449250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850868.1|1449577_1449892_+	hypothetical protein	NA	C8CLI2	Xylella_phage	97.1	1.8e-51
WP_024749224.1|1449891_1450218_+	hypothetical protein	NA	C8CLI3	Xylella_phage	96.3	2.3e-52
WP_020850869.1|1450126_1451542_+	Protein of unknown function DUF264	NA	C8CLI4	Xylella_phage	99.6	2.5e-281
WP_020850870.1|1451544_1453617_+	hypothetical protein	NA	C8CLI5	Xylella_phage	98.3	0.0e+00
WP_020850871.1|1453618_1454473_+	hypothetical protein	NA	C8CLI6	Xylella_phage	94.4	4.6e-121
WP_042836505.1|1454520_1455747_+	hypothetical protein	NA	C8CLI7	Xylella_phage	97.1	7.1e-224
WP_020850873.1|1455767_1456175_+	hypothetical protein	NA	C8CLI8	Xylella_phage	97.8	1.8e-67
WP_020850874.1|1456171_1458100_+	hypothetical protein	NA	C8CLI9	Xylella_phage	95.8	0.0e+00
WP_020850875.1|1458069_1458315_+	hypothetical protein	NA	C8CLJ0	Xylella_phage	97.2	1.6e-34
WP_020850876.1|1458345_1459053_+	hypothetical protein	NA	C8CLJ1	Xylella_phage	78.7	1.7e-92
WP_020850877.1|1459056_1460253_+	hypothetical protein	NA	C8CLJ2	Xylella_phage	94.8	2.4e-208
WP_155266650.1|1460256_1462026_+	hypothetical protein	NA	C8CLJ3	Xylella_phage	90.2	8.5e-279
WP_128283847.1|1462022_1462226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852736.1|1462318_1463101_+	hypothetical protein	NA	C8CLJ7	Xylella_phage	90.4	1.6e-128
WP_020852737.1|1463097_1464600_+	hypothetical protein	NA	C8CLJ8	Xylella_phage	91.8	1.5e-239
>prophage 6
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	1684799	1728386	2750603	plate,terminase,tail,head	Haemophilus_phage(19.51%)	64	NA	NA
WP_020852400.1|1684799_1685243_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.5	3.3e-30
WP_020852401.1|1685300_1686014_-	DNA-binding protein (Roi)	NA	G0ZND1	Cronobacter_phage	50.2	1.4e-43
WP_020852402.1|1686010_1686619_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	62.2	3.2e-36
WP_155266652.1|1686712_1687033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836520.1|1686969_1688604_-	hypothetical protein	NA	U6C712	Ralstonia_phage	37.2	9.2e-94
WP_042836522.1|1688600_1689536_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	47.2	1.5e-56
WP_042836523.1|1689551_1690373_-	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.0	2.1e-54
WP_042836525.1|1690412_1690757_-	hypothetical protein	NA	U5P4J6	Shigella_phage	45.5	2.3e-15
WP_024748588.1|1690777_1690969_-	hypothetical protein	NA	C8CLG6	Xylella_phage	73.4	3.4e-16
WP_080702475.1|1690991_1691270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086365.1|1691313_1691505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836702.1|1691501_1691909_-	hypothetical protein	NA	C8CLG7	Xylella_phage	83.7	7.9e-55
WP_042836527.1|1692065_1692590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836703.1|1692709_1693114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080702476.1|1693265_1693469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851949.1|1693431_1694229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080702477.1|1694414_1695479_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	25.7	5.5e-15
WP_080702478.1|1695477_1695732_+	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	49.3	1.3e-07
WP_020851634.1|1696279_1696468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748753.1|1696464_1696713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851952.1|1696994_1697636_+	hypothetical protein	NA	C8CLH4	Xylella_phage	45.3	3.2e-34
WP_020851954.1|1698240_1698831_+	hypothetical protein	NA	C8CLH5	Xylella_phage	94.5	2.8e-53
WP_042836694.1|1698933_1700082_+	hypothetical protein	NA	C8CLG1	Xylella_phage	80.2	7.2e-170
WP_020851956.1|1700060_1700339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853092.1|1700340_1701183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853093.1|1701179_1702640_+	replicative DNA helicase	NA	O80281	Escherichia_phage	39.5	9.8e-71
WP_020853094.1|1702645_1703071_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.0	2.5e-11
WP_004089577.1|1704070_1704337_+	hypothetical protein	NA	K4NX81	Burkholderia_phage	40.7	1.8e-07
WP_004089578.1|1704323_1704662_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_020852372.1|1704865_1705366_+	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	52.4	3.9e-27
WP_020852373.1|1705358_1705688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852374.1|1705677_1706139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038273669.1|1706116_1706353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852375.1|1706444_1706843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852376.1|1706793_1708344_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.5	3.2e-112
WP_080702538.1|1708424_1709729_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	39.1	1.8e-63
WP_020852378.1|1709777_1710059_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	45.2	1.2e-12
WP_020852379.1|1710055_1710394_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020852380.1|1710466_1711312_+|head	phage head morphogenesis protein, SPP1 gp7	head	Q7Y5U5	Haemophilus_phage	33.8	3.7e-30
WP_024748896.1|1711311_1712520_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.7	1.6e-39
WP_020852382.1|1712529_1713012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748895.1|1713021_1714005_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.3	3.8e-50
