The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	20289	28670	2265927		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005712132.1|20289_21609_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	33.7	1.5e-30
WP_005712135.1|21800_23675_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005712138.1|24144_25236_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.0	2.7e-49
WP_005712141.1|25237_25882_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.1	2.1e-41
WP_038513271.1|26013_27213_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.5	5.9e-98
WP_005712146.1|27305_27767_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.1	5.1e-42
WP_038513274.1|27878_28670_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	8.0e-11
>prophage 2
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	34458	43914	2265927		Mannheimia_phage(66.67%)	16	NA	NA
WP_038513278.1|34458_35262_-	antirepressor	NA	Q7Y5X0	Haemophilus_phage	42.8	4.9e-32
WP_015939641.1|35615_36071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015939642.1|36054_36252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005712166.1|36520_36901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010786204.1|37266_37479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712171.1|37497_37761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513285.1|37784_38504_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.8	7.5e-40
WP_010786201.1|38847_39036_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	50.0	7.4e-08
WP_038513288.1|39081_39561_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	52.9	1.0e-37
WP_038515078.1|39560_40220_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	81.3	1.8e-101
WP_038513294.1|40282_41200_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	86.9	7.3e-149
WP_038513297.1|41196_41403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513299.1|41389_41929_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	46.2	6.2e-23
WP_021115189.1|41925_42246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513306.1|42326_43130_-	antirepressor	NA	Q7Y5X0	Haemophilus_phage	47.7	4.1e-39
WP_005714998.1|43725_43914_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	49.1	1.8e-06
>prophage 3
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	48234	59745	2265927		Mannheimia_phage(36.36%)	13	NA	NA
WP_038513322.1|48234_48888_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	68.4	4.1e-69
WP_012621794.1|49023_49230_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	45.3	2.8e-08
WP_016528087.1|49569_49752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026916583.1|49729_50620_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	56.5	1.1e-80
WP_026916582.1|50619_51975_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	61.9	1.7e-154
WP_038515080.1|52073_52502_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	59.3	1.1e-43
WP_005715065.1|52535_52949_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	55.5	6.8e-38
WP_005715063.1|52975_53158_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	74.6	4.5e-18
WP_038513329.1|53404_53983_+	NinG recombination protein	NA	A0A0U4KL68	Pseudomonas_phage	55.3	2.9e-50
WP_051617452.1|53972_54437_+	antitermination protein	NA	A0A0M3LPW4	Mannheimia_phage	39.0	5.7e-17
WP_010786228.1|55498_57385_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.1	2.1e-110
WP_021115161.1|57490_58918_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_038515085.1|59124_59745_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.4	2.0e-25
>prophage 4
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	130783	169848	2265927	tail,transposase,terminase	Mannheimia_phage(75.0%)	42	NA	NA
WP_038513383.1|130783_131881_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005714898.1|132041_132227_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_035492359.1|132256_132694_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	36.9	1.8e-20
WP_021111021.1|134753_135119_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010786303.1|135186_135627_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005713993.1|135900_136725_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	1.1e-31
WP_010786302.1|136781_138068_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_005713996.1|138183_138909_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	6.4e-15
WP_021114788.1|139048_139984_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_038513397.1|140078_140819_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_038513400.1|141027_142011_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.3	1.0e-07
WP_038513404.1|142213_143221_-	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_038513407.1|143351_145010_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	35.1	4.5e-80
WP_005714008.1|145180_145768_-	azoreductase	NA	NA	NA	NA	NA
WP_038513409.1|145863_146916_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_035494232.1|146924_147323_-	acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_038513414.1|147382_148648_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_010786294.1|148905_149247_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035497983.1|149927_151025_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_035494818.1|151627_151891_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.6	1.3e-18
WP_038513418.1|151865_152411_+	lysozyme	NA	Q19UR6	Mannheimia_phage	48.6	1.3e-41
WP_080716950.1|152410_152728_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	64.4	7.7e-05
WP_080716922.1|152756_152906_+	lytic transglycosylase	NA	A0A0M3LSZ0	Mannheimia_phage	78.7	3.4e-16
WP_038513424.1|153292_153808_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	73.0	5.2e-59
