The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	126799	185420	2470036	transposase,tRNA,plate,integrase	Vibrio_phage(14.29%)	51	157621:157636	182951:182966
WP_038462777.1|126799_127297_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038462779.1|127296_127908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462781.1|128044_128614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908307.1|128696_130163_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038462783.1|130185_130719_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051908309.1|130964_131732_+	NAD kinase	NA	NA	NA	NA	NA
WP_051908311.1|131728_132559_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_051908313.1|132721_133207_+	DUF4167 domain-containing protein	NA	NA	NA	NA	NA
WP_038462784.1|133504_136069_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	37.9	5.4e-125
WP_084675811.1|136259_136796_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_038462790.1|136896_137430_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.0	6.5e-41
WP_038462793.1|137673_140325_-	DNA mismatch repair protein MutS	NA	F2QAF9	Pyramimonas_orientalis_virus	28.0	9.9e-05
WP_038462796.1|140536_140797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462800.1|140940_141942_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038462802.1|142325_143681_+	MFS transporter	NA	NA	NA	NA	NA
WP_051908315.1|143731_144313_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_038462805.1|144516_145914_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_038462807.1|145914_146850_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	34.6	1.9e-35
WP_038462809.1|146851_149701_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.7	0.0e+00
WP_051908317.1|150423_150678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908319.1|150728_151589_+	transporter	NA	NA	NA	NA	NA
WP_038462810.1|152121_152715_-	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_038462812.1|152787_154305_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038462814.1|154605_154875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956594.1|154905_155064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462817.1|155127_155448_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_156956595.1|155633_155777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956596.1|155948_156545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462820.1|157391_158663_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
157621:157636	attL	GAGCCATCCTCTTGCG	NA	NA	NA	NA
WP_038462822.1|158666_158930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908321.1|159259_160327_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_038462827.1|160320_162114_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038462829.1|162311_162911_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_038462832.1|163382_163811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956597.1|164380_164668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462836.1|164717_165173_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_084675812.1|165548_165686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462839.1|166028_166208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462841.1|167430_168594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462844.1|168674_169286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462846.1|169529_171551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462849.1|171972_174747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084676030.1|174984_175164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084675814.1|175185_175593_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_156956598.1|175762_175954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038462851.1|177060_178011_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	38.8	5.8e-40
WP_051908326.1|178298_180038_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_038462853.1|180078_180369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462856.1|180602_181976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462859.1|182157_183678_-	aminotransferase class V-fold PLP-dependent enzyme	NA	M1HWX9	Paramecium_bursaria_Chlorella_virus	28.4	2.7e-15
182951:182966	attR	GAGCCATCCTCTTGCG	NA	NA	NA	NA
WP_051908328.1|185207_185420_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	193505	282778	2470036	transposase	Escherichia_phage(25.0%)	49	NA	NA
WP_038462873.1|193505_194474_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	34.1	1.9e-46
WP_156956756.1|194508_194874_+	hypothetical protein	NA	W6CWV1	Ralstonia_phage	47.3	2.2e-08
WP_038462876.1|194905_195610_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.6e-37
WP_038466789.1|195819_196770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908337.1|196791_199758_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	32.8	9.5e-89
WP_075261536.1|199809_200397_-	hypothetical protein	NA	A4PE56	Ralstonia_virus	27.7	4.0e-07
WP_084675818.1|201308_202310_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038462882.1|202939_203944_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051908339.1|204158_206078_-	YncE family protein	NA	NA	NA	NA	NA
WP_038462884.1|206074_209362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462887.1|209415_209868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462889.1|209886_212283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908342.1|212303_215408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462892.1|215425_216691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462895.1|216709_218020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462898.1|218038_218566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462900.1|219054_219354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675820.1|219589_219763_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038462876.1|219864_220569_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.6e-37
WP_051908345.1|220615_221005_-|transposase	DDE transposase	transposase	A0A1V0E8E1	Vibrio_phage	39.6	1.9e-13
WP_051908347.1|221642_223067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084675822.1|222997_225625_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	34.3	2.1e-87
WP_038462876.1|226027_226732_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.6e-37
WP_156956600.1|226733_227045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908351.1|227208_228588_+	PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein	NA	NA	NA	NA	NA
WP_156956601.1|228674_228830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462904.1|228886_229597_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_051908353.1|229664_230927_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	44.0	1.7e-95
WP_084675826.1|231006_231261_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_084675828.1|231800_238133_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	31.5	1.5e-38
WP_038462908.1|238240_238501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908356.1|238520_242108_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	34.2	5.4e-46
WP_051908358.1|242168_245180_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_038462910.1|245365_245665_-	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	46.0	8.5e-14
WP_038462904.1|245747_246458_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_038462912.1|246863_248072_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	28.3	2.2e-20
WP_075261538.1|248077_252709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462914.1|253009_253723_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	64.4	1.1e-83
WP_051908360.1|253927_254758_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038462917.1|259755_260574_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038462882.1|260760_261765_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051908365.1|262086_262800_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	51.2	1.8e-49
