The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	199890	311988	5547323	tRNA,integrase,plate,transposase,tail,protease	Enterobacteria_phage(20.69%)	100	276169:276183	312404:312418
WP_001295561.1|199890_201243_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201272_203705_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203825_204311_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204314_205340_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205444_205900_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205903_206692_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206691_207840_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207836_208433_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208469_211952_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211964_212924_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213022_215164_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215220_215610_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|215674_216970_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217022_217283_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217269_217470_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635546.1|218177_218588_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218601_219312_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219511_220336_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220388_222107_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222217_222925_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222921_223326_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223443_224259_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224298_224952_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224944_225976_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226163_226739_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232496_233300_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233296_234211_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234451_235252_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235329_236100_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236147_237506_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237577_238333_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238366_239089_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239085_239553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239617_240349_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240886_241687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242164_242614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242616_243213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243291_243513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243533_244013_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243978_245388_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|245398_248833_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|250385_251129_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|251125_253897_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|253905_254667_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254671_256003_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256005_256530_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256526_257807_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257831_258914_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258877_260728_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260731_261145_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261235_262627_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262677_262902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262936_263437_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264133_264652_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264861_267003_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509132.1|267078_271293_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_001356493.1|271361_271907_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420837.1|272652_273789_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|273791_275552_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|275753_276017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|275931_276117_-	protein YncO	NA	NA	NA	NA	NA
276169:276183	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|276197_277370_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|277487_278258_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|278411_278885_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|278927_281372_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|281611_282190_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|282294_283062_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|283032_283773_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|283928_284189_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|284207_284468_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|284653_285427_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|286244_287984_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|287928_288714_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226188.1|288784_289840_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|289891_290185_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|290187_290586_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|290595_291048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|291354_291621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|291553_292090_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|292146_293604_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|293864_294323_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|294414_295659_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|295716_296118_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|296156_297212_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|297499_298603_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|298614_299868_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|300937_301183_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000708838.1|301422_301812_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001274756.1|301939_302653_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|302753_302954_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|303072_303366_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|304317_304629_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|304628_305423_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|305422_306016_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|305987_306431_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|306451_306862_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|306891_307446_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|307503_308277_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|309100_309844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|310806_311988_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
312404:312418	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	890966	929063	5547323	integrase,portal,lysis,tail,holin,protease,terminase	Enterobacteria_phage(51.16%)	50	880408:880422	912698:912712
880408:880422	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|890966_891848_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|892010_892229_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|892268_892436_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|892678_893281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|893491_893713_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|893811_894093_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|894103_894295_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|894267_894450_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|894446_895127_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|895824_896007_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|896003_896174_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|896166_896787_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|896783_897449_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|897660_898620_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|898957_899080_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|899094_899784_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|899967_900711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|900796_900955_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|901035_901434_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|901576_901792_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|901791_902289_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|902285_902753_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|902740_902893_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|903567_904059_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|904058_906161_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|906157_906370_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|906297_907422_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|907543_907879_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|907823_909851_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|909937_910261_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|910253_910529_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|910540_911119_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|911115_911517_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|911527_912271_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|912331_912718_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
912698:912712	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|912726_913056_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|913027_916093_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|916092_916422_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|916431_917130_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|917135_917879_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|917815_918424_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|918484_921898_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|921968_922568_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741879.1|922627_923944_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|923945_924215_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|924391_925372_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|925405_926425_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|926921_927083_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|927252_928134_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|928364_929063_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 3
