The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	1316980	1372236	5441200	lysis,transposase,tail,portal,head,capsid,tRNA,terminase,integrase	Enterobacteria_phage(57.41%)	67	1313368:1313382	1341860:1341874
1313368:1313382	attL	CACGGTAATGATTAA	NA	NA	NA	NA
WP_000268555.1|1316980_1318036_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.9	1.2e-70
WP_000380881.1|1318047_1318383_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224590.1|1318395_1318809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835278.1|1319014_1319557_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	46.0	9.3e-35
WP_000133395.1|1319813_1320095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734671.1|1320271_1321732_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1321731_1322403_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1322572_1323943_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001295971.1|1323946_1324588_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001443105.1|1324623_1325730_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1325783_1326245_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000444487.1|1327080_1328331_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_024199376.1|1328444_1328858_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	99.3	2.9e-73
WP_085949154.1|1328902_1330050_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001066176.1|1330487_1331069_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000088199.1|1331085_1331358_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1331335_1331518_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1331794_1332547_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1332543_1333101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067727.1|1333918_1334134_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1334275_1334572_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1334604_1335504_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1335500_1336202_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1336198_1336489_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1336567_1337008_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1337004_1337532_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1337528_1337705_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1337707_1338049_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1338255_1338618_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1338614_1338755_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1338840_1339224_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1339412_1340495_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1341083_1341299_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1341298_1341796_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1342012_1342195_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
1341860:1341874	attR	TTAATCATTACCGTG	NA	NA	NA	NA
WP_001298464.1|1342285_1342579_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1343059_1343386_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1343592_1343775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839596.1|1345436_1345652_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1345651_1346149_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1346365_1346548_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1346638_1346932_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1347412_1347739_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1347945_1348128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1348690_1349239_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000867568.1|1350854_1351403_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001335577.1|1351374_1353303_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000258997.1|1353286_1353493_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1353489_1355082_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253913.1|1355071_1356577_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1356613_1356961_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1357018_1358047_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1358098_1358473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1358465_1358819_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1358830_1359409_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683101.1|1359405_1359801_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	5.5e-69
WP_001351266.1|1359808_1360549_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1360564_1360987_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1360968_1361403_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|1361395_1363957_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1363953_1364283_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1364282_1364981_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1364986_1365730_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1365666_1366299_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|1366359_1369842_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1369900_1371961_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1371957_1372236_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 2
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	1995679	2089511	5441200	protease,tail,holin,portal,tRNA,terminase	Enterobacteria_phage(25.81%)	103	NA	NA
WP_000984517.1|1995679_1996561_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055794.1|1996752_1998801_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431376.1|1998820_1999519_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001304298.1|2000247_2001531_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001327806.1|2001499_2004133_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001704100.1|2004212_2005652_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2005769_2006006_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001317886.1|2006110_2006302_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812743.1|2006302_2006959_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.0e-56
WP_000984819.1|2007353_2007695_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879311.1|2007707_2008580_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2008583_2008958_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2009096_2009327_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011644.1|2009429_2010086_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2010109_2010772_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000024725.1|2013037_2013697_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2014023_2014380_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2014446_2014737_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000800512.1|2016105_2016747_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069461.1|2016783_2018595_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2018829_2020305_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056695.1|2020642_2021512_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091149.1|2021639_2023082_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001304294.1|2023213_2024185_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2024303_2025626_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|2025641_2026574_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2026652_2027408_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|2027404_2028190_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|2028336_2029347_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2029355_2029967_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|2030105_2030171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024947.1|2030242_2030845_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2030846_2031368_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2031402_2032143_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077393227.1|2032171_2032624_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258675.1|2032616_2034389_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891621.1|2034698_2035265_+	hydrolase	NA	NA	NA	NA	NA
WP_024199385.1|2035866_2036256_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	3.9e-51
WP_000497431.1|2036334_2036577_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	80.5	2.4e-30
WP_157221658.1|2036702_2036993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001704105.1|2036994_2037438_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	72.1	9.2e-57