WP_020852384.1|1714067_1714421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748894.1|1714420_1714789_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.9	7.5e-12
WP_024748893.1|1714785_1715265_+	hypothetical protein	NA	M4SN98	Psychrobacter_phage	28.7	2.7e-09
WP_038274217.1|1715251_1715620_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.3	2.2e-19
WP_024748892.1|1715600_1716077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852389.1|1716077_1717574_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.0	9.2e-125
WP_004087249.1|1717583_1718021_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	63.1	3.6e-45
WP_020851660.1|1718017_1718440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851659.1|1718587_1720477_+	phage-related protein	NA	D0UII2	Aggregatibacter_phage	27.7	2.9e-22
WP_024748528.1|1720487_1720892_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024748527.1|1720888_1721161_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020851656.1|1721320_1722091_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.2	1.3e-29
WP_020851655.1|1722090_1722408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851654.1|1722404_1723235_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.1	2.6e-76
WP_020851653.1|1723231_1723873_+	phage-related protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	8.7e-32
WP_020851652.1|1723869_1724223_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	51.3	3.3e-25
WP_004089254.1|1724233_1724539_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
WP_004089252.1|1724542_1724839_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.1	3.3e-26
WP_020851651.1|1724937_1726083_+|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	7.4e-98
WP_020851650.1|1726079_1726640_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	25.5	3.2e-06
WP_020851649.1|1726643_1727807_+|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.4e-08
WP_024749309.1|1727945_1728386_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	37.5	1.5e-22
>prophage 7
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	1834159	1845733	2750603	integrase	Stenotrophomonas_phage(40.0%)	18	1834176:1834228	1843103:1843155
WP_024748713.1|1834159_1834537_-	hypothetical protein	NA	S0F314	Stenotrophomonas_phage	58.7	7.7e-20
1834176:1834228	attL	CATCGGCCTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAG	NA	NA	NA	NA
WP_042836558.1|1834674_1834977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080702486.1|1834969_1835236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853101.1|1835239_1835422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080702487.1|1835553_1835886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853102.1|1835919_1837095_+	replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	46.3	6.6e-78
WP_042836560.1|1837139_1837451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042836563.1|1837462_1837666_+	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	63.3	2.8e-16
WP_020852956.1|1837662_1837908_+	phage-related protein	NA	A0A1D6ZIT7	Xanthomonas_phage	56.7	5.3e-06
WP_020852955.1|1837964_1839491_+	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	48.2	1.3e-44
WP_024749197.1|1839496_1839868_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	45.9	2.3e-21
WP_020852954.1|1839872_1841027_+	zonular occludens toxin	NA	S0F3F8	Stenotrophomonas_phage	57.5	1.2e-111
WP_080702488.1|1841301_1841718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852953.1|1841742_1841982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080702489.1|1842261_1843089_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	43.8	6.8e-61
WP_155244216.1|1843910_1844222_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	45.8	2.1e-07
1843103:1843155	attR	CATCGGCCTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAG	NA	NA	NA	NA
WP_024749199.1|1844307_1844547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852961.1|1844668_1845733_-	DUF2075 domain-containing protein	NA	Q6UAZ2	Ralstonia_phage	27.4	3.2e-23
>prophage 8
NZ_CP006696	Xylella fastidiosa subsp. sandyi Ann-1, complete genome	2750603	2428130	2475319	2750603	terminase,portal,tail,plate,integrase,transposase	Xylella_phage(18.18%)	56	2448706:2448722	2485035:2485051
WP_020852292.1|2428130_2428646_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	33.6	1.5e-13
WP_024749052.1|2428642_2428879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836615.1|2428955_2431055_-|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	30.5	6.7e-73
WP_020853062.1|2431051_2431651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836619.1|2432047_2433553_-	virulence factor	NA	A0A2D1GN57	Marinobacter_phage	32.8	2.6e-58
WP_042836620.1|2433549_2434605_-	DNA primase	NA	S5M810	Pseudoalteromonas_phage	39.8	1.1e-15
WP_024748708.1|2434603_2435005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852705.1|2435106_2435730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836623.1|2435787_2436138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836624.1|2436124_2436421_-	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	57.1	4.2e-13
WP_004086786.1|2436497_2436929_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	58.8	5.0e-15