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	1053758	1095477	5547323	integrase,protease,transposase	Stx2-converting_phage(30.0%)	35	1045915:1045930	1091351:1091366
1045915:1045930	attL	GCCACTGGCGCAGGGA	NA	NA	NA	NA
WP_000520781.1|1053758_1054079_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1054109_1056386_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279869.1|1056905_1058108_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1058294_1060112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1061223_1061520_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1061746_1061944_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335698.1|1062162_1063548_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1064368_1064932_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001171554.1|1070140_1070521_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032210650.1|1071011_1071866_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_028913479.1|1071912_1072518_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|1072565_1072817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1072840_1073131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|1073816_1074176_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591997.1|1074268_1075888_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1076112_1076388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010904558.1|1076768_1077467_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1077557_1077860_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1077868_1078189_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1078181_1079885_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1079894_1080359_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1080359_1081034_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021389.1|1081045_1081663_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1082874_1083138_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1083439_1083580_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397129.1|1084451_1085123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1087460_1087886_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1087882_1088233_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1088263_1089877_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957248.1|1090819_1091161_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1091147_1091477_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1091351:1091366	attR	GCCACTGGCGCAGGGA	NA	NA	NA	NA
WP_001176766.1|1091737_1092205_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1092222_1093431_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1093441_1094398_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1094397_1095477_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 4
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	1233341	1397601	5547323	integrase,portal,capsid,transposase,tail,holin,bacteriocin,head,protease,terminase	Escherichia_phage(32.84%)	193	1267187:1267213	1356382:1356408
WP_000156526.1|1233341_1235102_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1235287_1235740_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1235815_1236856_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1237212_1237722_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1237940_1238570_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1238532_1240695_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1240704_1241151_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1241273_1243328_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1243359_1243818_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1243913_1244576_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1244748_1245162_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1245206_1245524_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1245581_1246772_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1246866_1247145_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1247141_1247471_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1247561_1248221_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1248628_1249648_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1249625_1249868_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1249935_1252407_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1252500_1252692_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1252688_1252877_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1253450_1253636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1253822_1254212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1254353_1254509_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1254786_1255074_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1255073_1255265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1255292_1255694_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1255802_1256075_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1256058_1256484_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1256690_1257146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1257224_1258316_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1258322_1259069_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1259090_1259861_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1259876_1260290_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1260641_1261415_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1261780_1261918_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1261962_1262175_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1262342_1262621_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1262622_1263672_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1263684_1264056_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1264045_1264417_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1264568_1265387_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1265673_1265913_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1266007_1266721_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1267187:1267213	attL	TCACCGGGAGGCACCCGGCACCATGCA	NA	NA	NA	NA
WP_000874392.1|1267488_1269339_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001303878.1|1270695_1271010_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1271537_1271723_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1271944_1272058_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1272278_1272812_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1272971_1273244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1273499_1273706_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1274456_1274732_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1274807_1275188_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1275184_1275532_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1275581_1277120_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1277169_1277412_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_001302857.1|1277383_1279312_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1279295_1279502_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1279498_1281091_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1281080_1282586_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1282622_1282970_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1283027_1283294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1283275_1284016_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1284029_1284461_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1284487_1284901_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|1284881_1286744_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_010904726.1|1286695_1287460_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000847304.1|1287456_1287786_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1287785_1288484_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1288494_1289238_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1289183_1289816_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|1290006_1290534_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_000515108.1|1290667_1294141_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|1294208_1294808_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|1294872_1296186_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|1296187_1296457_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1298730_1299849_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1299845_1301639_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1301657_1302365_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1302361_1302949_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063969.1|1302945_1303344_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004940.1|1303340_1304198_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263572.1|1304331_1305876_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460778.1|1305887_1307024_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1307036_1307129_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001301957.1|1307208_1308513_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208668.1|1308632_1310813_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1310832_1311279_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1311266_1312406_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742329.1|1312451_1314548_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038071.1|1314547_1315294_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001301846.1|1315290_1315935_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001299283.1|1316041_1316347_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1316788_1317001_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1317286_1317499_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1317509_1317698_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001303885.1|1317672_1317903_+	protein YmcE	NA	NA	NA	NA	NA
