The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008885	Bifidobacterium longum strain BXY01, complete genome	2480603	369506	435835	2480603	protease,transposase,tRNA	Thermus_phage(15.38%)	57	NA	NA
WP_080515120.1|369506_370538_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013140179.1|370576_371374_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_080515121.1|371453_372926_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_013140181.1|373005_373737_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013140182.1|373827_375330_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_038426104.1|375555_376089_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	38.3	5.4e-19
WP_007057690.1|376571_376739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515122.1|377418_378579_-|transposase	IS256-like element ISBlo16 family transposase	transposase	NA	NA	NA	NA
WP_007057699.1|378956_379181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515123.1|379594_379804_-	Vacuole effluxer Atg22 like protein	NA	NA	NA	NA	NA
WP_007054783.1|380043_380208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140188.1|380204_380390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140189.1|380768_381839_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003829805.1|381857_382046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013140191.1|382305_382629_+	translation repressor RelB	NA	NA	NA	NA	NA
WP_106629662.1|382777_383008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140193.1|383186_383930_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013140194.1|384110_385388_-	MFS transporter	NA	NA	NA	NA	NA
WP_013140195.1|385611_386628_-	sugar kinase	NA	NA	NA	NA	NA
WP_007051452.1|386998_387193_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_013140196.1|387292_389926_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_013140197.1|390060_391104_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.0	2.8e-27
WP_013140198.1|391462_392374_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013140199.1|392373_393351_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038425867.1|393469_394861_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013140201.1|394951_396229_+	fuconate dehydratase	NA	Q6A202	Oenococcus_phage	23.7	1.8e-12
WP_013140202.1|396244_397036_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013140203.1|397179_398076_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_013140204.1|398111_398549_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_013140205.1|398568_400005_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_013140206.1|400020_402372_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_080515125.1|402506_403127_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013140209.1|403150_403966_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013140208.1|403964_405686_+	U32 family peptidase	NA	Q6DW11	Phage_TP	35.8	4.0e-39
WP_013140210.1|405764_406745_+	laccase domain-containing protein	NA	NA	NA	NA	NA
WP_013140211.1|406824_407700_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013140212.1|407709_408387_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_013140213.1|408534_410103_+	cell division protein	NA	NA	NA	NA	NA
WP_013140214.1|410217_411561_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.8	2.5e-60
WP_013140215.1|411867_413001_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	44.4	2.4e-80
WP_013140216.1|413129_414362_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.1	1.0e-84
WP_013140218.1|414515_415103_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	37.6	2.8e-24
WP_013140219.1|415095_416400_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	35.5	1.1e-36
WP_013140220.1|416461_417175_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_013140221.1|417447_418761_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_013140222.1|418985_420317_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_013140223.1|420449_421220_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	2.8e-40
WP_013140224.1|421457_422591_+	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_007051435.1|422801_423755_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011068422.1|423787_424753_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_007051433.1|424805_425585_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	1.3e-13
WP_013140225.1|425881_426460_+	LemA family protein	NA	NA	NA	NA	NA
WP_012471992.1|426523_428794_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_013140228.1|431801_432665_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013140229.1|432756_433812_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_013140230.1|433950_434538_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	37.0	2.3e-23
WP_013140231.1|434530_435835_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	33.9	3.6e-40
>prophage 2
NZ_CP008885	Bifidobacterium longum strain BXY01, complete genome	2480603	894448	907355	2480603	integrase,transposase	Gordonia_phage(33.33%)	12	895531:895590	898922:899020
WP_038425912.1|894448_894964_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
895531:895590	attL	TCCGATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCC	NA	NA	NA	NA
WP_038425913.1|895625_896681_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH95	Gordonia_phage	30.8	1.6e-06
WP_038425914.1|896677_897643_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140282.1|897639_898842_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140531.1|899397_900564_-	histidine kinase	NA	NA	NA	NA	NA
898922:899020	attR	GGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAATTAAACCGACATCGGTTTAATTCCGACCGCGGCTGCCA	NA	NA	NA	NA
