The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	215648	279923	5523849	tRNA,plate,transposase	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215648_216944_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|216996_217257_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217243_217444_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217609_218155_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218151_218562_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218575_219286_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219485_220310_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220362_222081_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222191_222899_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222895_223300_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223417_224233_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224272_224926_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224918_225950_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226137_226713_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232467_233271_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233267_234182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234422_235223_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235300_236071_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236118_237477_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_038430797.1|237548_238304_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238337_239060_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239056_239524_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239588_240320_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240857_241658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242135_242585_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242587_243184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|243293_243485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243505_243985_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243950_245360_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001303798.1|245370_248805_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248940_250353_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250357_251101_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251097_253875_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253883_254645_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254649_255981_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255983_256508_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256504_257785_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257809_258892_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258855_260706_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260709_261123_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261213_262605_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262655_262880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262914_263415_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264111_264630_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264839_266981_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267056_271289_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271428_272145_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001356573.1|273903_274461_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275206_276343_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278306_278570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278484_278670_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278750_279923_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	298709	315862	5523849	integrase,tail,transposase	Escherichia_phage(35.29%)	18	305319:305332	321223:321236
WP_000749881.1|298709_299765_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300052_301156_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301167_302421_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303490_303736_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304064_305278_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_038430801.1|305303_305687_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
305319:305332	attL	TCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001274756.1|305814_306528_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306628_306829_+	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306947_307241_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|308192_308504_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308503_309298_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309297_309891_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|309862_310306_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|310326_310737_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310766_311321_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311378_312152_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312975_313719_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130488.1|314680_315862_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.3e-142
321223:321236	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 3
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	893569	931672	5523849	integrase,holin,terminase,lysis,protease,portal,tail	Enterobacteria_phage(50.0%)	49	883011:883025	915304:915318
883011:883025	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|893569_894640_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|894617_894836_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|894875_895043_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|895285_895888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|896098_896320_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|896418_896634_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|896710_896902_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|896874_897057_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|897053_897734_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|898431_898614_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|898610_898781_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|898773_899394_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|899390_900056_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|900267_901227_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|901564_901687_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|901701_902391_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|902574_903318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|903403_903562_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|903642_904041_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|904184_904400_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|904399_904897_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|904893_905361_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|905348_905501_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000934137.1|906664_908767_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|908763_908976_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|908903_910028_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|910149_910485_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|910429_912457_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|912543_912867_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|912859_913135_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|913146_913725_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|913721_914123_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|914133_914877_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_038431162.1|914937_915324_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	1.8e-64
915304:915318	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|915332_915662_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|915633_918699_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|918698_919028_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|919037_919736_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|919741_920485_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|920421_921030_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|921090_924504_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|924574_925174_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|925233_926550_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|926551_926821_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|926997_927978_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|928011_929031_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|929530_929692_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|929861_930743_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|930973_931672_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	1148379	1219546	5523849	capsid,transposase,integrase,holin,terminase,protease,portal,tail,head	Escherichia_phage(25.58%)	76	1156866:1156881	1178217:1178232
WP_000156526.1|1148379_1150140_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1150325_1150778_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1150852_1151893_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1152249_1152759_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1152977_1153607_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1153569_1155732_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1155741_1156188_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1156310_1158365_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1156866:1156881	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1158396_1158855_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1158950_1159613_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1159785_1160199_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1160243_1160561_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1160618_1161809_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1161903_1162182_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1162178_1162508_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1162598_1163258_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_077766378.1|1163665_1164673_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.1	7.7e-83