WP_050554528.1|1317930_1318065_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818441.1|1318113_1319187_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054754.1|1319258_1322003_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_001264927.1|1322085_1323114_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120119.1|1323086_1323779_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230236.1|1323908_1325081_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063176.1|1325080_1327627_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000209883.1|1327623_1328223_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1328376_1328682_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420639.1|1328681_1329602_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_001044286.1|1331409_1332651_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|1332688_1332916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607020.1|1332936_1333515_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013654.1|1333511_1334822_-|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|1334874_1335159_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|1335244_1335544_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|1336519_1336807_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1336808_1337027_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|1337028_1337244_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|1337245_1337434_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|1337585_1338359_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000774248.1|1338355_1338577_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|1338675_1338957_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1338967_1339159_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1339131_1339314_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1339313_1339991_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1339987_1340773_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1340778_1341075_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1341150_1341294_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198863.1|1341262_1341427_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000065377.1|1341499_1341868_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|1342018_1342489_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1342547_1342931_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000957426.1|1343586_1344633_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1344626_1345088_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1345155_1345497_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1345557_1346265_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1346343_1346571_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|1346709_1347006_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|1347038_1347977_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|1347973_1348675_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1348671_1348962_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1349032_1349311_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|1349442_1349658_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_000814575.1|1349862_1350309_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|1350305_1350833_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000335902.1|1351014_1352064_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|1352215_1352938_+	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107955.1|1352937_1353543_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|1353539_1353734_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|1353726_1354161_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|1354944_1355904_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1355915_1356185_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|1356671_1358609_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
1356382:1356408	attR	TCACCGGGAGGCACCCGGCACCATGCA	NA	NA	NA	NA
WP_000143458.1|1358743_1358923_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1358963_1359236_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1359312_1359528_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1359532_1360066_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1360336_1360906_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1360905_1361052_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_015971382.1|1361279_1361465_+	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000738505.1|1361555_1361849_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1361998_1362202_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|1362257_1363064_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1363044_1364751_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1364750_1366895_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1367052_1368060_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1368083_1369298_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1369353_1369743_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1369792_1370254_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1370237_1370801_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|1370800_1371451_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000117994.1|1371447_1373385_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1373386_1373656_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1373795_1373984_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|1374278_1375904_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|1375900_1377169_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1377183_1377462_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1377467_1378085_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1378175_1378910_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1379142_1379283_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1379339_1379741_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1379834_1380491_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1380493_1380940_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1380949_1381201_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1381211_1382477_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331673.1|1382546_1390928_+	hypothetical protein	NA	A0A0P0ZCJ1	Stx2-converting_phage	100.0	0.0e+00
WP_000756595.1|1391478_1391823_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|1391942_1392155_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|1392388_1392784_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001289938.1|1392783_1393683_-	DUF551 domain-containing protein	NA	A0A0P0ZBW5	Stx2-converting_phage	100.0	4.5e-175
WP_000763352.1|1393679_1393901_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	100.0	2.2e-35
WP_000203859.1|1393948_1394578_-	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_001273654.1|1395567_1395675_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|1395757_1397086_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|1397106_1397601_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 5
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	1626385	1749786	5547323	tRNA,integrase,portal,protease,lysis,transposase,tail,holin,head,capsid,terminase	Enterobacteria_phage(34.21%)	156	1617045:1617060	1753762:1753777
1617045:1617060	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
WP_000952736.1|1626385_1627207_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1627362_1628409_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1628405_1629200_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1629366_1630485_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1630453_1630723_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1630784_1631174_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1631306_1631822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1631936_1632089_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1632404_1632881_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1633005_1633329_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1633312_1633738_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1633806_1634844_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1634755_1635298_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1635331_1636048_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1636044_1636362_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1636358_1636661_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1636650_1636968_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1636921_1637239_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1637225_1637663_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1637664_1637856_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1637858_1638446_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1638561_1638666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1638854_1639067_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1639234_1639513_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1639514_1640564_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1640576_1640951_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1640947_1641769_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1642365_1642533_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|1642847_1644785_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1644932_1645115_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1645152_1645422_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1645497_1645713_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1645717_1646062_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1646112_1646646_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1646916_1647486_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1647485_1647632_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1647859_1648066_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1648130_1648355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1648711_1648852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1648981_1649167_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1649208_1649574_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1649863_1650427_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1650423_1652085_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1652148_1654086_