WP_038513427.1|153791_155027_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	80.2	2.4e-195
WP_038513430.1|155036_156434_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	65.0	4.2e-164
WP_016527886.1|157987_158299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527887.1|158329_158719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714627.1|158913_159435_+	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	1.5e-34
WP_021109530.1|159559_160318_+	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	73.9	1.4e-76
WP_038513435.1|160329_161268_+	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	64.1	2.1e-114
WP_016527890.1|161353_161695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513439.1|161669_162131_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	57.2	6.1e-35
WP_016527892.1|162132_162483_+	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	51.3	7.4e-25
WP_038513442.1|162479_162893_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.0	6.0e-42
WP_021118479.1|162892_163294_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	50.8	1.7e-33
WP_038513445.1|163296_164301_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	72.8	4.3e-134
WP_005714383.1|164395_164800_+	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	64.2	1.3e-41
WP_005714384.1|164808_165144_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	65.4	1.0e-31
WP_005714385.1|165145_165472_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	64.5	1.4e-38
WP_021109522.1|165525_165786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513448.1|169110_169848_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.1	3.0e-68
>prophage 5
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	181871	190050	2265927		Mannheimia_phage(66.67%)	14	NA	NA
WP_012621817.1|181871_182090_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	77.8	5.2e-21
WP_038513471.1|182233_182497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021109857.1|182465_183110_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_035491341.1|183111_183894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513477.1|183930_184650_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	71.8	9.5e-35
WP_012621814.1|184996_185185_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	72.4	2.6e-13
WP_038513480.1|185230_185710_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	52.3	1.1e-36
WP_035497980.1|185709_186369_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	81.7	1.1e-101
WP_038513294.1|186431_187349_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	86.9	7.3e-149
WP_038513297.1|187345_187552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513299.1|187538_188078_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	46.2	6.2e-23
WP_021115189.1|188074_188395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052157554.1|188475_189075_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	54.9	2.0e-17
WP_016527556.1|189336_190050_-	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	44.7	7.2e-51
>prophage 6
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	193915	224378	2265927	tail,terminase	Mannheimia_phage(80.0%)	39	NA	NA
WP_038513492.1|193915_194572_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	74.2	1.2e-89
WP_016527920.1|194704_194911_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	61.8	6.7e-18
WP_016527921.1|195251_195977_+	Rha family transcriptional regulator	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	39.8	1.7e-28
WP_035494830.1|195973_196804_+	hypothetical protein	NA	A0A1X9SFR3	Acinetobacter_phage	37.4	5.4e-34
WP_052157555.1|196803_197475_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	37.7	5.2e-27
WP_080716923.1|197709_198159_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	60.0	7.0e-44
WP_038513497.1|198155_198506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513501.1|198649_199219_+	NinG recombination protein	NA	A0A0U4KL68	Pseudomonas_phage	55.1	1.8e-49
WP_038513503.1|199215_199593_+	antitermination protein	NA	Q7Y5V5	Haemophilus_phage	27.9	1.1e-07
WP_021116919.1|199601_199787_-	hypothetical protein	NA	A0A0R6PI59	Moraxella_phage	42.9	6.9e-06
WP_038513510.1|201610_202174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513512.1|202562_203108_+	lysozyme	NA	Q19UR6	Mannheimia_phage	47.9	7.9e-42
WP_080716950.1|203107_203425_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	64.4	7.7e-05
WP_080716925.1|203387_203591_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	73.4	9.8e-22
WP_035492539.1|203753_204206_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	57.9	1.1e-33
WP_038513516.1|204189_205413_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	82.1	2.2e-201
WP_035490840.1|205409_206786_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	81.0	1.7e-218
WP_051617422.1|206739_207678_+	chemotaxis protein	NA	A0A0M3LQH2	Mannheimia_phage	87.8	1.6e-151
WP_016527634.1|207664_209035_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	79.8	4.1e-204
WP_035490842.1|209027_209462_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	91.7	2.7e-69
WP_016527636.1|209475_210465_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	93.9	6.9e-177
WP_080716926.1|210476_210818_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	93.2	3.8e-18
WP_016527638.1|210820_211198_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	75.2	4.8e-46
WP_035490848.1|211198_211546_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	72.8	2.2e-45
WP_035490850.1|211545_211914_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	77.9	1.9e-47
WP_016527641.1|211910_212285_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	77.4	3.5e-49
WP_016527642.1|212293_212773_+	hypothetical protein	NA	A0A0M3LPR0	Mannheimia_phage	76.7	5.8e-65