WP_000273151.1|1164650_1164893_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_038430871.1|1164960_1167429_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1167522_1167714_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1167710_1167899_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1168474_1168660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1168846_1169236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1169377_1169533_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1169809_1170097_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1170096_1170288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1170315_1170717_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1170824_1171097_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1171080_1171506_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1171712_1172168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1172246_1173338_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|1173344_1174091_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1174112_1174883_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1174898_1175312_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1175663_1176437_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1177041_1177197_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1177364_1177643_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1177644_1178694_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1178217:1178232	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1178706_1179078_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1179067_1179439_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1179590_1180409_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1181029_1181743_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038430876.1|1182510_1184361_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_162829202.1|1184536_1185749_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1185954_1186269_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1186795_1186981_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1187202_1187316_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1187536_1188070_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1188229_1188502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001416698.1|1188757_1188922_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	94.4	3.5e-22
WP_162829202.1|1188991_1190204_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000235421.1|1191027_1191303_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1191378_1191759_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1191755_1192103_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_038430878.1|1192152_1193694_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	5.5e-298
WP_038430880.1|1193956_1195885_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1195868_1196075_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1196071_1197664_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_038430883.1|1197653_1199186_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	7.5e-98
WP_000256723.1|1199222_1199570_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1199628_1199895_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000479117.1|1200629_1201061_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1201087_1201501_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_038430886.1|1201481_1204061_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847274.1|1204057_1204387_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1204386_1205085_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1205095_1205839_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1205784_1206417_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1206607_1207135_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001230445.1|1210809_1211409_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_144241374.1|1211473_1212784_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	5.3e-76
WP_001023352.1|1212785_1213055_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1215327_1216446_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1216442_1218236_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1218254_1218962_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1218958_1219546_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	1480428	1599459	5523849	tRNA,capsid,transposase,integrase,protease,holin,terminase,lysis,head,portal,tail	Enterobacteria_phage(37.0%)	144	1542353:1542368	1570603:1570618
WP_000952736.1|1480428_1481250_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1481405_1482452_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1482448_1483243_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1483409_1484528_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1484496_1484766_-	excisionase	NA	NA	NA	NA	NA
WP_000241021.1|1484827_1485265_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.5	5.9e-40
WP_000559928.1|1485349_1485865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1485978_1486131_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1486445_1486922_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1487046_1487370_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1487353_1487779_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1487847_1488885_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1488796_1489339_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1489372_1490089_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1490121_1490403_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1490399_1490702_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1490691_1491009_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1490962_1491280_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1491266_1491704_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1491705_1491897_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1491899_1492487_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1492602_1492707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1492894_1493107_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1493274_1493553_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1493554_1494604_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001213059.1|1496294_1496477_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1496514_1496784_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1496859_1497075_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1497079_1497424_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1497474_1498008_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1498278_1498848_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1498847_1498994_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1499221_1499428_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1499492_1499717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1500073_1500214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1500343_1500529_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1500570_1500936_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1501224_1501788_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038430908.1|1501784_1503446_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.6	0.0e+00
WP_038430910.1|1503509_1505450_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
WP_001063099.1|1505494_1505716_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_038430912.1|1505661_1508247_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.6	0.0e+00
WP_000126019.1|1508243_1508570_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1508579_1508930_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1508926_1509373_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1509369_1509714_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1509779_1510496_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1510510_1510885_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1510980_1511190_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_049870895.1|1514520_1514820_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.0	3.8e-54
WP_001152182.1|1514819_1515518_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_010904626.1|1515896_1516007_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1516309_1517188_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1517241_1517979_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1517924_1518161_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1518173_1518263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1518282_1520631_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1521221_1524623_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1526931_1527207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1527267_1528629_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1528992_1529856_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000359446.1|1531224_1532451_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1532499_1533621_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1533869_1535099_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1535463_1535652_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1536456_1536654_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1536646_1536859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1536848_1537313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038430916.1|1537305_1537539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1537544_1537844_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000192401.1|1539439_1539691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1539687_1540098_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_038430920.1|1540108_1540381_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1540506_1540731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1540982_1541189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1541188_1542244_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1542256_1542592_+|head	head decoration protein	head	NA	NA	NA	NA