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063095.1|1654130_1654352_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000267292.1|1654297_1656799_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1656878_1657205_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1657214_1657565_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1657561_1658008_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1658004_1658349_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275506.1|1658407_1659124_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_001030063.1|1659129_1659504_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1659599_1659809_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001179478.1|1661275_1661974_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|1661990_1662245_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1662354_1662465_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1662767_1663646_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1663699_1664437_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1664382_1664619_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1664631_1664721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1664740_1667089_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1667679_1671081_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1673184_1673310_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1673389_1673665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1673725_1675087_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1675450_1676314_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1676297_1677434_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1677683_1678910_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1678958_1680080_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085257.1|1680328_1681558_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|1681922_1682111_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|1682168_1682912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|1682937_1683135_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|1683127_1683313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|1683312_1683504_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|1683493_1683736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|1683741_1684041_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|1684037_1686170_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|1686540_1686792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|1686788_1687199_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|1687209_1687482_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|1687606_1687831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|1688123_1689281_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|1689320_1689893_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000267612.1|1689894_1691106_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_001020660.1|1691102_1691441_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|1691437_1691734_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|1691733_1692174_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|1692157_1692340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1692463_1692820_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|1692803_1694465_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|1694478_1694760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1695616_1697077_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1697076_1697748_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1697916_1699287_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1699290_1699932_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1699967_1701074_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1701127_1701589_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1701598_1702252_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1702423_1703674_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1703787_1704930_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1704919_1705156_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1705259_1706084_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1706080_1706782_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1706778_1707081_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1707148_1707481_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1707545_1707668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1707725_1709252_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1709753_1710209_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1710208_1710379_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1710371_1710662_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1710658_1711021_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1711017_1711158_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1711154_1711844_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1712165_1712471_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1712457_1712934_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1713150_1713333_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1713423_1713717_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1714008_1714419_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1714704_1714911_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1715075_1715270_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1715658_1716204_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1716178_1718104_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1718100_1718307_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1718303_1719905_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1719885_1721205_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1721214_1721547_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1721602_1722628_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1722669_1723068_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1723079_1723433_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1723444_1724023_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1724019_1724415_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1724422_1725163_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1725178_1725601_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1725582_1726017_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1726009_1728559_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1728555_1728885_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1728884_1729583_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1729588_1730332_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1730268_1730901_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1730961_1734360_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|1734426_1735026_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|1735090_1738006_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|1738005_1738587_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|1738706_1739597_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1739615_1740122_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1740158_1740659_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1740737_1740920_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1741417_1742086_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1742142_1742391_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1742466_1742847_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1742843_1743191_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1743240_1744779_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1745081_1746566_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1746752_1747706_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_085948178.1|1748573_1749786_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1753762:1753777	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	1842734	1940675	5547323	integrase,portal,transposase,tail,holin,head,capsid,terminase	Escherichia_phage(30.19%)	125	1835460:1835473	1852196:1852209
1835460:1835473	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|1842734_1843865_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1843842_1844091_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1844155_1846627_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1846719_1846911_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1846907_1847096_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|1847432_1847576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1847569_1847803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1847780_1848188_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1848210_1848429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1848501_1848801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1849064_1849472_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1849548_1849776_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1849759_1850311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1850282_1851323_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1851234_1851777_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1851963_1852545_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
1852196:1852209	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|1852541_1852706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1853404_1854163_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1854441_1854654_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1854874_1855132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1855201_1855480_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1855481_1856528_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1856540_1856900_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1856908_1857439_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1857680_1857878_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1858028_1859087_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1859883_1861737_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1861886_1862102_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1862106_1862451_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1862501_1863035_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1863305_1863875_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1863874_1864021_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1864248_1864434_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1864858_1865086_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1865127_1865493_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1865782_1866346_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|1866342_1868004_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1868067_1870005_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|1870049_1870271_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|1870216_1872796_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|1872798_1873125_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1873134_1873485_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1873481_1873928_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1873924_1874269_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275438.1|1874334_1875051_+|tail	major tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.3	2.0e-125