WP_016527643.1|212818_213235_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	80.3	6.0e-58
WP_016527644.1|213292_213469_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	96.6	1.7e-25
WP_038513526.1|213566_214238_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	77.8	4.8e-97
WP_016527646.1|214342_214801_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	98.0	3.7e-77
WP_038513529.1|215026_217477_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	84.3	4.2e-308
WP_016527647.1|217481_217811_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	69.7	1.8e-41
WP_038513532.1|217811_218549_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.1	1.8e-68
WP_038513452.1|218628_219375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005713886.1|219374_219755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513536.1|219798_220560_+	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	48.4	1.9e-65
WP_038513459.1|220589_221093_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	50.0	6.8e-32
WP_052157556.1|221144_224378_+	hypothetical protein	NA	A0A0M3LQ61	Mannheimia_phage	50.2	3.3e-252
>prophage 7
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	348741	400237	2265927	transposase,tRNA,terminase,protease,integrase	Pseudomonas_phage(15.38%)	52	361376:361391	409331:409346
WP_038513653.1|348741_349839_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_038513655.1|349973_350936_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_096334835.1|351025_352124_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	42.4	6.3e-06
WP_016527717.1|352353_353166_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_021113714.1|353230_354715_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.8	2.0e-87
WP_021113713.1|354784_355483_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_016527719.1|355522_356542_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_012621944.1|356550_356910_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_012621943.1|356961_357480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016527722.1|357912_359367_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	9.5e-42
WP_012621941.1|359651_360422_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.7	1.2e-35
WP_035491200.1|360492_361362_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
361376:361391	attL	TAAAATACAAGCGGTG	NA	NA	NA	NA
WP_016527724.1|361439_361841_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_005714322.1|362016_363279_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_012621936.1|363731_364376_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005714158.1|365557_366178_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.1	4.9e-56
WP_005714155.1|366395_367457_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G3M9Y6	Bacillus_virus	34.6	3.6e-22
WP_035491186.1|367456_368158_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005714153.1|368312_368861_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_038515120.1|368893_370732_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005714149.1|370742_371594_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005714148.1|371699_372770_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_035491171.1|373815_374382_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_035491169.1|374439_375279_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_038513665.1|375325_375946_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_038513667.1|377176_377995_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_035522865.1|378395_379016_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038513671.1|379025_380315_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035496314.1|380580_381348_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_021113687.1|381347_382208_-	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_035496324.1|382194_383307_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	38.8	5.4e-29
WP_012621918.1|383714_385091_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_038513674.1|385144_385948_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_005712999.1|386007_387072_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_021115046.1|387081_387678_+	DUF416 family protein	NA	NA	NA	NA	NA
WP_005713002.1|387809_388082_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.7	3.6e-19
WP_005713004.1|388196_389279_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	2.1e-09
WP_035491182.1|389309_390251_+	DNA (cytosine-5-)-methyltransferase	NA	A0A193GZ36	Escherichia_phage	35.5	2.8e-42
WP_012621914.1|390247_390991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513676.1|390999_391869_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_038513678.1|391856_392723_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038513680.1|392930_393785_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.5	6.8e-48
WP_005713012.1|393861_394626_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012621910.1|394628_395501_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_005713016.1|395939_397187_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	32.9	3.9e-52
WP_005713018.1|397238_398156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527743.1|398323_398518_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_035491146.1|398542_398890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513684.1|398880_399087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080716927.1|399070_399373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026916866.1|399362_399836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016527745.1|399823_400237_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	61.8	3.9e-33
