The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007724	Corynebacterium glutamicum strain AR1 chromosome, complete genome	3145677	34952	80759	3145677	protease,transposase	Escherichia_phage(55.56%)	36	NA	NA
WP_038586652.1|34952_35612_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_038581881.1|37879_38104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162472690.1|38375_38525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861074.1|39091_39364_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_038581883.1|39476_41420_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	31.5	7.0e-16
WP_038581885.1|41416_42826_-	serine/threonine protein kinase	NA	K7YID8	Megavirus	31.2	1.2e-17
WP_038581886.1|42829_44254_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_038581888.1|44250_45576_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_044029636.1|45572_46928_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003855394.1|46927_47392_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003861088.1|47408_48305_-	DUF3662 and FHA domain-containing protein	NA	NA	NA	NA	NA
WP_038586655.1|48800_49181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080724052.1|52563_52983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038581893.1|53123_54290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973342.1|54312_54750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044029638.1|55373_57161_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_038581903.1|58439_59066_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	8.5e-24
WP_038581905.1|59585_60737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038581909.1|61495_61822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973343.1|62304_62604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|62850_63561_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_038586668.1|63833_64049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038581924.1|67920_68379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038581926.1|69206_69917_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	57.3	6.8e-78
WP_038586680.1|70080_71307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982465.1|71978_72242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051907067.1|72243_72588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162472691.1|72858_72999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858908.1|73521_73782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858906.1|73781_74183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|74664_75375_-|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_044029642.1|76076_77108_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	40.5	2.8e-19
WP_051904565.1|77310_77850_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_010889963.1|77924_78635_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_003858644.1|78879_79338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|80048_80759_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
>prophage 2
NZ_CP007724	Corynebacterium glutamicum strain AR1 chromosome, complete genome	3145677	1414449	1470312	3145677	tRNA,integrase,protease,transposase	Iris_mild_mosaic_virus(12.5%)	52	1459223:1459274	1472852:1472903
WP_038583803.1|1414449_1415940_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003854060.1|1416011_1416227_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038583806.1|1416227_1416701_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_038583808.1|1416817_1417342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162472705.1|1417426_1417930_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038583812.1|1417965_1418487_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_038583815.1|1420222_1421200_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038583818.1|1421523_1423320_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_145973367.1|1423644_1423935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038586943.1|1424473_1424803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038583821.1|1425015_1427403_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.7	6.4e-19
WP_038583828.1|1427814_1429224_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162472698.1|1429849_1431253_-|transposase	IS1380-like element IS1677 family transposase	transposase	NA	NA	NA	NA
WP_010991833.1|1431782_1432139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015203.1|1432143_1433766_-	hypothetical protein	NA	A0A160DH52	Gordonia_phage	32.4	9.0e-17
WP_080724100.1|1434008_1435376_-|transposase	IS1380-like element ISCgl4 family transposase	transposase	NA	NA	NA	NA
WP_038583836.1|1435947_1436427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038583839.1|1436487_1437054_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	7.0e-09
WP_003861499.1|1437036_1437744_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038583842.1|1437924_1439370_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011014282.1|1439387_1439981_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_162472699.1|1440439_1441843_+|transposase	IS1380-like element IS1677 family transposase	transposase	NA	NA	NA	NA
WP_011265722.1|1442020_1443031_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003858849.1|1443308_1444307_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003861506.1|1444331_1445414_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_038583847.1|1445470_1446451_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_044029946.1|1446518_1447508_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_038583862.1|1447507_1448257_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	5.6e-30
WP_038583864.1|1448268_1449972_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_038583867.1|1449976_1452100_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1452119_1452335_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003858829.1|1452334_1452919_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_038583872.1|1452922_1453405_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	2.5e-15
WP_003858826.1|1453976_1454741_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	1.6e-19
WP_038583875.1|1454744_1455695_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1455737_1456742_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003858818.1|1456841_1457651_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1457733_1458714_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
1459223:1459274	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_003858814.1|1459361_1460051_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	36.2	2.1e-15
WP_003858812.1|1460060_1460516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1460512_1461259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1461451_1461886_+	metallopeptidase	NA	NA	NA	NA	NA
WP_089158527.1|1462564_1463766_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_003858803.1|1463871_1464486_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_003858801.1|1464488_1464710_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1465358_1465793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1465808_1466024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1466462_1466834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858794.1|1466908_1467121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858792.1|1467550_1467754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861526.1|1468725_1469103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861528.1|1469361_1470312_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
1472852:1472903	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
>prophage 3
NZ_CP007724	Corynebacterium glutamicum strain AR1 chromosome, complete genome	3145677	2458297	2508642	3145677	integrase,protease,transposase	Escherichia_phage(28.57%)	44	2452754:2452768	2475046:2475060
2452754:2452768	attL	CGGCGTTGATCATGG	NA	NA	NA	NA
WP_038585363.1|2458297_2459041_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_038585370.1|2461301_2462180_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A096XTB6	Enterococcus_phage	37.9	9.2e-16
WP_089158527.1|2463754_2464955_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_044030199.1|2465317_2466070_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_044030201.1|2466143_2466944_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011015149.1|2466953_2467613_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	37.4	3.4e-23
WP_003860847.1|2467609_2468854_-	esterase family protein	NA	NA	NA	NA	NA
WP_038585376.1|2469041_2470253_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_038585379.1|2471033_2471681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155274390.1|2471690_2471834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|2471832_2472543_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_038585382.1|2473259_2473469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080724205.1|2473465_2474092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038585385.1|2474149_2475391_-	glutaminase	NA	NA	NA	NA	NA
2475046:2475060	attR	CGGCGTTGATCATGG	NA	NA	NA	NA
WP_080724136.1|2475435_2475747_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_158407474.1|2475661_2476039_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_038585404.1|2476103_2476520_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_038585407.1|2476590_2478147_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_038585410.1|2478300_2478804_+	gluconokinase	NA	NA	NA	NA	NA
WP_038585413.1|2478967_2480134_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_038585417.1|2480207_2480768_+	isochorismatase family protein	NA	A0A1V0SL12	Klosneuvirus	21.1	6.5e-07
WP_003857689.1|2480807_2481083_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_038585419.1|2481255_2481732_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_044030205.1|2481753_2482419_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038585426.1|2482408_2482816_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_038585429.1|2482826_2484284_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_162472694.1|2484466_2484616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|2486721_2487432_-|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_038585435.1|2495754_2495961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038585438.1|2496846_2498031_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038585443.1|2498206_2498782_+	M23 family metallopeptidase	NA	A0A1C9M0Q3	Mycobacterium_phage	44.4	4.4e-27
WP_003857998.1|2499055_2499520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857996.1|2499600_2499957_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_044030210.1|2500030_2500651_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_003857993.1|2500677_2501415_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_044030212.1|2501539_2503060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038585452.1|2503192_2503960_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_034983156.1|2504062_2504917_-	glutamate racemase	NA	NA	NA	NA	NA
WP_038585464.1|2504967_2505594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038585467.1|2505603_2506098_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038585470.1|2506127_2506877_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_038585473.1|2506873_2507788_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_003857980.1|2507787_2508327_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_038587061.1|2508339_2508642_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