1542353:1542368	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1542604_1543018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1543223_1543766_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1544020_1544302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1544902_1546363_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1546362_1547034_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1547202_1548573_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1548576_1549218_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1549253_1550360_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1550413_1550875_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1550884_1551538_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1551709_1552960_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1553073_1554216_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1554205_1554442_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1555366_1556068_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1556064_1556367_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1556434_1556767_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1556831_1556954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038430923.1|1557011_1558535_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.9	2.5e-32
WP_001053040.1|1559036_1559492_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1559491_1559662_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1559654_1559945_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1559941_1560304_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1560300_1560441_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1560437_1561127_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1561448_1561754_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1561740_1562217_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1562433_1562616_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1562706_1563000_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1563291_1563702_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1563987_1564194_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1564358_1564553_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1564941_1565487_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1565461_1567387_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1567383_1567590_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1567586_1569188_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1569168_1570488_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_144241377.1|1570497_1570836_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	95.9	6.6e-47
1570603:1570618	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1570886_1571912_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1571953_1572352_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1572363_1572717_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1572728_1573307_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1573303_1573699_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1573706_1574447_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1574462_1574885_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1574866_1575301_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_038430925.1|1575293_1577843_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|1577839_1578169_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1578168_1578867_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1578872_1579616_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1579552_1580185_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1580245_1583644_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1583710_1584310_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1584374_1587290_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1587289_1587871_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1587990_1588881_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1588899_1589406_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1589442_1589943_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1590021_1590204_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1590701_1591370_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1591426_1591675_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|1591750_1592131_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1592127_1592475_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1592524_1594063_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1594365_1595850_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_038430929.1|1596036_1596990_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1597488_1598073_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|1598246_1599459_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	1678656	1796283	5523849	capsid,transposase,integrase,protease,holin,terminase,lysis,head,portal,tail	Enterobacteria_phage(33.66%)	137	1694457:1694516	1752410:1752472
WP_000048551.1|1678656_1681128_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|1681220_1681412_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1681408_1681597_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1682155_1682389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1682366_1682774_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1682796_1683015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1683087_1683387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1683650_1684058_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1684134_1684362_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000020556.1|1684867_1685908_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1685819_1686362_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1686548_1687130_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1687126_1687291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1687989_1688748_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1689025_1689238_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1689457_1689715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1689784_1690063_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1690064_1691111_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1691123_1691483_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1691491_1692022_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1692263_1692461_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1692611_1693670_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|1694409_1694568_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
1694457:1694516	attL	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCT	NA	NA	NA	NA
WP_000284517.1|1695435_1695651_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1695655_1696000_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|1696050_1696584_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1696854_1697424_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1697423_1697570_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1697577_1698045_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1698507_1698822_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1698903_1699128_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1699514_1700060_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027185.1|1700034_1701960_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|1701956_1702163_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1702159_1703761_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1703741_1705061_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1705070_1705403_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1705458_1706484_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1706525_1706924_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1706935_1707289_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1707303_1707837_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1707833_1708229_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1708236_1708989_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1709002_1709425_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_038430935.1|1709451_1709760_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	98.0	5.6e-53
WP_000847298.1|1712450_1712780_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1712779_1713478_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|1714176_1714806_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|1715044_1717900_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|1717967_1718567_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|1718718_1720023_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|1720024_1720294_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1721320_1722646_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1724243_1724366_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1724472_1725384_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1725449_1726019_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1726984_1728523_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1728572_1728920_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1728916_1729297_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1729636_1729915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1730342_1730489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1730625_1731273_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1731456_1732047_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|1733553_1734204_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000113671.1|1735503_1736634_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|1736611_1736860_-	excisionase	NA	NA	NA	NA	NA
WP_038430941.1|1736924_1739366_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|1739458_1739647_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1739643_1739832_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|1740231_1740396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|1740399_1740618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1740777_1740933_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|1741122_1741530_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1741607_1741835_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|1741818_1742370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020570.1|1742341_1743382_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|1743293_1743836_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000537576.1|1743870_1744641_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_001118161.1|1744656_1745052_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1745108_1745465_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1745513_1745726_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1745761_1746133_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610377.1|1746129_1746492_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_001278450.1|1746607_1746712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1746900_1747113_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001217394.1|1747332_1747590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012779355.1|1747659_1747938_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_038430946.1|1747939_1748989_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	7.2e-108