409331:409346	attR	TAAAATACAAGCGGTG	NA	NA	NA	NA
>prophage 8
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	473897	481391	2265927	tRNA	Mollivirus(14.29%)	7	NA	NA
WP_010786632.1|473897_475412_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.4	1.4e-80
WP_005710639.1|475542_476127_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
WP_010786629.1|476143_476797_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.0	1.1e-34
WP_038513743.1|476986_477499_-	endopeptidase	NA	A0A0K2SUC1	Clostridium_phage	39.1	7.0e-16
WP_005710633.1|477551_477848_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.9e-12
WP_038513747.1|477864_480252_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.4e-05
WP_005714554.1|480407_481391_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.4	1.9e-33
>prophage 9
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	543835	549843	2265927		Mannheimia_phage(44.44%)	10	NA	NA
WP_016528089.1|543835_544567_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.4	1.9e-43
WP_016528088.1|544701_544926_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	62.1	2.0e-15
WP_016528087.1|544969_545152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026916583.1|545129_546020_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	56.5	1.1e-80
WP_026916582.1|546019_547375_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	61.9	1.7e-154
WP_038515080.1|547473_547902_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	59.3	1.1e-43
WP_005715065.1|547935_548349_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	55.5	6.8e-38
WP_005715063.1|548375_548558_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	74.6	4.5e-18
WP_038513329.1|548804_549383_+	NinG recombination protein	NA	A0A0U4KL68	Pseudomonas_phage	55.3	2.9e-50
WP_038513800.1|549372_549843_+	antitermination protein	NA	A0A0M3LPW4	Mannheimia_phage	39.0	7.6e-17
>prophage 10
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	557267	562606	2265927	tail,capsid,terminase	Mannheimia_phage(85.71%)	11	NA	NA
WP_005713954.1|557267_557729_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	62.0	1.0e-42
WP_035491384.1|557769_558204_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	56.3	1.5e-38
WP_010786750.1|558200_558419_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	71.2	3.1e-21
WP_012621781.1|558624_559143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513804.1|559325_559793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513807.1|559777_560302_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	57.4	3.4e-50
WP_010786754.1|560285_560423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012621779.1|560457_561111_-|terminase	terminase	terminase	A4JWP8	Burkholderia_virus	42.1	2.9e-38
WP_038513810.1|561110_561314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513813.1|561326_562142_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LSA0	Mannheimia_phage	44.1	1.5e-49
WP_051453330.1|562309_562606_+	hypothetical protein	NA	A0A0M3LRV4	Mannheimia_phage	59.8	5.4e-21
>prophage 11
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	646242	702344	2265927	transposase,tRNA,terminase,tail,integrase	Mannheimia_phage(44.83%)	61	661811:661848	709934:709971
WP_035520597.1|646242_648870_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	2.3e-78
WP_005711547.1|648933_649119_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	1.4e-11
WP_021109568.1|649298_650186_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.2	1.4e-59
WP_038515143.1|650298_651324_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	3.7e-16
WP_038513890.1|651333_651999_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016527842.1|652095_653763_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005711533.1|653828_654110_+	integration host factor subunit beta	NA	A4JWM7	Burkholderia_virus	44.4	2.4e-10
WP_005711531.1|654178_654463_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_016527843.1|654462_655656_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_035490578.1|655671_656364_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_010786911.1|656395_656695_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_038513894.1|656691_657441_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_005711521.1|657589_658732_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_038513897.1|659209_663595_+	hypothetical protein	NA	NA	NA	NA	NA
661811:661848	attL	CCTAAGGGGGATAAAGGCGATCCAGGACAAGCGGGTCC	NA	NA	NA	NA
WP_016527847.1|663650_664748_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_038513900.1|664748_666290_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005712867.1|666291_666945_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_035494092.1|667222_668257_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.7	1.8e-31
WP_005712872.1|668246_668924_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038513904.1|668956_669796_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_038513906.1|669868_670660_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_005712877.1|670836_671847_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_021109555.1|671863_673384_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.4	4.1e-11
WP_035491108.1|673435_674431_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_038513910.1|674551_676393_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_021109552.1|676392_676881_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_038513913.1|676912_677365_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_021113554.1|677365_677611_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_016527857.1|677676_678156_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_005712890.1|678239_679259_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005712894.1|679685_679988_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	37.6	2.3e-11