WP_000710962.1|1875065_1875440_+|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001453698.1|1875535_1875745_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|1875797_1878878_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|1878870_1879212_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|1879211_1879649_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|1879836_1883097_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|1883099_1883315_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|1883382_1883982_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|1884046_1885270_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|1885271_1885541_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|1886940_1887591_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|1888173_1889712_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1889761_1890109_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1890105_1890486_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|1891448_1891763_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|1892401_1893646_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|1893738_1893927_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1893923_1894112_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|1894676_1894886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1894886_1895525_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|1895536_1895689_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|1895981_1896320_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1896711_1896954_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|1896937_1897363_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|1897431_1898475_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|1898467_1898929_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|1898962_1899679_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|1899711_1899993_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1899989_1900217_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1900209_1900521_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|1900648_1900867_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1900868_1901426_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1901659_1901872_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1901991_1902336_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1902457_1902730_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1902731_1903781_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|1903793_1904099_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|1904161_1904716_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1904940_1905138_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1905273_1905987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|1906437_1906869_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|1907346_1909197_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|1909644_1909851_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|1909855_1910200_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1910250_1910784_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1911055_1911625_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|1911624_1911771_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1911993_1912179_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1912704_1913019_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1913100_1913325_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|1913711_1914257_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|1914231_1916157_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|1916153_1916360_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1916356_1917958_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1917938_1919258_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1919267_1919600_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1919655_1920681_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1920722_1921121_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1921132_1921486_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1921500_1922034_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1922030_1922426_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1922433_1923186_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1923199_1923622_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1923648_1924062_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|1924042_1926655_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|1926651_1926981_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1926980_1927679_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1927689_1928433_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1928378_1929008_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514945.1|1929248_1932728_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|1932795_1933395_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|1933459_1934683_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|1934684_1934954_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|1935067_1935643_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1935715_1936345_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|1936426_1937068_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_016241229.1|1937229_1937544_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1937603_1938887_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1938975_1940436_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1940471_1940675_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	2122642	2180360	5547323	tRNA,integrase,tail,holin,head,capsid,terminase	Escherichia_phage(42.19%)	69	2119100:2119115	2179521:2179536
2119100:2119115	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2122642_2123077_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2123657_2124299_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2124380_2125010_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2125082_2125658_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2125770_2126040_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2126041_2127355_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2127419_2128019_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2128089_2131587_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2131720_2132248_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2132438_2133071_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2133016_2133760_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2133770_2134469_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2134468_2134810_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2134802_2137883_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2137934_2138144_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2138239_2138614_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2138619_2139336_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2139404_2139749_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2139745_2140192_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2140188_2140539_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2140548_2140875_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2143401_2143623_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2143667_2145605_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2145668_2147330_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2147326_2147890_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2148178_2148544_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2148585_2148786_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2148917_2149244_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2149644_2149830_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2150052_2150184_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2150278_2150974_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2151247_2151781_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2151831_2152176_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2152180_2152396_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_021497500.1|2152545_2154399_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2154973_2155405_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2155966_2156521_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2156517_2156808_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2156807_2157407_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2157906_2159298_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2159297_2160287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2160254_2161406_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2161837_2162083_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2162161_2162323_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2162333_2162597_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2162848_2163061_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2163166_2163589_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2163604_2164366_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2164388_2165135_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2165141_2165930_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2166007_2166430_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2166426_2166681_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2166760_2167180_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2167422_2167602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2167612_2167768_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2167764_2168253_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2168694_2168916_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2168915_2169086_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2169160_2169436_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2169537_2172138_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2172130_2172940_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2172995_2173145_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2173182_2173371_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2173470_2173686_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2173687_2174923_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2174974_2175910_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2176038_2177412_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2177889_2178873_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2179127_2180360_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2179521:2179536	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 8