WP_001704106.1|2037409_2038003_-|tail	tail assembly chaperone	tail	K7P870	Enterobacteria_phage	63.0	1.7e-58
WP_021567253.1|2039440_2039674_+	hypothetical protein	NA	A0A0D4DAJ4	Escherichia_phage	96.1	1.3e-38
WP_001704108.1|2039705_2043632_-	DUF1983 domain-containing protein	NA	K7PMC2	Enterobacterial_phage	96.4	0.0e+00
WP_001704109.1|2043674_2044292_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.5	1.5e-105
WP_001704110.1|2044284_2045004_-	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	99.2	1.8e-142
WP_001704111.1|2045006_2045744_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	1.2e-146
WP_001704112.1|2045800_2046139_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_001704113.1|2046135_2049273_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	94.9	0.0e+00
WP_071605477.1|2049256_2049571_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	93.3	8.3e-52
WP_001704115.1|2049579_2050011_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	90.9	1.1e-65
WP_001704116.1|2050021_2050765_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	99.2	1.7e-132
WP_001704117.1|2050774_2051176_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_001704118.1|2051172_2051751_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	98.4	1.7e-95
WP_032315004.1|2051760_2052036_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	96.2	5.9e-38
WP_001704120.1|2052028_2052355_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	98.1	3.9e-52
WP_173400927.1|2052437_2054471_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.0	0.0e+00
WP_001704122.1|2054397_2055897_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	3.8e-288
WP_001704123.1|2055893_2056109_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
WP_001704124.1|2056105_2058208_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.7	0.0e+00
WP_001704125.1|2058207_2058696_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	100.0	3.1e-82
WP_000066210.1|2058879_2059608_-	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	98.3	4.1e-118
WP_001446080.1|2059782_2060013_-	hypothetical protein	NA	Q38201	Enterobacteria_phage	98.7	1.0e-38
WP_001446081.1|2060011_2060608_+	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_001704127.1|2060676_2060874_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	2.2e-26
WP_077249777.1|2061087_2061654_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	32.5	4.5e-08
WP_032315006.1|2061587_2062130_-	lysozyme	NA	K7PM52	Enterobacteria_phage	97.2	1.3e-100
WP_024199389.1|2062107_2062386_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_001704131.1|2062531_2063584_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	80.7	7.8e-171
WP_024199390.1|2063734_2063926_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	84.1	3.7e-23
WP_001704133.1|2064094_2064994_-	DUF114 domain-containing protein	NA	NA	NA	NA	NA
WP_001704134.1|2065006_2065213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001704136.1|2065645_2066335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199391.1|2066356_2067352_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.9	1.0e-143
WP_001704138.1|2067348_2068032_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.0	3.0e-62
WP_001704139.1|2068045_2068432_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	88.4	4.1e-61
WP_032315008.1|2068428_2069745_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.3	3.6e-117
WP_001704141.1|2069744_2070626_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	84.1	6.0e-31
WP_071840634.1|2070615_2070795_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	7.3e-13
WP_001704142.1|2070970_2071534_-	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	1.1e-06
WP_024195799.1|2071565_2071823_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
WP_032140310.1|2071892_2072612_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
WP_016240143.1|2072856_2073222_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	51.6	9.7e-12
WP_001704144.1|2073564_2074482_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.0	1.7e-105
WP_000120456.1|2074590_2075130_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.8	2.7e-66
WP_001253785.1|2075117_2075294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215602.1|2075290_2075545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126106.1|2075541_2075889_+	hypothetical protein	NA	A0A2H4A316	Salmonella_phage	65.5	3.5e-11
WP_000359354.1|2075890_2076199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210514.1|2076212_2076680_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	84.7	9.5e-44
WP_000492059.1|2076682_2076937_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	54.4	4.1e-17
WP_001704145.1|2076958_2077528_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	82.4	1.1e-91
WP_003839185.1|2077568_2077805_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	89.7	4.6e-39
WP_001704146.1|2077863_2079177_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.9	4.3e-235
WP_050557523.1|2079155_2079929_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2079981_2080377_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2080417_2081161_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564738.1|2081157_2082129_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176878.1|2082293_2084723_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214284.1|2084747_2085848_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2086235_2086982_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001304291.1|2086995_2087562_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2087777_2089511_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 3
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	2471724	2481169	5441200		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001305166.1|2471724_2472861_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	3.8e-163
WP_001327380.1|2472857_2474861_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.1	0.0e+00
WP_001296231.1|2474985_2475447_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2475487_2475958_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2476004_2476724_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2476720_2478406_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240404.1|2478627_2479359_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|2479418_2479526_+	protein YohO	NA	NA	NA	NA	NA
WP_000783150.1|2479506_2480238_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569381.1|2480242_2481169_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 4
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	3072570	3079710	5441200		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3072570_3075132_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141289.1|3075237_3075894_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001298167.1|3075944_3076712_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847998.1|3076907_3077816_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_000590418.1|3077812_3079075_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3079071_3079710_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 5
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	3312618	3367727	5441200	lysis,protease,transposase,tRNA,integrase	Acinetobacter_phage(28.57%)	48	3332556:3332571	3346697:3346712
WP_001327406.1|3312618_3313377_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3313580_3314501_-	agmatinase	NA	NA	NA	NA	NA
WP_000758911.1|3314636_3315368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3315513_3317490_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3317498_3317630_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3317765_3317981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3318284_3319439_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3319874_3321269_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3321345_3321843_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001327408.1|3321937_3322645_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3322724_3323456_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593261.1|3323468_3324419_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3324527_3325091_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3325090_3325507_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001327409.1|3325680_3326661_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3326678_3327383_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3327400_3327967_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3327963_3328254_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3328261_3328855_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239981.1|3328847_3329984_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745192.1|3330052_3331060_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394106.1|3331176_3332223_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3332398_3333118_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
