The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007627	Flavobacterium psychrophilum strain CSF259-93 chromosome, complete genome	2900735	569728	684901	2900735	integrase,transposase	uncultured_virus(15.38%)	85	618387:618446	670378:670624
WP_016361990.1|569728_570931_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011962621.1|571018_571642_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011962622.1|571807_572632_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011962623.1|572733_573534_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011962624.1|573687_574074_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011962625.1|574073_574529_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011962626.1|575328_577749_-	ribonucleoside-diphosphate reductase subunit alpha	NA	Q8QMY6	Cowpox_virus	63.7	5.4e-292
WP_011962627.1|578085_579063_-	ribonucleoside-diphosphate reductase	NA	A0A1B4X9B4	Tenacibaculum_phage	77.6	4.7e-146
WP_011962628.1|579310_579880_-	DUF3109 family protein	NA	NA	NA	NA	NA
WP_011962629.1|580105_580684_+	MarC family protein	NA	NA	NA	NA	NA
WP_011962630.1|580722_580926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011962631.1|580925_581534_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011962632.1|581579_583154_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.1	3.4e-21
WP_011962633.1|583227_583656_-	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	45.7	1.9e-30
WP_011962634.1|583836_584430_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_011962635.1|584574_585006_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_011962636.1|585051_585876_-	universal stress protein	NA	NA	NA	NA	NA
WP_011962637.1|586058_586523_+	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_011962638.1|586538_587780_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011962639.1|587833_590737_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	1.0e-23
WP_034100109.1|597704_598550_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_011964284.1|598655_599042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100111.1|599081_599276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964283.1|600979_601357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964245.1|603353_603581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964282.1|603776_604472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964281.1|604655_605114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117601869.1|605793_606681_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|606689_607001_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011964280.1|607447_607648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964279.1|607888_609037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162263851.1|609195_610665_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011964278.1|611424_612912_+	serine hydrolase	NA	Q19XB5	Mycobacterium_phage	27.9	3.4e-10
WP_011964276.1|613395_614487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964275.1|616415_617129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016361990.1|617384_618587_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
618387:618446	attL	ACAAATTTAATAGAAAATTTAAATGGAAAAATTAGAAAATACACTAAAAATAAAATGTCA	NA	NA	NA	NA
WP_011964274.1|618832_619651_-	phage protein	NA	S5Z6N6	Mycobacterium_phage	27.2	2.0e-17
WP_162179057.1|619652_620513_-	AAA family ATPase	NA	A0A220BZX1	Staphylococcus_phage	41.0	2.8e-49
WP_117601869.1|620693_621581_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|621589_621901_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052193140.1|621988_622588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964270.1|622830_623112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011964269.1|623209_625303_+	hypothetical protein	NA	M1NXJ3	Cellulophaga_phage	40.0	2.4e-70
WP_011964268.1|625862_627599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964267.1|627730_629569_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_034100123.1|629568_631677_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_034100126.1|632005_633637_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.7	7.6e-48
WP_034100128.1|633691_634690_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.8	9.9e-83
WP_011964263.1|634847_637541_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011964262.1|637618_640561_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	21.7	3.3e-09
WP_011964261.1|640725_641484_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016361983.1|641746_642058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|642066_642954_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_034100130.1|643155_644010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100132.1|644012_644432_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_034100133.1|644496_644988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100135.1|645085_645889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100137.1|645957_646410_+	hypothetical protein	NA	A0A2I7RVN5	Vibrio_phage	30.5	5.2e-07
WP_034100139.1|646422_646686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100141.1|646675_646918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100466.1|647092_647515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100145.1|648999_651312_-	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	28.6	1.4e-66