WP_005712896.1|679997_680360_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	61.5	2.4e-34
WP_020997002.1|680399_680546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712900.1|680622_681021_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_016527861.1|681378_682203_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_026917064.1|682210_684130_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	4.6e-36
WP_005712907.1|684255_684585_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_052157564.1|684887_685847_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	56.9	8.0e-98
WP_038513918.1|685861_686701_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.1	2.1e-49
WP_038513920.1|686746_687112_+	antitermination protein	NA	Q7Y5V5	Haemophilus_phage	29.6	1.8e-05
WP_012621837.1|687120_687339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513510.1|688193_688757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038513512.1|689144_689690_+	lysozyme	NA	Q19UR6	Mannheimia_phage	47.9	7.9e-42
WP_080716950.1|689689_690007_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	64.4	7.7e-05
WP_080716922.1|690035_690185_+	lytic transglycosylase	NA	A0A0M3LSZ0	Mannheimia_phage	78.7	3.4e-16
WP_038513923.1|690571_691087_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	72.2	2.2e-57
WP_038513926.1|691070_692306_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	80.2	4.1e-195
WP_038513929.1|692315_693713_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	65.0	2.5e-164
WP_080716933.1|693669_695415_+	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	70.6	3.2e-137
WP_005714619.1|695411_695618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149350961.1|695686_696319_+	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	53.8	5.0e-56
WP_005714623.1|696318_696537_+	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	80.6	8.9e-29
WP_005714625.1|696536_696956_+	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	66.2	1.8e-41
WP_157686080.1|697176_697515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096334846.1|697489_698050_+	hypothetical protein	NA	A0A0R6PHM5	Moraxella_phage	43.7	1.3e-28
WP_012621948.1|698086_699184_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010786946.1|700161_700617_+	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	60.4	1.4e-31
WP_038513448.1|700626_701364_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.1	3.0e-68
WP_005714478.1|701360_701642_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.6	2.3e-08
WP_005714476.1|701653_701932_-	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_035492515.1|702002_702344_+	cell wall hydrolase	NA	K7PLW1	Enterobacteria_phage	56.9	2.6e-27
709934:709971	attR	CCTAAGGGGGATAAAGGCGATCCAGGACAAGCGGGTCC	NA	NA	NA	NA
>prophage 12
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	752254	766068	2265927		Bacillus_virus(12.5%)	10	NA	NA
WP_038513969.1|752254_754498_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.9	5.7e-86
WP_038515156.1|754531_755860_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.8	7.8e-43
WP_010786776.1|755973_757236_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	5.6e-99
WP_038513972.1|757582_758593_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_010786777.1|758741_759020_+	plasmid maintenance system killer protein	NA	A0A0M3LQB1	Mannheimia_phage	48.9	2.6e-17
WP_005712616.1|759030_759303_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	42.5	2.2e-08
WP_038513975.1|759366_760587_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	2.0e-40
WP_080716934.1|760976_762191_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_021115958.1|762395_762938_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	56.2	1.9e-43
WP_038513981.1|763239_766068_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	3.8e-305
>prophage 13
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	1399825	1494952	2265927	transposase,tRNA,terminase,protease,head,tail,portal,integrase	uncultured_Caudovirales_phage(22.22%)	75	1393293:1393308	1466697:1466712
1393293:1393308	attL	AGATAAGGTTTCATTA	NA	NA	NA	NA
WP_016528358.1|1399825_1400260_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_038514526.1|1400268_1401537_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_038514529.1|1401582_1402047_-	YchJ family protein	NA	NA	NA	NA	NA
WP_038514532.1|1402104_1403754_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	31.7	4.4e-35
WP_038514535.1|1403815_1404442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021111318.1|1404444_1405218_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_026916974.1|1405513_1405825_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_021111317.1|1405844_1406819_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005713911.1|1407037_1408093_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.9	2.5e-20
WP_005713913.1|1408154_1408481_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_005713914.1|1408648_1409101_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_010787138.1|1409143_1409530_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_038514539.1|1409529_1410303_+	TonB family protein	NA	NA	NA	NA	NA
WP_005713919.1|1410379_1410700_-	DUF2322 family protein	NA	NA	NA	NA	NA
WP_005713921.1|1410715_1411435_-	cell division protein	NA	NA	NA	NA	NA
WP_038514542.1|1411498_1412128_-	thiamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.0e-21
WP_016528366.1|1412140_1412344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021115289.1|1412446_1413175_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.6	2.1e-42