3332556:3332571	attL	AATGGGTTACCGCCGC	NA	NA	NA	NA
WP_001107565.1|3333301_3333628_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|3333627_3334347_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001327411.1|3334507_3335560_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091699.1|3335587_3335863_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3335927_3337007_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|3337208_3338465_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839794.1|3338513_3340649_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|3341047_3341755_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3342133_3343399_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3343654_3344698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089643931.1|3345682_3346839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
3346697:3346712	attR	GCGGCGGTAACCCATT	NA	NA	NA	NA
WP_001171523.1|3346941_3347322_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3347318_3347666_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_071925535.1|3349465_3350017_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|3351215_3351437_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|3353304_3353418_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3355251_3355512_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3355553_3356114_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3356153_3356582_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000266542.1|3357134_3357350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529396.1|3357353_3357722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296383.1|3358012_3358255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199380.1|3359122_3361213_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000291745.1|3363211_3363793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3363839_3367727_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 6
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	3404902	3415468	5441200		Pseudomonas_phage(36.36%)	18	NA	NA
WP_038427155.1|3404902_3405724_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.4	1.5e-44
WP_001537423.1|3405986_3406460_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	9.7e-12
WP_001186170.1|3406475_3406952_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|3407014_3407236_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000094915.1|3407254_3407899_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	7.2e-26
WP_001285481.1|3407948_3408323_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854739.1|3408369_3408750_+	toxin	NA	NA	NA	NA	NA
WP_001355625.1|3409189_3409399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234620.1|3409811_3410630_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849565.1|3410684_3411170_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186726.1|3411185_3411662_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|3411724_3411946_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000902034.1|3412378_3412612_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|3412712_3413531_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849565.1|3413585_3414071_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186726.1|3414086_3414563_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|3414625_3414847_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_038427156.1|3414865_3415468_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	7.0e-23
>prophage 7
NZ_CP007799	Escherichia coli Nissle 1917 chromosome, complete genome	5441200	5252658	5353742	5441200	integrase,tRNA,transposase	Enterobacteria_phage(22.22%)	53	5244888:5244922	5378228:5378262
5244888:5244922	attL	TGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGC	NA	NA	NA	NA
WP_001219060.1|5252658_5253870_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	2.5e-160
WP_001172293.1|5255952_5256942_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000573634.1|5257814_5258768_+	HTH-type transcriptional regulator MetR	NA	NA	NA	NA	NA
WP_001196237.1|5258655_5259555_-	biotin transporter	NA	NA	NA	NA	NA
WP_038427212.1|5259630_5260416_-	sugar/pyridoxal phosphate phosphatase YigL	NA	NA	NA	NA	NA
WP_038427213.1|5261405_5262521_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.2	4.8e-86
WP_000007629.1|5262543_5262876_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000955028.1|5265143_5266088_+	transporter YfdV	NA	NA	NA	NA	NA
WP_000829498.1|5268095_5268830_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000070131.1|5270225_5271359_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000083138.1|5271699_5273610_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001261095.1|5273742_5274075_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_000085626.1|5275080_5275410_-	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_000190110.1|5275739_5276300_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000331917.1|5276313_5277159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145203.1|5277219_5277714_-	membrane protein	NA	NA	NA	NA	NA
WP_000749342.1|5277954_5278419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000594912.1|5279456_5280281_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000747102.1|5280679_5281030_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|5280949_5282101_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000581502.1|5284508_5284964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141584.1|5285064_5285274_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000362014.1|5286248_5286920_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_000860428.1|5286929_5288126_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001305352.1|5291235_5291442_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000782654.1|5291529_5292138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|5294670_5294928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038427219.1|5295729_5296296_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028102.1|5296306_5296801_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	5.5e-50
WP_001304753.1|5296821_5298150_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	6.3e-234
WP_001273658.1|5298232_5298406_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001190062.1|5299224_5299626_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_038427220.1|5299631_5300426_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.4	1.3e-16
WP_001136233.1|5300422_5301187_-	nickel import ATP-binding protein NikD	NA	NA	NA	NA	NA
WP_001008953.1|5301186_5302020_-	nickel ABC transporter permease subunit NikC	NA	NA	NA	NA	NA
WP_000692323.1|5303149_5303371_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186170.1|5303439_5303916_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855074.1|5303931_5304405_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	1.3e-11
WP_038427221.1|5304667_5305489_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	4.0e-45
WP_000884933.1|5308449_5309100_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_038427222.1|5310058_5311339_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.6e-21
WP_000183973.1|5311446_5312985_+	aldehyde dehydrogenase AldB	NA	NA	NA	NA	NA
WP_000893156.1|5313031_5313727_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_001296278.1|5322616_5322961_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000826499.1|5322962_5323355_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000695662.1|5323405_5324821_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001774069.1|5327142_5327694_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103103190.1|5329622_5330850_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000634338.1|5336408_5337125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000634338.1|5339695_5340412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140167.1|5349515_5350088_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000115885.1|5351014_5351533_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|5352521_5353742_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
5378228:5378262	attR	GCCGGATGCGGCGTGAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