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	2265306	2342885	5547323	portal,capsid,transposase,tail,holin,head,protease,terminase	Stx2-converting_phage(43.86%)	76	NA	NA
WP_000422055.1|2265306_2266356_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2266575_2267334_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2267330_2267921_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2267960_2268833_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2269045_2270629_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2270656_2271277_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2271273_2272155_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2272292_2272337_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2272428_2273991_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2273990_2275586_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2275589_2276948_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2276959_2278153_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2278152_2278959_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2279339_2279519_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2279604_2280105_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2280150_2280657_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|2281158_2281377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2284127_2284718_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2284901_2285549_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2285685_2285832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2286259_2286538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2286877_2287258_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2287254_2287602_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2287651_2289190_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2290155_2290725_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2290790_2291702_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2291808_2291931_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2293528_2294854_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2295880_2296150_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2296151_2297465_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2297616_2298216_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2298283_2300629_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2300580_2301756_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2302097_2302730_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2302675_2303419_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2303429_2304128_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2304127_2304469_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2304461_2307704_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2307751_2307961_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2308056_2308431_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2308445_2309162_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2309227_2309572_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2309568_2310015_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2310011_2310362_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2310371_2310698_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2310700_2313280_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001411754.1|2313225_2313387_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.1	2.4e-23
WP_158414468.1|2318651_2319116_-	hypothetical protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.9e-65
WP_000133388.1|2319181_2319526_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000125988.1|2320327_2320654_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063094.1|2323183_2323405_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2323449_2325387_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|2325450_2327112_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|2327108_2327672_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2327961_2328327_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2328368_2328596_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2329020_2329206_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2329433_2329580_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2329579_2330149_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2330419_2330953_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2331003_2331348_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2331352_2331559_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|2332007_2333858_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2334336_2334765_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2335405_2336095_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2336091_2336451_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2336463_2337513_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2337514_2337793_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2337960_2338173_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2338361_2338466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2338581_2339166_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2339222_2339618_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2340428_2341169_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2341175_2342138_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2342160_2342586_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2342582_2342885_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	2649833	2707572	5547323	tRNA,integrase,tail,transposase	Enterobacteria_phage(60.0%)	63	2649677:2649692	2707651:2707666
2649677:2649692	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_000564730.1|2649833_2650805_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176813.1|2650969_2653399_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214277.1|2653423_2654524_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185748.1|2654911_2655658_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|2655671_2656238_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|2656453_2658187_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2658363_2658852_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2658971_2659364_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2659363_2661442_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2661434_2662583_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2662784_2663429_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2663439_2663829_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2663843_2664893_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2664895_2665756_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2665774_2667376_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2667421_2669083_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2669225_2669729_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2669749_2671714_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2671718_2672645_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2672641_2673529_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2673655_2674234_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2674236_2674587_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2675366_2675795_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089030.1|2675801_2677226_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2677200_2678001_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001187796.1|2679168_2680683_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	9.6e-13
WP_000548680.1|2680752_2681742_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2682538_2683042_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2683121_2683373_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2683487_2683574_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2683835_2684159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2684329_2684827_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2684863_2685103_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2685294_2686506_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2686567_2687233_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2687589_2688591_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2688596_2688944_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2688973_2689624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2689639_2690044_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2690133_2690271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2690342_2690546_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2690567_2690918_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2690928_2691207_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2691218_2691461_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2691457_2691571_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2691663_2692080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2692103_2692307_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2692303_2692570_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2692566_2692866_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001413181.1|2692877_2693495_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000599379.1|2693491_2693857_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2693863_2696686_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686531.1|2696762_2697722_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|2697726_2698041_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2699246_2699663_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2699706_2700279_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2700435_2700924_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2703726_2703855_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2703890_2704256_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2704310_2704823_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2704822_2706007_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2706164_2706488_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161728.1|2706438_2707572_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
