The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008852	Pelosinus sp. UFO1 chromosome, complete genome	5115410	1229027	1238241	5115410		Synechococcus_phage(28.57%)	9	NA	NA
WP_038668824.1|1229027_1229999_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.0	1.6e-53
WP_038668826.1|1230014_1230551_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_038668828.1|1230629_1231445_-	alpha-1,2-fucosyltransferase	NA	E3SJA0	Synechococcus_phage	38.2	3.2e-39
WP_084159924.1|1231456_1232623_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A218MN59	uncultured_virus	29.9	4.2e-40
WP_051788837.1|1232594_1233578_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	55.0	5.0e-95
WP_038668832.1|1233915_1234500_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	38.7	1.2e-27
WP_038668834.1|1234499_1235477_-	GHMP kinase	NA	A0A067XQL1	Caulobacter_phage	41.5	5.6e-54
WP_038668837.1|1235451_1236168_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_051788838.1|1236444_1238241_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	36.4	2.4e-10
>prophage 2
NZ_CP008852	Pelosinus sp. UFO1 chromosome, complete genome	5115410	1458703	1471432	5115410		Synechococcus_phage(18.18%)	13	NA	NA
WP_038669342.1|1458703_1459330_+	sulfur carrier protein ThiS adenylyltransferase ThiF	NA	A0A1V0SCZ9	Indivirus	38.2	5.6e-07
WP_038669345.1|1459364_1460015_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_038669348.1|1460011_1461310_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_038669352.1|1461363_1461687_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	34.0	1.5e-11
WP_038669355.1|1461694_1462645_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.5	4.0e-73
WP_038669358.1|1462897_1463560_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.1	1.4e-29
WP_038669361.1|1464063_1465431_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.2	1.6e-51
WP_038669365.1|1465569_1466061_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.9	2.5e-23
WP_038669368.1|1466080_1466791_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SYW1	Cyanophage	40.9	3.7e-39
WP_038669371.1|1466787_1468224_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.0	2.1e-62
WP_038669374.1|1468220_1469270_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	42.8	3.9e-69
WP_038669377.1|1469262_1469871_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.7	9.8e-25
WP_038669380.1|1469890_1471432_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	2.4e-75
>prophage 3
NZ_CP008852	Pelosinus sp. UFO1 chromosome, complete genome	5115410	1854049	1911225	5115410	portal,terminase,head,capsid,tail,plate,transposase,integrase,protease,tRNA	Vibrio_phage(33.33%)	75	1858384:1858430	1905606:1905652
WP_038670016.1|1854049_1855261_-|tRNA	Ser-tRNA(Ala) deacylase AlaX	tRNA	NA	NA	NA	NA
WP_038670017.1|1855369_1856077_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_038670018.1|1856310_1856901_+	peptidoglycan-binding protein	NA	A0A142F1E5	Bacillus_phage	46.9	5.6e-17
WP_038670019.1|1857040_1857490_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038670020.1|1857666_1858206_+	hypothetical protein	NA	NA	NA	NA	NA
1858384:1858430	attL	CGTTGACATCGAAGAGGTCTGCGGTTCGAGTCCGCCTAACCCCACCA	NA	NA	NA	NA
WP_038670021.1|1858551_1859760_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_038670022.1|1859825_1860245_-	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	52.9	3.6e-34
WP_144390929.1|1860266_1860662_-	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	42.7	2.9e-17
WP_144390930.1|1860927_1861086_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_038670025.1|1861143_1861395_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038670026.1|1861755_1862505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144390931.1|1862627_1862822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173406213.1|1863037_1863184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670028.1|1863899_1864172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670029.1|1864168_1864402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158442783.1|1864518_1864695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051788864.1|1865152_1866220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670030.1|1866134_1866530_+	single-stranded DNA-binding protein	NA	E2ELN0	Clostridium_phage	45.2	5.4e-24
WP_038670031.1|1866631_1867141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670032.1|1867263_1867767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670033.1|1867878_1868442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670034.1|1868459_1868972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670035.1|1869036_1869264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670036.1|1869357_1869813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670037.1|1869925_1871221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051788865.1|1871486_1872047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670038.1|1872227_1872806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670039.1|1872983_1873340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670040.1|1873503_1873716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670041.1|1873768_1874170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144390873.1|1874249_1874924_+	DUF4145 domain-containing protein	NA	A0A1L2JZ52	Aeribacillus_phage	41.3	6.1e-44