WP_042836716.1|2437043_2437511_+	hypothetical protein	NA	C7BGF7	Burkholderia_phage	38.5	5.2e-10
WP_051604013.1|2437716_2438025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836626.1|2438527_2438926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853051.1|2439159_2439648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020853053.1|2440086_2440566_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_020852697.1|2440562_2441012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021358638.1|2441008_2441230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853056.1|2441226_2441505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020853057.1|2441501_2441768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852695.1|2441899_2442433_+	pilin	NA	NA	NA	NA	NA
WP_020852693.1|2442845_2443055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852950.1|2443038_2443485_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.9	5.0e-34
WP_020852746.1|2443506_2443779_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.7	1.7e-08
WP_020852945.1|2445341_2445815_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_020852944.1|2445771_2446605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024749081.1|2447163_2447712_+	SocA family protein	NA	I6R0L8	Salmonella_phage	39.4	9.5e-19
WP_024749080.1|2447671_2448268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024749079.1|2448281_2448509_+	hypothetical protein	NA	C8CLJ6	Xylella_phage	64.5	2.6e-15
WP_020851649.1|2448509_2449673_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.4e-08
2448706:2448722	attL	TTGCCGTTTGCATCGGT	NA	NA	NA	NA
WP_020851650.1|2449676_2450237_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	25.5	3.2e-06
WP_020851651.1|2450233_2451379_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	7.4e-98
WP_004089252.1|2451477_2451774_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.1	3.3e-26
WP_004089254.1|2451777_2452083_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
WP_020851652.1|2452093_2452447_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	51.3	3.3e-25
WP_020851653.1|2452443_2453085_-	phage-related protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	8.7e-32
WP_042836628.1|2453081_2453912_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	48.5	4.2e-71
WP_020851655.1|2453908_2454226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024749165.1|2454225_2454996_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.6	9.8e-30
WP_004091353.1|2455053_2455380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004091355.1|2455376_2455658_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.4	8.8e-13
WP_024749166.1|2456320_2456620_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	3.9e-19
WP_004085003.1|2456623_2456932_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.4e-16
WP_042836631.1|2457005_2458895_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.7	1.7e-22
WP_020852390.1|2459042_2459465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004087249.1|2459461_2459899_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	63.1	3.6e-45
WP_155244267.1|2462316_2462838_+	hypothetical protein	NA	C8CLG0	Xylella_phage	98.8	1.3e-97
WP_020851667.1|2462834_2463113_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	97.8	3.9e-45
WP_024749168.1|2463474_2463921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020852570.1|2464005_2465424_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	98.7	1.2e-275
WP_080702516.1|2465420_2465666_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	92.2	1.0e-33
WP_020852569.1|2465665_2466685_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	86.7	8.1e-165
WP_020852568.1|2466752_2468690_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.3	1.2e-68
WP_020852567.1|2468851_2471233_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.1	1.4e-10
WP_042836634.1|2472615_2474982_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.8	6.3e-11
WP_080566196.1|2475229_2475319_+|transposase	transposase	transposase	NA	NA	NA	NA
2485035:2485051	attR	ACCGATGCAAACGGCAA	NA	NA	NA	NA
>prophage 1
NZ_CP006697	Xylella fastidiosa subsp. sandyi Ann-1 plasmid unnamed1, complete sequence	30305	0	4656	30305	transposase	Lactobacillus_prophage(50.0%)	6	NA	NA
WP_020852265.1|73_1180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020852266.1|1227_1515_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_020852267.1|1686_2691_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_024748613.1|2749_3076_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	35.9	9.0e-09
WP_013087943.1|3072_3336_-	antitoxin	NA	NA	NA	NA	NA
WP_042836803.1|3447_4656_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	78.1	3.5e-183
>prophage 2
NZ_CP006697	Xylella fastidiosa subsp. sandyi Ann-1 plasmid unnamed1, complete sequence	30305	8416	12653	30305	transposase	Salmonella_phage(33.33%)	5	NA	NA
WP_042836805.1|8416_9631_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	72.5	7.1e-168
WP_024748685.1|9653_10067_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	8.9e-46
WP_024748686.1|10176_10401_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_020852248.1|10920_12024_-	Plasmid encoded RepA protein	NA	NA	NA	NA	NA
WP_020852249.1|12050_12653_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.5	4.6e-43