WP_038430948.1|1749001_1749376_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	5.4e-34
WP_000762860.1|1749372_1750194_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000917735.1|1750420_1750618_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483509.1|1750768_1751827_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_038430953.1|1752419_1754366_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
1752410:1752472	attR	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCTTGC	NA	NA	NA	NA
WP_001290230.1|1754722_1754968_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_038430955.1|1755045_1755261_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	5.9e-33
WP_001015158.1|1755264_1755822_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001092902.1|1755858_1756392_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|1756910_1757096_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|1757570_1758047_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_038430957.1|1758043_1760164_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.4	0.0e+00
WP_144241378.1|1760160_1760373_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974554.1|1760372_1761875_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|1761819_1763844_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1763931_1764258_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1764250_1764532_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|1764534_1765158_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|1765170_1765569_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1765576_1766329_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1766342_1766765_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1766791_1767100_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_038430960.1|1767143_1769789_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.1	0.0e+00
WP_000847298.1|1769785_1770115_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_038430961.1|1770114_1770813_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_038430963.1|1770823_1771567_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	5.4e-150
WP_144241385.1|1771512_1772142_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_038430967.1|1772382_1775859_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.4	0.0e+00
WP_038430969.1|1775926_1776523_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	2.0e-107
WP_038430971.1|1776587_1777901_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_038430973.1|1777902_1778172_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.2e-44
WP_000692020.1|1779304_1779895_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1780272_1780443_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079499.1|1780932_1781439_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1781484_1781985_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1782070_1782250_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1782630_1783437_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1783436_1784630_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1784641_1786003_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1786003_1787599_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1787598_1789161_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1789252_1789297_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1789434_1790316_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1790312_1790933_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1790960_1792544_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1792756_1793629_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1793668_1794259_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1794255_1795014_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1795233_1796283_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2068131	2151621	5523849	capsid,transposase,holin,terminase,head,portal,tail	Stx2-converting_phage(43.18%)	95	NA	NA
WP_000527769.1|2068131_2069592_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_077766380.1|2071105_2071360_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.6e-27
WP_001143804.1|2071521_2072163_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|2072244_2072874_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2072946_2073522_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2073635_2073905_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_038430992.1|2073906_2075220_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.9	7.7e-83
WP_001230508.1|2075284_2075884_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2080371_2081004_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2080949_2081693_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|2081703_2082402_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|2082401_2082743_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2082735_2085978_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2086028_2086238_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2086333_2086708_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2086713_2087430_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2087488_2087833_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2087829_2088276_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2088272_2088623_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_001063023.1|2090998_2091220_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000731239.1|2091763_2092171_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_024180155.1|2092175_2092391_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2092829_2094680_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001344632.1|2095029_2095161_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_001302123.1|2095157_2095589_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2096039_2096753_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2096888_2097086_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2097310_2097865_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2097927_2098233_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2098245_2099295_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2099296_2099569_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2099690_2100035_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2100154_2100367_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2100600_2101158_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2101159_2101378_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2101505_2101817_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2101809_2102037_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2102033_2102315_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2102347_2103064_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2103097_2103559_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2103551_2104595_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2104663_2105089_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2105072_2105315_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2105706_2106045_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2106337_2106490_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2106501_2107140_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2107140_2107350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2107914_2108103_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2108099_2108288_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001120551.1|2110335_2110578_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|2111539_2111920_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2111916_2112264_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2112313_2113852_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2114434_2115085_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2115795_2116371_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2116484_2116754_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2116755_2117979_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2118043_2118643_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001179509.1|2122376_2122814_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_001417171.1|2122813_2123113_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	4.5e-55
WP_038431001.1|2123146_2126404_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	96.8	0.0e+00
WP_001453746.1|2126451_2126661_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2126756_2127131_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2127145_2127862_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2127927_2128272_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2128268_2128715_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2128711_2129062_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2129071_2129398_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|2129400_2131980_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2131925_2132147_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2132191_2134129_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2134192_2135854_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2135850_2136414_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2136703_2137069_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2137110_2137338_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2137762_2137948_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539789.1|2138205_2138322_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
