The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	639116	646601	4843789		Bacillus_virus(33.33%)	8	NA	NA
WP_008173705.1|639116_640091_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	51.1	8.5e-87
WP_036120829.1|640164_640917_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_036120826.1|640913_641645_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.4e-17
WP_036120824.1|641748_642249_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.4	1.1e-21
WP_036120821.1|642325_643627_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.0	6.9e-68
WP_012291989.1|643642_643984_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_036120816.1|644296_645757_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.9	6.5e-115
WP_036120813.1|645776_646601_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.8	2.9e-72
>prophage 2
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	683960	692371	4843789		Synechococcus_phage(33.33%)	8	NA	NA
WP_008173672.1|683960_685256_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.9	1.2e-16
WP_036120716.1|685385_686096_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	41.0	4.5e-45
WP_008173668.1|686098_686347_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_025115757.1|686349_687033_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_036120711.1|687019_689254_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.4e-156
WP_008173665.1|689229_690654_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.4e-52
WP_036120708.1|690746_691802_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.0	1.0e-61
WP_036120704.1|691801_692371_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	2.3e-23
>prophage 3
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	1181572	1190906	4843789	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_036119729.1|1181572_1182151_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	49.5	1.2e-43
WP_036119726.1|1182147_1183104_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	6.6e-60
WP_036119723.1|1183330_1184512_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	48.7	5.8e-106
WP_008176651.1|1184656_1185004_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036119720.1|1185061_1186804_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.1	1.0e-42
WP_036119717.1|1187166_1189584_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.9	0.0e+00
WP_036119714.1|1189724_1190906_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.4	2.1e-07
>prophage 4
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	2175012	2181048	4843789		Pneumococcus_phage(50.0%)	6	NA	NA
WP_036126327.1|2175012_2177367_-	S-layer homology domain-containing protein	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.2	1.1e-66
WP_036126325.1|2177986_2178487_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.2	2.2e-46
WP_036126322.1|2178606_2179266_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.6	2.4e-69
WP_036126320.1|2179268_2179742_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	70.9	8.6e-61
WP_036126318.1|2179734_2180463_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.0	3.7e-55
WP_036126316.1|2180508_2181048_+	VUT family protein	NA	E7DND6	Pneumococcus_phage	28.8	1.2e-05
>prophage 5
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	2210712	2252338	4843789	terminase,holin,integrase,plate,transposase,capsid	Aeribacillus_phage(25.81%)	57	2210492:2210551	2255046:2255179
2210492:2210551	attL	CCCAGTTAAATACATTTAAATACACTTAGTTAGATAGGTATAGAAACCCTTATAAAAACA	NA	NA	NA	NA
WP_042737456.1|2210712_2211891_-|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	24.8	1.4e-14
WP_036126267.1|2212029_2212530_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	35.2	4.9e-22
WP_036126265.1|2212612_2213464_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_036126263.1|2213520_2215293_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_036126260.1|2215447_2215813_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	35.5	2.0e-09
WP_036126257.1|2215957_2216179_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036126256.1|2216344_2216641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126254.1|2216861_2217137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036126252.1|2217124_2217391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126250.1|2217673_2217883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126249.1|2217879_2218110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042737457.1|2218178_2219072_+	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	67.4	7.7e-111
WP_042737458.1|2219088_2219826_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2P1JU03	Anoxybacillus_phage	61.9	3.8e-87
WP_036126246.1|2220571_2221120_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_036126242.1|2221642_2221843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126240.1|2221820_2222435_+	dUTP diphosphatase	NA	A0A290GJJ6	Caldibacillus_phage	44.5	1.6e-35
WP_036126237.1|2222434_2222620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126234.1|2222697_2223513_+	DNA adenine methylase	NA	R4IBV6	Listeria_phage	57.6	4.6e-86