WP_038670043.1|1875043_1875388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670044.1|1876119_1876812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670045.1|1876982_1877567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670046.1|1877699_1878632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051788866.1|1878798_1879692_+	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	30.1	3.8e-17
WP_144390875.1|1879717_1880059_+	hypothetical protein	NA	S5MUD8	Brevibacillus_phage	42.7	4.7e-08
WP_038670048.1|1880255_1880795_+	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	41.7	8.4e-20
WP_071841997.1|1880769_1882659_+|terminase	phage terminase large subunit family protein	terminase	A0A067ZJA1	Vibrio_phage	42.4	4.4e-140
WP_038670049.1|1882674_1882896_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	43.1	9.4e-10
WP_038670050.1|1882888_1884466_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	57.5	1.4e-163
WP_051788868.1|1884452_1885556_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	39.4	1.4e-56
WP_038670051.1|1885555_1885927_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	50.4	6.2e-22
WP_038670052.1|1885941_1886985_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	38.6	3.0e-66
WP_038670053.1|1886997_1887300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051788869.1|1887296_1887857_+|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	48.1	6.0e-37
WP_038670054.1|1887853_1888339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051788870.1|1888307_1888607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670055.1|1888608_1890069_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	54.5	1.8e-157
WP_038670056.1|1890083_1890614_+|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	40.8	5.5e-32
WP_051788871.1|1890636_1890945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670057.1|1891072_1893244_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	31.2	1.8e-57
WP_038670058.1|1893236_1893449_+|tail	tail protein X	tail	A0A2K9V482	Faecalibacterium_phage	50.0	1.9e-12
WP_038670059.1|1893445_1894468_+	hypothetical protein	NA	A0A0C5AJ59	Bacteriophage	37.3	9.6e-57
WP_038670060.1|1894467_1894950_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	38.7	5.8e-20
WP_051788872.1|1894960_1895503_+|tail	phage tail protein	tail	A0A067ZI88	Vibrio_phage	32.3	7.7e-13
WP_051788873.1|1895506_1895827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670061.1|1895819_1896938_+|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	50.4	8.5e-91
WP_038670062.1|1896934_1897573_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.5	1.3e-32
WP_051788874.1|1897585_1899655_+|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	38.8	2.6e-16
WP_038670063.1|1899668_1900211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051789102.1|1900440_1900668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670065.1|1900668_1901007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071842069.1|1901013_1901574_+	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	28.3	2.0e-11
WP_038670067.1|1901585_1902125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670068.1|1902362_1903433_+	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	26.9	2.3e-05
WP_038670069.1|1903794_1904034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670070.1|1904222_1904993_+	radical SAM protein	NA	NA	NA	NA	NA
WP_144390876.1|1905105_1905372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670071.1|1906133_1906571_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1905606:1905652	attR	CGTTGACATCGAAGAGGTCTGCGGTTCGAGTCCGCCTAACCCCACCA	NA	NA	NA	NA
WP_038670072.1|1906631_1907489_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_084159927.1|1907613_1907769_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_158442784.1|1908202_1908370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038675040.1|1908673_1908946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670074.1|1911000_1911225_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP008852	Pelosinus sp. UFO1 chromosome, complete genome	5115410	2594554	2602673	5115410	tail	Paracoccus_phage(50.0%)	6	NA	NA
WP_051788922.1|2594554_2594899_-	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	52.8	2.5e-25
WP_038671145.1|2594898_2597394_-	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	29.5	2.3e-64
WP_038671147.1|2597393_2597834_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	36.1	1.5e-19
WP_038671149.1|2597830_2598694_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	37.4	6.2e-41
WP_051788923.1|2598690_2599329_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	37.7	9.9e-36
WP_038671151.1|2599328_2602673_-|tail	phage tail tape measure protein	tail	A0A2H4JC10	uncultured_Caudovirales_phage	71.4	5.4e-08
>prophage 5
NZ_CP008852	Pelosinus sp. UFO1 chromosome, complete genome	5115410	4399656	4405195	5115410		Escherichia_phage(50.0%)	6	NA	NA
WP_038673902.1|4399656_4400190_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	6.7e-54
WP_038673903.1|4400189_4401074_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.9	7.4e-98
WP_038673904.1|4401073_4402141_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.3	1.9e-84
WP_038673905.1|4402182_4403022_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	37.6	4.3e-39
WP_051789040.1|4403149_4404073_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.8	2.5e-11
WP_038673906.1|4404100_4405195_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.3	1.9e-34