WP_001056806.1|2138321_2138891_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2139161_2139695_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2139745_2140090_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2140094_2140310_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_038431006.1|2140748_2142599_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2143077_2143506_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2144141_2144831_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2144827_2145187_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2145199_2146249_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2146250_2146529_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2146696_2146909_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2147097_2147202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2147317_2147902_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2147958_2148354_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2149164_2149905_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2149911_2150874_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2150896_2151322_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2151318_2151621_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2466503	2518727	5523849	integrase,tRNA,tail,transposase	Enterobacteria_phage(60.0%)	59	2459727:2459742	2519017:2519032
2459727:2459742	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2466503_2468237_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2468413_2468902_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2469021_2469414_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2469413_2471492_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2471484_2472633_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2472834_2473479_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2473489_2473879_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2473893_2474943_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2474945_2475806_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_144241379.1|2475802_2477425_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	7.9e-13
WP_001302081.1|2477471_2479133_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2479275_2479779_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2479799_2481764_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2481768_2482695_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2482691_2483579_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2483705_2484284_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2484286_2484637_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_038431029.1|2485416_2485845_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2485851_2487276_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2487250_2488051_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2488217_2489204_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2489218_2490733_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2490802_2491792_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2492588_2493092_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2493171_2493423_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2493537_2493624_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2493885_2494209_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2494379_2494877_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2494913_2495153_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2495344_2496556_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2496617_2497283_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2497639_2498641_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2498646_2498994_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2499023_2499674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2499689_2500094_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2500183_2500321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2500392_2500596_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2500617_2500968_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2500978_2501257_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2501268_2501511_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2501507_2501621_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2501713_2502130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2502153_2502357_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2502353_2502620_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2502616_2502916_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2502927_2503545_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2503541_2503907_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2503913_2506736_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2506812_2507772_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2507776_2508091_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2509182_2509713_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2509756_2510329_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2510485_2510974_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2513776_2513932_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2513940_2514306_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2514360_2514873_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2514872_2516057_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2516214_2516538_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829242.1|2517514_2518727_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2519017:2519032	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2576516	2645546	5523849	capsid,transposase,integrase,holin,terminase,head,portal,tail	Escherichia_phage(37.21%)	67	2592083:2592098	2649173:2649188
WP_001023407.1|2576516_2576786_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|2576787_2578101_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230514.1|2578165_2578765_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_097454001.1|2582559_2583189_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_158414461.1|2583552_2583705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431034.1|2583823_2584522_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.1	5.4e-128
WP_000533402.1|2587233_2587647_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2587673_2588105_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2588118_2588859_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2588840_2589107_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2589164_2589512_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2589548_2591054_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2591043_2592636_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2592083:2592098	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2592632_2592839_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2592822_2594751_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2594722_2595232_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2595626_2595851_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2595932_2596247_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2596773_2596959_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2597186_2597318_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2597330_2597513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2597668_2598202_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2598252_2598597_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2598601_2598817_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2599126_2600339_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_038431037.1|2600421_2602269_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	94.6	0.0e+00
WP_001303558.1|2602746_2603175_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_038431039.1|2603808_2604498_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	2.6e-58
WP_000904141.1|2604494_2604854_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2604866_2605916_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2605917_2606196_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2606363_2606576_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2606762_2606867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2606976_2607540_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2607666_2607978_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2607974_2608127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2608159_2608516_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2608512_2608737_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2608758_2609457_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2609491_2610034_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2609945_2610983_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2611051_2611477_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2611473_2611701_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2611798_2612443_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2612717_2612870_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2613350_2613539_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2613535_2613724_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2613819_2616291_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2616349_2616553_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|2616552_2617632_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_001302302.1|2617823_2618621_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_134793145.1|2619109_2627092_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480501.1|2627353_2628406_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2628719_2630036_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2630137_2631592_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2631934_2632651_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2633276_2634920_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2635037_2635988_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2636089_2637007_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2637463_2638399_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2638460_2639540_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2639551_2640295_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2640291_2640837_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|2641198_2641579_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2641575_2641923_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2641972_2643511_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_193363939.1|2644329_2645546_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.1e-168
2649173:2649188	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 10
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2659492	2717895	5523849	capsid,transposase,protease,integrase,holin,terminase,lysis,head,tail	Stx2-converting_phage(49.35%)	77	2673210:2673225	2720958:2720973
