The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	247636	296320	4718545	integrase,transposase	Streptococcus_phage(20.0%)	49	262122:262181	296430:296489
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250041_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253466_253733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253665_254202_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257828_258230_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258268_259324_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259611_260715_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260726_261980_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262122:262181	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262551_262893_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262913_263231_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263249_263471_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263479_263956_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263971_264430_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264527_264767_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264843_265311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265333_265777_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265776_266004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266407_267229_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267320_268184_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268512_269406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269826_270978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273324_274341_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274548_275952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275938_276871_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276979_278026_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279247_279586_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279608_279959_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280052_281207_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281501_282410_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282424_284392_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284618_286001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286012_287623_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287627_288386_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288524_289529_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290723_291455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291545_292172_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292443_293142_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293168_294023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294141_294366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294362_294803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294919_296320_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296430:296489	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	518169	581128	4718545	protease,integrase,tRNA,terminase,transposase,lysis	Enterobacteria_phage(50.0%)	66	563786:563832	585088:585134
WP_001295836.1|518169_518793_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518763_519450_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|519446_521861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|522291_526572_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|526611_526980_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|527670_527931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|529162_530257_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530325_531252_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531481_531964_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|532041_532857_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|532946_534728_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534740_535517_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535616_536495_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536663_538118_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|538177_539539_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539595_540897_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|540918_542064_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|542291_543077_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|543087_544323_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544344_545394_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545710_547378_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|547387_548647_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548657_549473_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549469_550363_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550557_551625_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551621_552131_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552248_552971_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|552973_553468_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553641_555027_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|555062_555584_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555691_555904_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|555905_556772_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|557242_557785_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558004_558697_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558727_561331_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561309_562350_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562360_562876_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|562878_563511_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563786:563832	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|563845_565009_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565128_565392_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565714_565810_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|565872_566172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|566168_567035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|567345_567678_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567725_567875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|567932_569459_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|569923_570475_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570484_571282_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571398_571500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571496_571952_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|571951_572122_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572114_572405_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572401_572764_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572760_572901_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|572986_573370_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|573767_574784_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|574788_575856_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|576428_576644_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|576643_577141_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|577357_577540_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|577630_577924_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|578214_578625_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|578910_579117_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579281_579476_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|579864_580410_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580384_581128_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
585088:585134	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	1378703	1412175	4718545	integrase,tRNA,tail,transposase,lysis	Escherichia_phage(46.67%)	36	1379850:1379866	1402881:1402897
WP_010723085.1|1378703_1379720_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1379850:1379866	attL	GCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_000885458.1|1380022_1380931_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1381260_1381824_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1381844_1383077_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1383331_1384315_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1384792_1386166_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1386294_1387230_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1387281_1388517_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1388518_1388734_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1388812_1389022_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1389014_1389209_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1389265_1390075_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1390067_1392668_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1392769_1393045_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1393119_1393290_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1393289_1393511_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1393952_1394441_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1394437_1394593_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1395046_1395523_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1395646_1395943_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1395965_1396388_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1396400_1397258_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1397264_1398011_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1398033_1398594_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1398681_1398867_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1399063_1400521_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1400658_1400922_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1400902_1401262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1403027_1404008_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1402881:1402897	attR	GGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1404330_1407693_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1407692_1408268_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1408365_1408956_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1409272_1409506_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1409574_1409688_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1410466_1410901_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1411041_1412175_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	1604734	1623945	4718545	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1604734_1606195_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1606283_1607567_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1608171_1608285_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1608353_1608587_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1608903_1609494_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1609591_1610167_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1610166_1611129_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1611079_1611649_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1612037_1612271_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1612328_1612739_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1612890_1613064_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1613235_1613391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1613469_1613535_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1613537_1613726_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1613736_1613949_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1614311_1614809_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1614805_1615339_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1615335_1615647_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1615651_1615867_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1616620_1616836_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1617136_1617349_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1617403_1617493_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1617770_1618523_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1618536_1619586_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1619587_1619866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1619932_1620184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1620400_1620556_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1620627_1620915_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1620914_1621154_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1621178_1621484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1621686_1622019_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1622455_1622605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1622901_1623132_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1623215_1623623_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1623789_1623945_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	2082930	2091601	4718545		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2082930_2084034_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2084041_2085289_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2085285_2085843_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2085842_2086724_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2086781_2087681_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2087680_2088766_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2089138_2090032_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2090206_2091601_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	2441002	2453032	4718545	tail	Enterobacteria_phage(41.18%)	18	NA	NA
WP_000368140.1|2441002_2441935_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_038430632.1|2442354_2443071_-	hypothetical protein	NA	B9U1C3	Vaccinia_virus	97.1	7.2e-136
WP_000412211.1|2443374_2444034_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000915541.1|2444376_2444739_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2444735_2445656_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2445652_2446984_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2447018_2447300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2447598_2448039_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2448065_2448584_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2448633_2448909_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2448908_2449403_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2449399_2449768_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2450125_2450488_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2450553_2451378_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2451505_2452042_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2452032_2452395_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2452394_2452700_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2452831_2453032_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 7
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	2833614	2840753	4718545		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2833614_2836176_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2836281_2836938_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2836988_2837786_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2837951_2838860_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2838856_2840023_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2840114_2840753_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
NZ_CP008801	Escherichia coli KLY chromosome, complete genome	4718545	3048521	3074661	4718545	tRNA,transposase	Acinetobacter_phage(33.33%)	22	NA	NA
WP_000911324.1|3048521_3048920_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450532.1|3048919_3049147_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000987005.1|3049228_3054499_+	conjugative transfer relaxase/helicase TraI	NA	V5UQN3	Mycobacterium_phage	31.5	2.8e-06
WP_000205776.1|3054518_3055265_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_000169527.1|3055780_3056080_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3056076_3056943_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001345829.1|3057275_3057464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802277.1|3057928_3058240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|3058640_3058790_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083834.1|3059073_3059331_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|3059564_3059639_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000422420.1|3060017_3062114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235704.1|3062129_3062681_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_001143750.1|3062844_3065853_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|3066443_3067505_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|3067614_3068028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|3068191_3068656_-	membrane protein	NA	NA	NA	NA	NA
WP_000483319.1|3068761_3069175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131420.1|3069777_3069966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|3070872_3071172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001443048.1|3071168_3072035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.3e-50
WP_085947917.1|3073387_3074661_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