WP_012576686.1|900575_901178_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038425915.1|901713_902640_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	9.7e-16
WP_048349542.1|902636_903407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828120.1|903408_904113_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	9.6e-24
WP_003828119.1|904138_904831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080715479.1|905339_906500_+|transposase	IS256-like element ISBlo16 family transposase	transposase	NA	NA	NA	NA
WP_038425912.1|906839_907355_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP008885	Bifidobacterium longum strain BXY01, complete genome	2480603	2273669	2362188	2480603	integrase,tRNA,transposase	Bacillus_phage(25.0%)	57	2304150:2304166	2362441:2362457
WP_013141415.1|2273669_2274725_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH95	Gordonia_phage	27.1	9.4e-07
WP_038425874.1|2274721_2275687_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140282.1|2275683_2276886_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148217417.1|2277016_2278084_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	26.9	1.3e-08
WP_013141418.1|2278823_2279780_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_038426042.1|2279790_2281365_-	sodium:galactoside symporter	NA	NA	NA	NA	NA
WP_013141420.1|2281401_2283762_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_038426200.1|2283827_2285198_-	glycoside hydrolase family 27 protein	NA	NA	NA	NA	NA
WP_013141422.1|2285502_2286573_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013141423.1|2286681_2287719_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_013141424.1|2287929_2288673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141425.1|2288701_2290858_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_013141426.1|2290904_2292968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141427.1|2292990_2294061_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_013141428.1|2294108_2295023_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_080515236.1|2295071_2297822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141430.1|2297965_2298928_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038426201.1|2298955_2299924_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013141432.1|2299997_2301614_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_148217418.1|2301923_2303039_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013141434.1|2303043_2303724_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_013141435.1|2303801_2305589_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.3	1.8e-13
2304150:2304166	attL	GTACCCGTCGGGCAGTT	NA	NA	NA	NA
WP_080515311.1|2305599_2307462_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.0e-48
WP_013141437.1|2307951_2309349_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013141439.1|2310209_2311190_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012578633.1|2311310_2312186_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013141440.1|2312189_2313149_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013141441.1|2313311_2314559_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013141442.1|2314835_2315882_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_050569365.1|2316157_2318269_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_013141444.1|2318343_2319714_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_038426044.1|2320035_2321457_+	MFS transporter	NA	NA	NA	NA	NA
WP_013141446.1|2321826_2323560_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_013141447.1|2323591_2325730_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	1.8e-17
WP_013141448.1|2325747_2326746_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_124880457.1|2326770_2327691_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013141450.1|2328047_2329577_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	30.9	6.4e-65
WP_038426045.1|2329853_2330939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141452.1|2331404_2331701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141453.1|2332118_2333984_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	29.6	1.2e-65
WP_013141454.1|2334370_2334997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141455.1|2334993_2335365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515237.1|2335391_2336489_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.7	7.2e-42
WP_013141458.1|2336948_2338367_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_038426048.1|2338521_2339568_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013141459.1|2339706_2341536_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.2e-47
WP_013141460.1|2341750_2343622_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.0e-32
WP_007052942.1|2343808_2344330_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007055052.1|2344691_2345255_+	hypothetical protein	NA	A0A2H4J297	uncultured_Caudovirales_phage	42.3	5.0e-23
WP_013141462.1|2345750_2349587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141463.1|2349798_2354340_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_013141464.1|2354643_2356140_-	ATPase AAA	NA	NA	NA	NA	NA
WP_013141465.1|2356479_2358003_-	amino acid permease	NA	NA	NA	NA	NA
WP_080515239.1|2358328_2359621_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_080515240.1|2359725_2360388_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_050749730.1|2360417_2360744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515312.1|2360877_2362188_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	23.0	8.1e-08
2362441:2362457	attR	AACTGCCCGACGGGTAC	NA	NA	NA	NA