WP_001303036.1|2659492_2660659_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2661982_2662633_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|2662856_2663732_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001023455.1|2663872_2664142_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268958.1|2664143_2665457_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.5	2.4e-84
WP_001230514.1|2665521_2666121_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_038431050.1|2666188_2669668_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_122994717.1|2669906_2670539_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|2670484_2671222_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|2671276_2672200_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|2672270_2672444_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2672550_2672871_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
2673210:2673225	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_000807954.1|2673613_2673955_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212920.1|2673947_2677190_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|2677241_2677451_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2677546_2677921_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2677926_2678643_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2678701_2679046_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2679042_2679489_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2679485_2679836_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2679845_2680172_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|2682698_2682920_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2682964_2684902_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038431053.1|2684965_2686624_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.3	0.0e+00
WP_000958416.1|2686620_2687184_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2687474_2687840_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2687881_2688109_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|2688571_2688829_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_038431055.1|2688821_2689322_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	2.4e-93
WP_000092318.1|2689524_2689962_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2689958_2690456_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2690455_2690671_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2690747_2691020_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2691060_2691240_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143110.1|2691376_2693314_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2693557_2693881_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2694177_2694447_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2694458_2695418_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2696067_2696556_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2696546_2697218_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2697214_2697820_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2697819_2698542_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2698616_2699297_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2699552_2700311_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2700585_2700768_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_038431062.1|2700764_2701292_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	99.4	6.2e-100
WP_001303571.1|2701288_2701735_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2701691_2701928_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2701938_2702154_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2702286_2702565_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2702635_2704012_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2704008_2704830_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2704816_2704978_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2705010_2705307_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2705448_2705664_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2705739_2706435_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2706936_2707458_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2708026_2708209_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2708186_2708459_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2708517_2708769_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2708951_2709320_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2709392_2709557_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2709525_2709669_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2709743_2710040_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|2710045_2710831_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_193363940.1|2711125_2712339_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	7.1e-168
WP_000682306.1|2712817_2713000_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|2712972_2713164_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000188870.1|2713240_2713456_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2713554_2713776_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2713772_2714720_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|2714721_2714898_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2715231_2715588_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|2715584_2715935_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2716122_2716467_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2716544_2716736_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2716716_2717895_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2720958:2720973	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 11
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2801117	2839209	5523849	tRNA,capsid,integrase,plate,holin,terminase,lysis,head,portal,tail	Escherichia_phage(60.47%)	47	2805417:2805444	2837402:2837429
WP_000675144.1|2801117_2802521_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2802517_2803240_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2803430_2803763_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2803910_2805272_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2805417:2805444	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2805545_2805764_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2805845_2807009_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2807008_2807488_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2807502_2809950_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2809942_2810062_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2810094_2810370_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2810426_2810945_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_038431074.1|2810957_2812148_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	98.7	1.9e-221
WP_000983068.1|2812826_2813360_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_001057694.1|2813359_2813962_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000217043.1|2814426_2815626_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001285352.1|2815622_2816234_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2816226_2817135_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2817139_2817487_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2817483_2818119_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2818185_2818638_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2818630_2819098_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2819060_2819234_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2819205_2819631_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2819618_2820044_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2820058_2820556_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_038431075.1|2820555_2820837_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	98.9	3.7e-43
WP_000846406.1|2820840_2821044_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2821043_2821553_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2821652_2822396_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2822399_2823473_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2823531_2824386_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2824559_2826332_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2826331_2827366_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2827683_2829651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2830148_2831372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2831461_2833744_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2833733_2834009_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2834005_2834230_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2834232_2834532_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2834531_2834756_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2834819_2835320_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2835316_2835487_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2835497_2835773_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2835894_2836194_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2836308_2837322_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2837586_2837904_-	hypothetical protein	NA	NA	NA	NA	NA
2837402:2837429	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2838309_2839209_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 12
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	2864836	2940065	5523849	tRNA,holin,terminase,portal,tail	Enterobacteria_phage(52.24%)	80	NA	NA