WP_036126230.1|2223523_2223940_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	54.5	7.1e-35
WP_036126226.1|2224269_2224986_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_036128023.1|2225395_2225728_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	38.3	2.7e-13
WP_036126224.1|2225826_2226825_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_052323601.1|2226915_2227953_+	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	45.7	3.5e-22
WP_036126222.1|2228478_2229048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126219.1|2229221_2230079_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_036126217.1|2230284_2230518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126215.1|2230544_2231081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126213.1|2231181_2231937_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	37.7	1.9e-30
WP_042737459.1|2231936_2233226_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.7	8.4e-151
WP_052323600.1|2234526_2235306_+|capsid	minor capsid protein	capsid	A8ATG2	Listeria_phage	40.3	3.0e-50
WP_042737460.1|2235354_2236143_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_036126211.1|2236186_2237266_+	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	55.0	4.7e-78
WP_036126210.1|2237277_2237724_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_144422608.1|2237744_2238644_+	encapsulin	NA	A8ATG6	Listeria_phage	47.5	3.5e-71
WP_036126207.1|2238658_2238970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126205.1|2238981_2239341_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_082011623.1|2239357_2239807_+	hypothetical protein	NA	A8ATG9	Listeria_phage	30.8	7.7e-19
WP_036126202.1|2239806_2240169_+	hypothetical protein	NA	A0A1L2JY57	Aeribacillus_phage	43.4	2.1e-22
WP_052323598.1|2240161_2240638_+	hypothetical protein	NA	A0A2D1GQ35	Lysinibacillus_phage	32.4	4.1e-10
WP_036126199.1|2240637_2241648_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	47.9	1.0e-79
WP_036126196.1|2241660_2242065_+	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	54.6	4.4e-29
WP_036128002.1|2242165_2242435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126193.1|2242613_2242838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126189.1|2244495_2244816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052323596.1|2244818_2245310_+	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	37.8	3.9e-16
WP_036126187.1|2245418_2245742_+	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	55.3	1.7e-23
WP_036126184.1|2245734_2246535_+	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	46.5	2.5e-60
WP_042737461.1|2246531_2246909_+	hypothetical protein	NA	A0A1L2JY64	Aeribacillus_phage	29.8	3.2e-10
WP_036126182.1|2246908_2247262_+	hypothetical protein	NA	E5DV62	Deep-sea_thermophilic_phage	37.6	3.2e-12
WP_144422583.1|2247594_2248958_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	65.2	6.3e-96
WP_158499490.1|2248986_2249883_+|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	46.8	2.1e-63
WP_036126179.1|2249875_2250517_+	DUF2612 domain-containing protein	NA	A0A1L2JZ80	Aeribacillus_phage	51.2	9.6e-55
WP_036126177.1|2250528_2250726_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	58.7	4.4e-11
WP_158499491.1|2250809_2250983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126176.1|2251124_2251373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036126175.1|2251385_2251640_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	56.4	1.3e-18
WP_052323603.1|2251639_2252338_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L2JY70	Aeribacillus_phage	42.2	4.7e-39
2255046:2255179	attR	CCCAGTTAAATACATTTAAATACACTTAGTTAGATAGGTATAGAAACCCTTATAAAAACAAACCCTTTTTATTATGCACATCAAAAAATTAAAAACATCAGGATAGCAACCAAGGTCATAAGTTATGCTTATCA	NA	NA	NA	NA
>prophage 6
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	3338976	3401278	4843789	protease,tail,holin,integrase,transposase	Bacillus_virus(34.78%)	57	3332103:3332122	3405710:3405729
3332103:3332122	attL	GTGCCAACATTTCCATAATG	NA	NA	NA	NA
WP_036121761.1|3338976_3340557_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	50.2	4.7e-143
WP_036124564.1|3340718_3341855_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_036124562.1|3341957_3342632_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036124560.1|3342728_3343388_-	flagellar brake domain-containing protein	NA	NA	NA	NA	NA
WP_036124559.1|3343474_3344758_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_008180429.1|3344773_3345607_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	41.9	6.2e-22
WP_036124557.1|3345696_3346377_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_036124554.1|3346461_3347430_+	asparaginase	NA	NA	NA	NA	NA
WP_036124552.1|3349004_3349565_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_036124550.1|3349622_3350588_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_036124548.1|3350701_3351457_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_036124547.1|3351603_3352332_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036124546.1|3352418_3353861_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.3	2.7e-57