2707651:2707666	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	2765152	2832370	5547323	portal,integrase,transposase,tail,holin,head,terminase	Escherichia_phage(34.04%)	69	2799875:2799889	2812145:2812159
WP_001023407.1|2765152_2765422_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268861.1|2765423_2766737_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001230508.1|2766801_2767401_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_115801853.1|2767468_2769820_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001413764.1|2769771_2770947_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_127446151.1|2771187_2771817_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2771762_2772506_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|2772516_2773215_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2773214_2773544_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082450.1|2773540_2776120_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|2776100_2776514_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2776540_2776972_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2776985_2777726_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2777707_2777974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2778031_2778379_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2778415_2779921_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2779910_2781503_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2781499_2781706_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2781689_2783618_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2783589_2784099_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2784493_2784718_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2784799_2785114_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2785640_2785826_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2786053_2786185_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2786197_2786380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2786535_2787069_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2787119_2787464_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2787468_2787675_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2787994_2789207_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2789289_2791140_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2791617_2792046_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2792679_2793369_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2793365_2793725_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2793737_2794787_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2794788_2795067_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2795234_2795447_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2795633_2795738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2795847_2796411_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2796537_2796849_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2796845_2796998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2797030_2797387_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2797383_2797608_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2797629_2798328_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2798362_2798905_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2798816_2799854_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
2799875:2799889	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000693816.1|2799922_2800348_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2800344_2800572_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2800669_2801314_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2801588_2801741_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2802221_2802410_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2802406_2802595_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2802690_2805162_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2805220_2805424_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2805423_2806446_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2806681_2807479_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2807968_2815951_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
2812145:2812159	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000480501.1|2816212_2817265_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2817578_2818895_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2818996_2820451_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2820793_2821510_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2823896_2824847_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2824948_2825866_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2826322_2827258_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2827319_2828399_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2828410_2829154_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2829150_2829696_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2830057_2830438_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2830434_2830782_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2830831_2832370_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 11
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	2929409	3034598	5547323	tRNA,portal,integrase,transposase,tail,holin,protease,terminase	Enterobacteria_phage(63.1%)	121	2984224:2984244	3032104:3032124
WP_000476014.1|2929409_2930771_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|2931100_2931418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2931823_2932723_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|2932804_2933584_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2933683_2934724_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2934771_2936127_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2936130_2936415_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2936445_2936898_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|2936907_2938170_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|2938198_2939053_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2939351_2940404_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|2940660_2941938_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|2941934_2942939_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|2942935_2943901_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2943874_2944621_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|2944672_2945491_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|2945555_2946356_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|2946352_2947141_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2947474_2947714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2948764_2949112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2949121_2949436_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|2949545_2949818_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|2949938_2950790_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|2951007_2951346_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|2951427_2952462_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|2952472_2954953_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677408.1|2954968_2955643_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|2955730_2956273_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|2956564_2956846_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|2957107_2958217_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|2958348_2960382_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|2964344_2965625_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|2965788_2967330_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|2967339_2970969_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2971030_2971348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2972588_2973677_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2973687_2975217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2975235_2975967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2975959_2977096_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_085953806.1|2979136_2980350_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001295429.1|2980533_2980995_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2981036_2981507_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2981553_2982273_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2982269_2983955_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2984224:2984244	