WP_001301615.1|2864836_2866870_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2873827_2877457_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2877518_2877836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2879076_2880165_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2880175_2881705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528952.1|2881723_2882455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301655.1|2882447_2883584_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2883580_2885584_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2885708_2886170_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2886211_2886682_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2886728_2887448_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2887444_2889130_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2889644_2889893_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2890260_2890530_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_038431080.1|2890531_2891845_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|2891909_2892509_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_038431081.1|2892576_2896050_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_072147834.1|2896290_2896920_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2896865_2897609_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2897619_2898318_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2898317_2898647_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2898643_2901289_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|2901332_2901641_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2901667_2902090_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2902103_2902856_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2902863_2903262_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2903274_2903898_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2903900_2904182_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2904174_2904501_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_038431082.1|2906556_2908059_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.6	9.1e-290
WP_144241378.1|2908058_2908271_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077626.1|2908267_2910391_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|2910387_2910864_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2911339_2911525_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2912043_2912577_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_038431172.1|2912613_2913171_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.0	3.4e-48
WP_038430955.1|2913174_2913390_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	5.9e-33
WP_001290230.1|2913467_2913713_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2913753_2913933_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_038431083.1|2914067_2916014_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_001356551.1|2916815_2916968_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2917218_2917653_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2917738_2917879_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2917875_2918238_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2918234_2918525_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2918517_2918688_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2918687_2919143_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2919139_2919241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2919357_2920155_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2920164_2920716_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2921180_2922707_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|2922764_2922872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2922963_2923296_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2923363_2923666_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000147876.1|2925672_2926692_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|2926688_2927228_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2927297_2927528_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2927632_2928322_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2928402_2929464_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2929441_2929819_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2930299_2930506_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2930581_2930878_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2930883_2931669_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2931665_2932343_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2932342_2932525_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2932497_2932689_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2932765_2932981_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2933079_2933301_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2933297_2934245_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2934246_2934423_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2934756_2935113_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2935109_2935472_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2935559_2935802_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2935805_2935940_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2935958_2936213_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2936246_2937533_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2937553_2938255_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2938314_2938422_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2938402_2939134_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2939138_2940065_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	3155044	3253444	5523849	tRNA,capsid,transposase,integrase,holin,terminase,lysis,protease,portal,tail	Escherichia_phage(44.09%)	119	3176217:3176233	3250433:3250449
WP_001283590.1|3155044_3155857_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3155856_3156870_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3156935_3158072_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|3158170_3159166_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3159162_3160341_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3160614_3161835_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3161993_3164000_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3164120_3164399_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3164432_3164981_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3164980_3165790_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|3165789_3166614_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3166617_3167703_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3167737_3168670_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3168835_3169387_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3169557_3170400_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3170401_3170923_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3170919_3171390_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3171386_3171887_-	fimbrial protein	NA	NA	NA	NA	NA
WP_038431091.1|3171897_3172656_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_038431092.1|3172678_3175318_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3175399_3175963_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3176217:3176233	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3176608_3177094_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3177296_3179441_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3179440_3180751_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3180930_3181215_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3181586_3182927_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3183291_3184323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3184717_3185473_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3185766_3186699_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331680.1|3186920_3195296_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000012445.1|3195364_3196630_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|3196640_3196934_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|3196943_3197390_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|3197392_3198049_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|3198143_3198545_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3198601_3198742_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3198971_3199706_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3199796_3200414_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3200419_3200698_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3200712_3201981_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|3201977_3203603_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|3203897_3204086_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3204224_3204494_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_038431096.1|3204495_3206433_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|3206429_3207080_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3207079_3207643_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3207626_3208088_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3208137_3208527_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3208582_3209797_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|3209820_3210237_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_162829202.1|3210367_3211580_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000787025.1|3212298_3214443_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|3214442_3216149_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3216129_3216936_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3217343_3217637_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3217668_3218133_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3218140_3218290_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3218289_3218859_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3219132_3219666_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3219670_3219886_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3219962_3220235_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3220275_3220455_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3220589_3222527_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3223013_3223283_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3223294_3224254_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|3224634_3224787_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_001204880.1|3225034_3225469_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3225461_3225656_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3225652_3226258_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|3226257_3226980_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|3226972_3227182_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3227141_3227543_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3227617_3228292_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3228548_3228743_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|3228739_3229267_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|3229263_3229866_-	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3229858_3230275_-	