WP_036124544.1|3353861_3354890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004232564.1|3354996_3355245_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	50.7	5.8e-16
WP_036127741.1|3355389_3355983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080709378.1|3356131_3356914_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082011538.1|3357166_3357895_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_036124543.1|3357913_3359116_-	MFS transporter	NA	NA	NA	NA	NA
WP_025117432.1|3359408_3360233_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_036124542.1|3360248_3360794_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036124540.1|3360833_3362387_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	29.2	8.7e-09
WP_008174302.1|3362402_3362933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036124538.1|3363140_3363320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036124537.1|3363371_3363617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155269843.1|3363651_3363825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036124535.1|3363886_3364351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036124533.1|3364500_3365487_-|integrase	site-specific integrase	integrase	A0A1P8CWX4	Bacillus_phage	24.5	2.7e-16
WP_036124531.1|3365497_3366814_-	hypothetical protein	NA	A0A0H3UZ06	Geobacillus_virus	29.0	8.3e-45
WP_036124529.1|3367041_3367545_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_036124527.1|3367621_3368101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124525.1|3368364_3368907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124523.1|3368903_3369659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124521.1|3369693_3370692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124519.1|3370760_3371252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124517.1|3371422_3377821_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0H3V0Q1	Geobacillus_virus	22.3	1.8e-12
WP_036124515.1|3377820_3378417_+|tail	phage tail family protein	tail	A0A0K2FMB9	Brevibacillus_phage	44.7	1.9e-41
WP_036124513.1|3378417_3379074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124511.1|3379085_3379724_+	hypothetical protein	NA	A0A0K2FM10	Brevibacillus_phage	36.3	6.7e-32
WP_036124510.1|3379735_3383548_+|tail	phage tail protein	tail	A0A0K2FLF6	Brevibacillus_phage	34.1	2.4e-246
WP_082011539.1|3383802_3384045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124507.1|3384072_3385221_+	hypothetical protein	NA	A0A0K2FMC4	Brevibacillus_phage	39.1	6.3e-81
WP_036124505.1|3385287_3386037_+	hypothetical protein	NA	G3MAA2	Bacillus_virus	34.4	1.3e-07
WP_036124504.1|3386161_3386761_+	hypothetical protein	NA	G3MAA3	Bacillus_virus	38.9	2.9e-37
WP_144422596.1|3386779_3387121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036124500.1|3387138_3388212_+	hypothetical protein	NA	G3MAA4	Bacillus_virus	34.8	1.3e-48
WP_036124498.1|3388212_3389379_+	discoidin domain-containing protein	NA	G3MAA5	Bacillus_virus	30.7	3.4e-26
WP_036124496.1|3389378_3390719_+	LamG domain-containing protein	NA	G3MAA5	Bacillus_virus	43.4	9.1e-07
WP_036124494.1|3390719_3392168_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_036124492.1|3392186_3393536_+	discoidin domain-containing protein	NA	G3MAA5	Bacillus_virus	32.9	9.2e-15
WP_036124491.1|3393581_3394355_+	hypothetical protein	NA	G3MAA5	Bacillus_virus	35.1	1.5e-25
WP_052323437.1|3394357_3395704_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_036124490.1|3395748_3398058_+	hypothetical protein	NA	G3MAA7	Bacillus_virus	48.1	1.2e-115
WP_036124488.1|3398089_3400015_+	DNRLRE domain-containing protein	NA	A0A0K2FM25	Brevibacillus_phage	28.9	1.8e-40
WP_052323439.1|3400036_3400486_+	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	37.7	9.8e-14
WP_036124486.1|3400478_3400979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144422617.1|3401002_3401278_+|holin	phage holin	holin	A0A142F1N6	Bacillus_phage	54.4	3.5e-22
3405710:3405729	attR	GTGCCAACATTTCCATAATG	NA	NA	NA	NA
>prophage 7
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	4123949	4167272	4843789	protease,tail,terminase,holin,head,portal,capsid	Bacillus_phage(23.68%)	56	NA	NA
WP_036123287.1|4123949_4124486_-	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	69.7	4.0e-22
WP_036123284.1|4124486_4125086_-	replication-relaxation family protein	NA	A0A1S5QTS6	Bacillus_phage	49.7	2.1e-48
WP_082011572.1|4125027_4126215_-	cell division protein FtsK	NA	A0A2H4J9G1	uncultured_Caudovirales_phage	58.5	1.3e-126
WP_082011571.1|4126765_4127602_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036123276.1|4127826_4128030_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	48.5	7.8e-11
WP_036123273.1|4128118_4128538_+	hypothetical protein	NA	Q4ZCB6	Staphylococcus_virus	40.5	1.5e-19
WP_158499497.1|4128681_4128822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036123270.1|4129039_4129291_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	44.9	2.8e-10
WP_036123267.1|4129313_4129670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123263.1|4130455_4130716_-|holin	phage holin	holin	A0A1Q1PVX5	Staphylococcus_phage	54.9	4.5e-19