WP_005713926.1|1413261_1413942_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_026916977.1|1414175_1414568_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_038514545.1|1414648_1415584_+	membrane protein	NA	NA	NA	NA	NA
WP_010787146.1|1416627_1418307_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_035490065.1|1418549_1420820_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_038514551.1|1421033_1422881_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.0	4.0e-61
WP_005713402.1|1423137_1423401_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_035490060.1|1423641_1425213_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_015939738.1|1425276_1426227_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.9	4.9e-71
WP_038514555.1|1426409_1427156_+	ribonuclease	NA	NA	NA	NA	NA
WP_005713406.1|1427155_1427650_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_021109984.1|1427771_1428380_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005713410.1|1428573_1429140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005713412.1|1429154_1430204_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005713415.1|1430391_1432101_-	ribonucleoside-diphosphate reductase subunit alpha	NA	Q2XUY0	environmental_halophage	60.5	4.0e-201
WP_035490056.1|1432087_1433065_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1X9I9V4	Staphylococcus_phage	54.6	1.7e-98
WP_016528378.1|1433382_1436994_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016528379.1|1437109_1438615_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_038514560.1|1444903_1449370_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_021119396.1|1449596_1451024_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_038514563.1|1451151_1453194_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021118315.1|1453695_1454445_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-33
WP_021119394.1|1454447_1455164_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021119393.1|1455153_1455936_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038514569.1|1456788_1458015_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	41.3	5.7e-80
WP_016528388.1|1458374_1458809_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096334851.1|1459565_1460135_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	59.5	2.5e-54
WP_026916938.1|1460135_1461350_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	60.9	9.7e-141
WP_035491032.1|1461333_1461705_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	29.1	8.1e-06
WP_035491030.1|1461697_1461979_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016528393.1|1462018_1462381_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_157686090.1|1462529_1462667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038514572.1|1462703_1463069_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	67.8	1.3e-40
WP_080697462.1|1463076_1464657_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	71.0	1.3e-217
WP_005711455.1|1465085_1466039_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_021109966.1|1466159_1467569_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
1466697:1466712	attR	TAATGAAACCTTATCT	NA	NA	NA	NA
WP_010787219.1|1467570_1468293_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_038514577.1|1468448_1468949_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_015940060.1|1468997_1469627_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_026916940.1|1471398_1472673_+	threonine synthase	NA	NA	NA	NA	NA
WP_005711442.1|1472727_1473792_-	MFS transporter	NA	NA	NA	NA	NA
WP_038514579.1|1474059_1477509_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_026916943.1|1477620_1478586_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_005711435.1|1478920_1479238_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_005711433.1|1479294_1479534_+	DUF997 family protein	NA	NA	NA	NA	NA
WP_021115558.1|1479523_1480954_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005711429.1|1481215_1482538_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_005711427.1|1482690_1483515_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_010787210.1|1483914_1484709_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_038514583.1|1484718_1485870_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_005711422.1|1486067_1486379_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_005711421.1|1486399_1486657_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_010787206.1|1487665_1488586_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038514586.1|1488622_1489798_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_005711417.1|1489908_1490250_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.8	3.9e-23
WP_052157580.1|1491096_1493919_+	hypothetical protein	NA	A0A2C9CZB7	Yersinia_phage	35.4	1.9e-06
WP_038514589.1|1494088_1494952_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.1	2.1e-49
>prophage 14
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	1602133	1610504	2265927	transposase,integrase	Haemophilus_phage(100.0%)	13	1596588:1596601	1610360:1610373
1596588:1596601	attL	TAAACGTGTAAAAA	NA	NA	NA	NA
WP_038514644.1|1602133_1602556_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	99.3	7.9e-74
WP_038514647.1|1602536_1603100_-	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	96.8	2.8e-98
WP_016057756.1|1603268_1603646_-	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	100.0	1.4e-66
WP_016528532.1|1603662_1604619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038514649.1|1604620_1604806_-	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	96.4	1.3e-20
WP_038514651.1|1604909_1605431_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	98.3	2.2e-89
WP_038514655.1|1605442_1605736_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	93.8	4.4e-47