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3230448_3230664_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|3230796_3231075_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3231145_3231436_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|3231432_3232134_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|3232130_3233069_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|3233101_3233398_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3233536_3233764_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3233842_3234550_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3234610_3234952_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|3235019_3235481_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|3235474_3236521_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745484.1|3236523_3236688_+	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000198444.1|3237176_3237560_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3237618_3238089_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065487.1|3238239_3238608_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_001198861.1|3238680_3238845_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|3238813_3238978_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|3239031_3239328_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3239333_3240119_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3240115_3240796_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3240792_3240975_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3240947_3241139_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|3241215_3241431_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000774248.1|3241529_3241751_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|3241747_3242695_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_193363941.1|3243137_3243377_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	2.6e-37
WP_001142590.1|3243378_3243597_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000206751.1|3243888_3244506_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|3244505_3244790_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|3245145_3245769_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3245811_3245979_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000268107.1|3245978_3246209_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000163444.1|3246205_3246832_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3246791_3247004_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3247039_3247417_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3247495_3247678_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3247661_3248831_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3249262_3250420_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3250594_3251731_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3250433:3250449	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3251740_3252421_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3252407_3252875_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3252874_3253444_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 14
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	3531007	3545794	5523849	holin,tail,transposase	Enterobacteria_phage(35.71%)	18	NA	NA
WP_000162574.1|3531007_3531490_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3532335_3532584_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3533085_3533676_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3533858_3534509_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3534587_3535646_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3535775_3536198_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3536358_3536628_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_193363937.1|3536845_3538058_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	4.9e-169
WP_000612591.1|3538559_3538907_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3538903_3539284_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000731241.1|3539640_3539985_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3539989_3540205_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3540354_3542208_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3542651_3542819_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3542904_3543648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3543900_3544524_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3544520_3545186_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3545182_3545794_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 15
NZ_CP008805	Escherichia coli O157:H7 str. SS17 chromosome, complete genome	5523849	5131206	5145871	5523849	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5132487:5132502	5150016:5150031
WP_000956557.1|5131206_5131740_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5131936_5132110_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5132157_5132439_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5132487:5132502	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5132783_5132981_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5133316_5133601_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5133597_5133948_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5133938_5134475_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_038431149.1|5135796_5136396_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	2.2e-109
WP_000268945.1|5136460_5137774_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5137775_5138045_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5138156_5138729_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5138801_5139431_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5139512_5140154_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5140314_5140563_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5140624_5141722_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|5141810_5142848_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5142981_5143224_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5143389_5144373_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5144455_5145871_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5150016:5150031	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP008806	Escherichia coli O157:H7 str. SS17 plasmid p0157, complete sequence	94645	8416	81238	94645	protease,integrase,transposase	Macacine_betaherpesvirus(27.78%)	60	626:640	23306:23320
626:640	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001066920.1|8416_9157_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|9441_10419_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|10826_11027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|11023_11644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|11640_12324_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|12782_13001_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_162829348.1|13054_14268_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_027868286.1|14321_14621_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|14621_15428_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_000852148.1|17434_18190_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|18777_19944_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|19943_20915_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|21609_22512_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|22515_22821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025840132.1|22897_23584_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
23306:23320	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001104869.1|23580_23802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|23695_24250_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001005037.1|24295_25072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010891293.1|25612_25915_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|25961_26384_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|26380_26572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032245379.1|26541_27051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|27564_27795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|27846_29208_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|29254_29818_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001496595.1|29903_30371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|30440_30647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|30672_31125_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|31181_31415_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|31480_33439_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|33493_33928_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|33924_34686_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|34917_35076_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|37298_37730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|39523_49033_+	toxin B	NA	NA	NA	NA	NA
WP_000205762.1|51291_52038_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|52096_52957_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|53059_53620_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|53752_53965_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233856.1|54209_54671_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
WP_001302200.1|54716_54926_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|54963_55302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|55541_55796_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|56031_56106_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|56098_56956_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|57868_58153_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|58152_58428_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|58522_58729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|60069_60255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|60431_62642_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|62685_63075_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|64300_68203_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|70381_71203_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|71202_72309_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|72398_74120_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|74193_75192_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|75559_75940_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|75936_76284_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|76333_77872_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001358886.1|78541_81238_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
