The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007719	Brucella suis bv. 3 str. 686 chromosome 1, complete sequence	2107052	1460139	1525788	2107052	protease,transposase	Tupanvirus(16.67%)	58	NA	NA
WP_004690613.1|1460139_1461552_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002963624.1|1461693_1462320_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_004690614.1|1462720_1463608_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_004690615.1|1463745_1465404_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	36.3	3.2e-09
WP_004683128.1|1465631_1466579_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_004683131.1|1466578_1466764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004690616.1|1466783_1467389_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_004690617.1|1467597_1468476_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_004688061.1|1468589_1468973_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_004683138.1|1468969_1469719_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_004690618.1|1469827_1470868_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004690619.1|1470873_1471854_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002963635.1|1471850_1472315_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.6	1.7e-40
WP_002963636.1|1472344_1472830_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	46.8	3.0e-24
WP_004690620.1|1473009_1473810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683145.1|1473944_1474547_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_004690621.1|1474660_1477555_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002963640.1|1477551_1478172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004690622.1|1478342_1479635_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	28.1	1.1e-33
WP_004690623.1|1479688_1481080_-	threonine synthase	NA	NA	NA	NA	NA
WP_004690624.1|1481159_1481411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004690625.1|1481561_1482140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025198227.1|1482453_1484088_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004690627.1|1484216_1484402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004688072.1|1484443_1485130_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004688073.1|1485277_1487068_-	chloride channel protein	NA	NA	NA	NA	NA
WP_004689516.1|1487404_1488538_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	30.4	4.7e-28
WP_002963651.1|1488620_1489238_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004690628.1|1489234_1490311_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002971552.1|1490276_1490423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004689517.1|1490584_1491112_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002971551.1|1491349_1492003_+	DsbA family protein	NA	NA	NA	NA	NA
WP_004690629.1|1492081_1495540_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_004691958.1|1495562_1496456_+	cation transporter	NA	NA	NA	NA	NA
WP_002967466.1|1496565_1496907_-	glyoxalase	NA	NA	NA	NA	NA
WP_004691957.1|1497170_1499834_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.6	7.0e-91
WP_004690635.1|1501866_1502655_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_005969743.1|1502655_1503561_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004690636.1|1503761_1504361_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_004688080.1|1504514_1505024_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_004690637.1|1505035_1505392_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_004690638.1|1505462_1506299_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	45.2	2.5e-39
WP_004691955.1|1506835_1508704_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.4	4.2e-18
WP_004690639.1|1508690_1509698_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_129171622.1|1509579_1509852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004691954.1|1510356_1511175_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_077281772.1|1511786_1512137_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002963675.1|1513565_1514345_-	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_004691951.1|1514370_1515225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963677.1|1515221_1515980_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004683211.1|1515976_1516759_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004690643.1|1516773_1517877_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	2.0e-44
WP_024767981.1|1517884_1518976_-	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	68.9	4.5e-137
WP_029097245.1|1520098_1521037_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_002963682.1|1522236_1523355_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077281774.1|1524111_1524264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006072314.1|1524306_1524861_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144242537.1|1525025_1525788_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.7	4.0e-23
>prophage 3
NZ_CP007719	Brucella suis bv. 3 str. 686 chromosome 1, complete sequence	2107052	1851152	1863066	2107052	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_002968731.1|1851152_1852004_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_004690782.1|1851996_1852722_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.1e-43
WP_002964012.1|1852867_1853086_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_004686803.1|1853196_1853778_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_004690783.1|1853774_1854599_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	40.7	1.7e-43
WP_004690784.1|1854675_1855959_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	3.5e-104
WP_004683703.1|1856107_1856875_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|1856871_1857540_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|1857684_1857870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004690785.1|1857918_1859217_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964020.1|1859265_1860132_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|1860291_1860633_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_080546505.1|1860750_1863066_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.1e-51
>prophage 4
NZ_CP007719	Brucella suis bv. 3 str. 686 chromosome 1, complete sequence	2107052	1934856	1944891	2107052	transposase,integrase	Brucella_phage(37.5%)	15	1934739:1934779	1949854:1949894
1934739:1934779	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_004690811.1|1934856_1935882_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	37.8	1.6e-48
WP_004690812.1|1935868_1936072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971459.1|1936074_1936290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|1936286_1936490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006072696.1|1936539_1937259_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.6e-05
WP_002964091.1|1937255_1937486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1937482_1937758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683738.1|1937780_1938368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|1938602_1939313_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002964095.1|1939660_1939831_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_002964097.1|1940178_1940493_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	43.4	6.9e-06
WP_004688321.1|1940492_1940738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080723468.1|1941578_1942335_+|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_006132649.1|1942336_1943110_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.3	2.9e-122
WP_004689673.1|1943244_1944891_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	62.0	1.3e-175
1949854:1949894	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