WP_038514659.1|1605737_1605929_-	hypothetical protein	NA	F6MII8	Haemophilus_phage	96.8	1.5e-27
WP_016057750.1|1605936_1606818_-	AAA family ATPase	NA	F6MII7	Haemophilus_phage	100.0	8.0e-161
WP_016057749.1|1606901_1607324_-	hypothetical protein	NA	F6MII6	Haemophilus_phage	100.0	1.5e-69
WP_038514664.1|1607333_1609310_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	98.9	0.0e+00
WP_005822937.1|1609319_1609589_-	transcriptional regulator	NA	F6MII4	Haemophilus_phage	100.0	7.6e-46
WP_052157583.1|1609784_1610504_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	99.6	7.1e-131
1610360:1610373	attR	TAAACGTGTAAAAA	NA	NA	NA	NA
>prophage 15
NZ_CP009158	Glaesserella parasuis strain SH03 chromosome, complete genome	2265927	1876184	1940125	2265927	tRNA,transposase	Shigella_phage(17.65%)	57	NA	NA
WP_035498565.1|1876184_1876367_-|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	98.3	7.7e-26
WP_038514886.1|1876484_1878347_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	30.9	2.9e-11
WP_005713639.1|1878770_1879157_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_005713638.1|1879185_1879977_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_005713637.1|1880117_1880372_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_005713636.1|1880433_1880904_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_005713635.1|1880917_1881451_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_005713634.1|1881463_1883005_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_005713631.1|1883027_1883894_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_015939856.1|1883914_1885288_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_005713627.1|1885314_1885731_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_005713622.1|1885805_1886795_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005713620.1|1886909_1887329_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_038514889.1|1887338_1888838_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L3Z8	Tupanvirus	22.5	4.4e-18
WP_038514892.1|1888849_1889809_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_026916719.1|1889849_1890722_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.1	9.5e-05
WP_021110136.1|1890804_1891725_+	ribokinase	NA	NA	NA	NA	NA
WP_038514894.1|1892044_1893472_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015939863.1|1894528_1894723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005713609.1|1894699_1895350_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005713602.1|1896623_1897067_-	membrane protein	NA	NA	NA	NA	NA
WP_038514900.1|1897201_1898092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038514904.1|1899134_1902722_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	23.4	2.6e-16
WP_038514907.1|1903727_1905500_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	30.7	5.1e-13
WP_021110357.1|1905680_1906280_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015939869.1|1906375_1906678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712846.1|1906741_1907194_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_038514912.1|1907208_1911147_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	25.6	2.5e-44
WP_021111672.1|1911354_1912545_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005712839.1|1912634_1913771_-	alanine racemase	NA	NA	NA	NA	NA
WP_020457514.1|1913894_1914809_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_021110363.1|1914818_1915259_+	NfeD family protein	NA	NA	NA	NA	NA
WP_021110364.1|1915333_1916560_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	36.5	4.0e-57
WP_005712834.1|1916754_1918050_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.0	4.0e-68
WP_080513251.1|1918235_1918376_-	hypothetical protein	NA	I3WVW4	Acinetobacter_phage	61.0	2.9e-09
WP_021111680.1|1918786_1919536_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005712827.1|1919589_1920252_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_021111681.1|1920607_1921294_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.0	1.3e-36
WP_038514917.1|1921293_1922544_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_010786502.1|1922577_1923564_-	amidohydrolase family protein	NA	A0A076FFX9	Aureococcus_anophage	29.4	3.5e-32
WP_021110369.1|1923805_1924579_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	28.0	6.9e-15
WP_005712818.1|1924624_1925908_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026916397.1|1926247_1926997_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005712814.1|1927017_1927968_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_005712812.1|1927977_1928667_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_015939878.1|1928856_1929399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021115395.1|1929432_1930071_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_038514923.1|1930067_1931135_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_005712807.1|1931165_1931798_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_038513851.1|1932091_1933063_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	3.2e-09
WP_038514926.1|1934988_1935588_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_026916400.1|1935587_1936169_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_015939880.1|1936204_1936357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005713507.1|1936791_1937652_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_005713509.1|1938977_1939301_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	43.4	9.2e-14
WP_157686103.1|1939312_1939882_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	34.4	3.4e-19
WP_035498411.1|1939903_1940125_+|transposase	transposase	transposase	Q716C2	Shigella_phage	56.5	7.9e-17