WP_036123261.1|4130717_4130915_-	hemolysin XhlA family protein	NA	A6M968	Geobacillus_virus	64.8	9.2e-17
WP_036123258.1|4131016_4131196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158499498.1|4131244_4131394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123255.1|4131395_4131623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123252.1|4133159_4134272_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	D2J072	Enterococcus_phage	28.5	7.8e-28
WP_052323513.1|4134274_4135165_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_052323512.1|4135176_4140348_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	50.2	3.2e-84
WP_036123246.1|4140938_4141523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052323511.1|4141542_4141887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123242.1|4141883_4142303_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_036123239.1|4142303_4142639_-|head	phage head closure protein	head	A0A0U4JE41	Bacillus_phage	32.2	2.4e-09
WP_052323510.1|4142616_4142949_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	38.8	5.0e-07
WP_036123237.1|4142948_4143182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082011563.1|4143225_4144464_-|capsid	phage major capsid protein	capsid	A0A0C5AEH1	Paenibacillus_phage	64.6	4.5e-133
WP_036123236.1|4144482_4145235_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	66.0	7.2e-86
WP_036127605.1|4145227_4146430_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	63.4	1.1e-147
WP_036123232.1|4146481_4148185_-|terminase	terminase large subunit	terminase	Q2LII3	Bacillus_virus	63.5	1.2e-208
WP_036123229.1|4148181_4148700_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	59.5	5.9e-47
WP_036123225.1|4148829_4149210_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.4	2.5e-34
WP_052323509.1|4149202_4149517_-	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	37.7	9.6e-08
WP_052323508.1|4149518_4150082_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	60.8	1.3e-10
WP_158499499.1|4150341_4150515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123223.1|4150627_4150834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123221.1|4151073_4151475_-	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	59.2	3.9e-38
WP_052323507.1|4151511_4152477_-	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.0	1.8e-113
WP_036123219.1|4152504_4152855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123214.1|4153078_4153618_-	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	61.0	2.7e-58
WP_036123211.1|4153614_4154046_-	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	29.9	1.8e-09
WP_036123208.1|4154155_4154584_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	47.9	2.1e-37
WP_036123205.1|4154903_4157276_-	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	74.5	0.0e+00
WP_036123202.1|4157280_4157490_-	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	52.7	5.5e-12
WP_036123200.1|4157570_4158050_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	49.1	8.2e-35
WP_036123197.1|4158049_4158766_-	AAA family ATPase	NA	A8ATF0	Listeria_phage	50.0	4.2e-59
WP_036123191.1|4159132_4159477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052323505.1|4159490_4159991_-	siphovirus Gp157 family protein	NA	B6CXH7	Clostridium_phage	33.1	4.1e-13
WP_036123188.1|4159987_4160833_-	hypothetical protein	NA	A0A2H4J2J8	uncultured_Caudovirales_phage	47.4	2.8e-17
WP_036123186.1|4160829_4161009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123183.1|4161017_4161287_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	60.3	1.1e-15
WP_036123180.1|4161283_4161742_-	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	30.2	7.2e-12
WP_036123177.1|4161779_4162031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052323503.1|4162264_4163050_-	hypothetical protein	NA	A0A2H4J989	uncultured_Caudovirales_phage	32.6	1.0e-21
WP_036123175.1|4163097_4163346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036123171.1|4163393_4163642_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	69.7	5.9e-21
WP_036127586.1|4163820_4164435_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	60.5	5.7e-65
WP_036123169.1|4164506_4165898_+	recombinase family protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	46.5	6.8e-106
WP_008178870.1|4166429_4167272_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	44.2	1.8e-21
>prophage 8
NZ_CP010820	Lysinibacillus fusiformis strain RB-21 chromosome, complete genome	4843789	4480658	4517522	4843789	protease,tail,terminase,holin,integrase,plate,head,portal,capsid	uncultured_Caudovirales_phage(23.68%)	57	4480118:4480174	4517672:4517728
4480118:4480174	attL	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTTA	NA	NA	NA	NA
WP_036122616.1|4480658_4481546_-	helix-turn-helix domain-containing protein	NA	S5M5V5	Brevibacillus_phage	29.1	1.3e-06
WP_052323447.1|4481737_4481959_+	helix-turn-helix transcriptional regulator	NA	L0L8F4	Bacillus_phage	46.2	1.7e-06
WP_036122609.1|4482043_4482565_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	28.8	3.3e-05