WP_034100147.1|651313_653443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100148.1|653443_654643_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_034100150.1|654635_656573_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_038509094.1|656574_659274_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.1	2.8e-156
WP_034100152.1|659315_660329_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	30.6	1.3e-37
WP_034100153.1|660780_662874_-	DUF3874 domain-containing protein	NA	M1NXJ3	Cellulophaga_phage	40.1	2.2e-68
WP_011964270.1|662982_663264_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034100155.1|663408_664317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100157.1|664610_665828_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.2	4.1e-14
WP_011964259.1|666377_667580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964258.1|667884_669057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162179056.1|669177_670227_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_086438997.1|670536_671520_+|transposase	transposase	transposase	NA	NA	NA	NA
670378:670624	attR	TGACATTTTATTTTTAGTGTATTTTCTAATTTTTCCATTTAAATTTTCTATTAAATTTGTGGTTTAATAGTCAAAAATAGTTGGTAAAAACCTTTCTAGTCACTATAAAATATGATGTTTCCAAAAGTTTATTGAAATTCGTTTCAATAAACTTTTTTTATTTATGAAAAACTCAAAAAAAAGCGTTGTCCAACGTGTAAAAGTCTTCAAACTATTAAATGGGGAATCCAGCAAAATAAGCAACGAT	NA	NA	NA	NA
WP_011964256.1|674092_675250_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.0	1.5e-13
WP_016361987.1|675436_676639_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964255.1|677512_677986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964254.1|677987_678296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162179055.1|678672_679098_+	TonB family protein	NA	NA	NA	NA	NA
WP_011964252.1|679362_680037_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_011964251.1|680049_680640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964250.1|681061_681829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964249.1|682657_683404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016361990.1|683698_684901_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
>prophage 2
NZ_CP007627	Flavobacterium psychrophilum strain CSF259-93 chromosome, complete genome	2900735	1396770	1445380	2900735	protease,integrase,transposase	Bacillus_phage(66.67%)	30	1391153:1391174	1416660:1416681
1391153:1391174	attL	AGATATTCCAAAAGAAAATATT	NA	NA	NA	NA
WP_016362010.1|1396770_1398015_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.1	9.3e-38
WP_011963658.1|1398055_1398895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963657.1|1398901_1399867_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011963656.1|1399964_1401122_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_162179050.1|1401154_1401301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963654.1|1401318_1402542_+	MFS transporter	NA	NA	NA	NA	NA
WP_011963653.1|1403003_1403852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963652.1|1403963_1404251_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011963651.1|1404258_1405119_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011963650.1|1405204_1405831_+	ATPase	NA	NA	NA	NA	NA
WP_162472442.1|1406627_1409867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162179081.1|1410104_1410851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963647.1|1410850_1411708_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_034100366.1|1411759_1413907_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011963645.1|1413908_1415069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100368.1|1415070_1417065_+	hypothetical protein	NA	NA	NA	NA	NA
1416660:1416681	attR	AGATATTCCAAAAGAAAATATT	NA	NA	NA	NA
WP_011963643.1|1417083_1418424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963642.1|1418393_1419041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963641.1|1419037_1422277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963640.1|1422280_1423120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117601869.1|1423134_1424022_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|1424030_1424342_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011963639.1|1427225_1427573_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011963638.1|1427565_1428462_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011963637.1|1428770_1432835_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_011963636.1|1433496_1434186_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	4.1e-27
WP_011963052.1|1441823_1443284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963053.1|1443280_1444588_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_117386929.1|1444751_1445021_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_051907069.1|1445053_1445380_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP007627	Flavobacterium psychrophilum strain CSF259-93 chromosome, complete genome	2900735	2438778	2446903	2900735		Enterobacteria_phage(16.67%)	6	NA	NA
WP_011963425.1|2438778_2439660_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.8	6.0e-100
WP_011963426.1|2439728_2440775_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.5	1.3e-85
WP_011963427.1|2440781_2442158_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	31.6	4.7e-59
WP_011963428.1|2442189_2443461_-	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	26.4	6.2e-21
WP_011963429.1|2443471_2444452_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.9	2.7e-85
WP_011963430.1|2444455_2446903_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.3	2.1e-17
