The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007443	Bifidobacterium adolescentis strain 22L chromosome, complete genome	2203222	1493241	1532157	2203222	portal,tail,terminase,integrase,holin	Bifidobacterium_phage(45.0%)	56	1492291:1492314	1532294:1532317
1492291:1492314	attL	AATCGTTGGAATGAAGCCGTTTCT	NA	NA	NA	NA
WP_038444705.1|1493241_1493475_-|holin	holin	holin	NA	NA	NA	NA
WP_051872044.1|1493509_1494802_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A220NQR5	Corynebacterium_phage	31.6	6.5e-10
WP_038444706.1|1494944_1495331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173401850.1|1495467_1495902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444707.1|1497372_1498953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444708.1|1498964_1499363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051872125.1|1499543_1500347_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	26.1	1.8e-05
WP_158332671.1|1500477_1500651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038444709.1|1500690_1500987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038444710.1|1500983_1501319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444711.1|1501343_1502126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444712.1|1502122_1502374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051872046.1|1502373_1503939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444713.1|1503905_1504760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444714.1|1504746_1508154_-|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	47.6	1.3e-137
WP_038444715.1|1508171_1508447_-	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	45.2	2.6e-09
WP_038444717.1|1508497_1509007_-	hypothetical protein	NA	I3NL92	Bifidobacterium_phage	38.7	4.8e-17
WP_038444718.1|1509110_1509629_-	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	50.3	2.9e-41
WP_038444719.1|1509652_1510057_-	hypothetical protein	NA	I3NL94	Bifidobacterium_phage	44.0	2.0e-21
WP_038444721.1|1510068_1510452_-	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	43.2	3.1e-16
WP_080716525.1|1510448_1510862_-	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	65.9	3.3e-24
WP_038444723.1|1510858_1511443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444725.1|1512427_1513018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051872050.1|1513029_1514235_-	hypothetical protein	NA	A0A1C9EHV4	Gordonia_phage	35.1	2.8e-31
WP_051872052.1|1514128_1515649_-|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	33.8	3.9e-70
WP_038444727.1|1515649_1516303_-|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	51.0	6.8e-56
WP_148304133.1|1516304_1516628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051872053.1|1516672_1517374_-	DUF4417 domain-containing protein	NA	A0A1P8VVM8	Streptococcus_phage	48.1	4.4e-53
WP_038444731.1|1517402_1518521_-	hypothetical protein	NA	A0A1C9EHW4	Gordonia_phage	55.1	3.7e-110
WP_021913321.1|1518522_1519074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913320.1|1519422_1519815_-	hypothetical protein	NA	A0A2P1JVL8	Mycobacterium_phage	38.4	1.0e-11
WP_038444734.1|1520131_1520899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913203.1|1520936_1521089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913201.1|1521195_1521567_-	DUF3310 domain-containing protein	NA	K4NXV7	Acinetobacter_phage	42.4	2.8e-06
WP_021913200.1|1521559_1521715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444736.1|1521711_1522119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444738.1|1522115_1522388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913196.1|1522544_1523018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913194.1|1523172_1523475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913193.1|1523499_1523793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913192.1|1523789_1524293_-	hypothetical protein	NA	A0A142KCP9	Gordonia_phage	47.5	9.0e-24
WP_021913191.1|1524431_1525004_-	hypothetical protein	NA	I3NLB8	Bifidobacterium_phage	50.5	1.3e-42
WP_038444742.1|1525005_1525359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444744.1|1525378_1525645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051872057.1|1525641_1526598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913280.1|1526618_1527026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444747.1|1527025_1527571_-	single-stranded DNA-binding protein	NA	I3NLC3	Bifidobacterium_phage	54.5	5.7e-48
WP_038444749.1|1527579_1528182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038444751.1|1528485_1528743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913276.1|1528739_1528934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913275.1|1528935_1529136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913274.1|1529156_1529366_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_021913273.1|1529380_1529623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021913272.1|1529744_1530104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021913271.1|1530188_1530848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038444753.1|1530888_1532157_-|integrase	site-specific integrase	integrase	A0A2P1CI94	Actinomyces_phage	33.1	1.6e-32
1532294:1532317	attR	AATCGTTGGAATGAAGCCGTTTCT	NA	NA	NA	NA