WP_036122606.1|4482659_4482875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158499502.1|4482954_4483101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082011548.1|4483396_4483702_-	aconitate hydratase	NA	NA	NA	NA	NA
WP_036122602.1|4483746_4483971_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_036122598.1|4484097_4484766_-	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	58.6	5.3e-72
WP_036122595.1|4484762_4485020_-|holin	phage holin	holin	A0A2H4IZQ3	uncultured_Caudovirales_phage	48.8	4.9e-18
WP_036122592.1|4485035_4485308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122589.1|4485361_4486138_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	61.0	4.4e-78
WP_052323449.1|4486385_4486793_-	hypothetical protein	NA	A0A090EUF8	Clostridium_phage	56.9	1.5e-13
WP_036122588.1|4486807_4488463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052323451.1|4488462_4489281_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_052323452.1|4489291_4489639_-	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	35.1	3.4e-06
WP_036122584.1|4489635_4490676_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	35.7	1.5e-52
WP_052323454.1|4490676_4491123_-	DUF2634 domain-containing protein	NA	J9QEB8	Clostridium_phage	33.9	7.7e-11
WP_036122581.1|4491112_4491394_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_144422600.1|4491394_4492375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122575.1|4492371_4492794_-	hypothetical protein	NA	A0A0A8WJR4	Clostridium_phage	32.1	3.1e-17
WP_052323456.1|4492806_4494831_-|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	44.2	2.2e-68
WP_036122574.1|4495036_4495429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122571.1|4495453_4495888_-|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	34.8	2.3e-12
WP_036122569.1|4495900_4496956_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A8WJR2	Clostridium_phage	47.7	4.4e-81
WP_036122567.1|4496959_4497436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052323458.1|4497432_4497861_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_036122565.1|4497857_4498187_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_036122562.1|4498196_4498487_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U3PCS3	Lactobacillus_phage	41.1	1.2e-09
WP_158499503.1|4498476_4498632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042737485.1|4498670_4499840_-|capsid	phage major capsid protein	capsid	F7V9A6	Lactobacillus_virus	51.7	2.8e-105
WP_036122560.1|4499841_4500447_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	69.7	2.1e-64
WP_036122557.1|4500436_4501690_-|portal	phage portal protein	portal	A0A075KQ80	Lactobacillus_phage	48.5	5.6e-99
WP_036122555.1|4501702_4503382_-|terminase	terminase	terminase	A0A0A7RUM0	Clostridium_phage	43.3	1.3e-122
WP_025114154.1|4503378_4503840_-|terminase	P27 family phage terminase small subunit	terminase	A0A0A7RUQ4	Clostridium_phage	64.1	4.3e-49
WP_036122550.1|4503915_4504314_-	HNH endonuclease	NA	A0A0D4DD69	Staphylococcus_phage	36.9	2.1e-07
WP_036122548.1|4504380_4504566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122545.1|4504689_4505205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122543.1|4505710_4506151_-	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	62.2	6.2e-45
WP_036122541.1|4506207_4506657_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	36.9	2.9e-10
WP_036122538.1|4506649_4507228_-	hypothetical protein	NA	A0A2H4J564	uncultured_Caudovirales_phage	59.7	1.1e-57
WP_036122535.1|4507249_4507603_-	hypothetical protein	NA	U5PTZ8	Bacillus_phage	62.6	1.2e-35
WP_144422619.1|4507635_4508925_-	AAA family ATPase	NA	A0A2H4J268	uncultured_Caudovirales_phage	57.9	1.7e-135
WP_082011546.1|4508893_4509661_-	replication protein	NA	A0A0C5AN15	Bacteriophage	53.8	4.0e-39
WP_036122531.1|4509676_4509904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122526.1|4509903_4510647_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	63.2	7.9e-85
WP_052323460.1|4510792_4511671_-	recombinase RecT	NA	A0A2H4JA23	uncultured_Caudovirales_phage	68.1	9.3e-109
WP_036122523.1|4511673_4511868_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	58.9	1.0e-12
WP_036122520.1|4511864_4513373_-	AAA family ATPase	NA	A0A2H4J9G9	uncultured_Caudovirales_phage	60.6	6.4e-142
WP_036122518.1|4513532_4513802_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	66.7	1.6e-16
WP_036122514.1|4513801_4514146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036122511.1|4514150_4514453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036127532.1|4514449_4514635_-	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	59.6	7.1e-11
WP_036122508.1|4514685_4514871_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	58.8	7.8e-10
WP_036122505.1|4514884_4515130_-	DNA-binding protein	NA	A6M975	Geobacillus_virus	63.2	1.5e-13
WP_042737486.1|4515334_4515793_+	helix-turn-helix transcriptional regulator	NA	A6XML9	Bacillus_virus	50.0	1.3e-21
WP_082011549.1|4515882_4516257_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	53.5	1.9e-26
WP_036122501.1|4516331_4517522_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	41.4	2.0e-77
4517672:4517728	attR	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTTA	NA	NA	NA	NA