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2984469_2984718_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023431.1|2985085_2985355_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_000268835.1|2985356_2986670_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001228289.1|2986734_2987334_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_115801855.1|2987401_2989747_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001356361.1|2989698_2990874_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_072147834.1|2991114_2991744_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2991689_2992433_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2992443_2993142_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2993141_2993471_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2993467_2996113_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|2996156_2996465_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2996491_2996914_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2996927_2997680_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2997687_2998086_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2998098_2998722_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2998724_2999006_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2998998_2999325_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_085948178.1|3000574_3001787_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000974564.1|3002694_3004197_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|3004196_3004409_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|3004405_3006529_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3006525_3007002_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3007034_3007307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3007518_3007704_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3007931_3008078_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3008077_3008647_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3008917_3009451_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3009455_3009671_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3009748_3009994_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3010034_3010214_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874257.1|3010351_3012298_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|3012808_3013078_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3013087_3014035_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3014541_3014976_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3014968_3015163_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107983.1|3015159_3015765_-	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_001543885.1|3015757_3015967_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_000924601.1|3015926_3016328_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3016330_3016507_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153268.1|3016503_3017031_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001304104.1|3017027_3017474_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|3017430_3017667_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|3017677_3017893_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3018025_3018304_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3018374_3018665_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788906.1|3018661_3019363_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000185456.1|3019359_3020298_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000035953.1|3020330_3020627_-	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_001033078.1|3020741_3020960_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|3021068_3021716_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|3021838_3022120_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|3022126_3022678_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|3023190_3023463_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|3023479_3024061_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|3024321_3024690_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|3024762_3024927_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372942.1|3024895_3025039_+	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_000995395.1|3025114_3025411_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3025416_3026202_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3026198_3026876_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3026875_3027058_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3027030_3027222_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3027232_3027514_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3027612_3027834_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3027830_3028778_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3028779_3028956_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3029289_3029646_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3029642_3030005_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3030092_3030335_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3030338_3030473_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3030491_3030746_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3030779_3032066_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3032086_3032788_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3032104:3032124	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3032847_3032955_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3032935_3033667_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3033671_3034598_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	3278904	3284291	5547323	integrase	Enterobacteria_phage(50.0%)	6	3269355:3269371	3281319:3281335
3269355:3269371	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3278904_3279837_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3280148_3281306_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3281480_3282617_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3281319:3281335	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3282626_3283307_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3283293_3283761_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3283760_3284291_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 13
NZ_CP008957	Escherichia coli O157:H7 str. EDL933 chromosome, complete genome	5547323	3524578	3578950	5547323	tRNA,holin,tail,transposase	Stx2-converting_phage(27.27%)	56	NA	NA
WP_000997403.1|3524578_3525616_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3525822_3526242_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3526310_3527009_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3527040_3529701_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3529814_3531170_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464871.1|3531194_3531539_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3531535_3532834_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3538607_3541181_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3541310_3542042_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3542038_3543019_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3543153_3543891_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3544161_3544503_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3544606_3544654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3544752_3545913_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3545955_3547077_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3547087_3548158_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3548367_3548733_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3548882_3549401_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3549390_3550617_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3550632_3551115_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3551191_3551539_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3551580_3552348_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3552378_3552927_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3552945_3553194_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3553330_3554692_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3554783_3555650_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626964.1|3555671_3556958_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3557012_3557606_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3557728_3558607_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3558692_3560354_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3560502_3560844_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3560905_3561196_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3561185_3561662_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3561793_3562276_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3563121_3563370_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3563871_3564462_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3564644_3565295_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3565373_3566432_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3566561_3566984_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_032178067.1|3567144_3567282_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	1.7e-14
WP_085948178.1|3567319_3568532_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077766655.1|3568498_3568732_+	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	100.0	2.8e-20
WP_001299612.1|3568728_3569619_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|3569425_3570070_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|3570119_3570467_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3570463_3570844_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3571200_3571545_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3571549_3571765_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3571914_3573768_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3574175_3574343_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3574428_3575172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3575424_3576048_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3576044_3576710_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3576706_3577318_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3577292_3577859_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3578194_3578950_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP008958	Escherichia coli O157:H7 str. EDL933 plasmid unnamed, complete sequence	92076	52416	60572	92076	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	48986:48999	54938:54951
48986:48999	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|52416_53223_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_085948178.1|53309_54523_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071525396.1|54484_54823_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|55410_56577_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
54938:54951	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|56576_57548_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|58847_60572_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