WP_038462921.1|263167_265252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462925.1|266021_269666_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_051908367.1|269815_275719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462927.1|275676_278697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462929.1|279027_279609_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.3	2.6e-22
WP_038462931.1|279760_280408_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_156956602.1|280438_282778_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.6e-43
>prophage 3
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	292019	363921	2470036	protease,transposase,integrase	Streptococcus_phage(46.15%)	53	354756:354771	355503:355518
WP_038462951.1|292019_292697_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.4	2.3e-38
WP_051908376.1|293140_295555_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	9.5e-55
WP_038466839.1|296781_299310_-	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	25.1	1.5e-39
WP_038462904.1|299600_300311_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_038462957.1|300797_301259_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_038462959.1|301451_304433_+	AAA family ATPase	NA	V5UQN3	Mycobacterium_phage	22.4	2.8e-08
WP_038462963.1|304541_305303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462965.1|305278_306160_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_038462967.1|306191_307874_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_038462969.1|307934_308261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462971.1|308265_310983_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_038462973.1|310995_312405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462975.1|312443_312665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462977.1|312651_312936_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	37.6	4.7e-14
WP_038462979.1|312944_313685_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_084675830.1|313681_315187_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_051908380.1|315225_315771_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_051908383.1|315755_316760_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_075261541.1|316752_317358_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_038462904.1|317417_318128_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_156956757.1|318184_318466_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038462986.1|319505_320216_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_038462991.1|321123_321450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956603.1|321424_321991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462998.1|322466_323732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956604.1|323737_325468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038463002.1|325527_326049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956605.1|326083_326257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908881.1|326418_326709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463004.1|326798_327041_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038463006.1|327494_328064_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.5	3.7e-42
WP_038463009.1|328253_328442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038463011.1|328490_329759_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_038463013.1|330222_330930_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_038463016.1|331162_332566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463018.1|332661_336279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463020.1|336316_338878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463022.1|338879_339791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463024.1|339790_341185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956758.1|343600_343687_-	CxxxxCH/CxxCH domain-containing protein	NA	NA	NA	NA	NA
WP_038463029.1|345440_346880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075261542.1|348150_348645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038463037.1|348915_351735_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	33.5	1.6e-122
WP_051908385.1|352308_352938_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_038463039.1|352975_353938_+	YfdX family protein	NA	NA	NA	NA	NA
WP_038463041.1|354185_354734_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
354756:354771	attL	GTATCGTCAAGTTGTT	NA	NA	NA	NA
WP_156956606.1|354828_355065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084675832.1|355003_355468_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_051908387.1|355781_356936_+	hypothetical protein	NA	A0A1B2LRS3	Wolbachia_phage	32.5	1.5e-34
355503:355518	attR	AACAACTTGACGATAC	NA	NA	NA	NA
WP_051908389.1|357078_360969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038463043.1|361357_362356_+	response regulator	NA	NA	NA	NA	NA
WP_038463045.1|362584_363190_-	DNA resolvase	NA	A0A141DZX2	Streptococcus_phage	33.3	2.8e-11
WP_051908390.1|363603_363921_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	58.4	3.9e-25
>prophage 4
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	992756	1092170	2470036	transposase	Escherichia_phage(25.0%)	68	NA	NA
WP_038464370.1|992756_993470_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.1	4.2e-51
WP_038464373.1|993832_994837_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051908584.1|995856_1003287_-	GNAT family N-acetyltransferase	NA	D0R7J2	Paenibacillus_phage	32.4	5.8e-34
WP_038464376.1|1003880_1004729_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_051908586.1|1004718_1005480_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_038464379.1|1005719_1006427_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_084676034.1|1006521_1006710_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_038464382.1|1007227_1007656_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	37.2	2.5e-19
WP_038464385.1|1007848_1008667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261560.1|1010052_1010328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038464391.1|1010714_1011140_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_038464370.1|1011446_1012160_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.1	4.2e-51
WP_156956651.1|1012178_1012694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464402.1|1012920_1013433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462876.1|1013532_1014237_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.6e-37
WP_051908345.1|1014283_1014673_-|transposase	DDE transposase	transposase	A0A1V0E8E1	Vibrio_phage	39.6	1.9e-13
WP_084675911.1|1014825_1014978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908592.1|1015528_1015810_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_038464405.1|1016000_1016198_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_038464408.1|1016422_1016641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464410.1|1016715_1017129_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_051908595.1|1017162_1021752_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.0	5.1e-182
WP_051908597.1|1021829_1030001_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.4	2.1e-210
WP_156956652.1|1030201_1030468_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_051908602.1|1030460_1030892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675913.1|1031036_1031876_-	thioesterase	NA	NA	NA	NA	NA
WP_038462876.1|1032072_1032777_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.6e-37
WP_038462904.1|1033789_1034500_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.0	3.4e-29
WP_156956653.1|1034496_1034988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464422.1|1035189_1036908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464425.1|1037382_1037961_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	66.7	5.6e-38
WP_038464429.1|1038054_1039164_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.5	1.4e-13
WP_156956654.1|1039370_1039607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956655.1|1039669_1042099_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_038464438.1|1042540_1043074_-	hypothetical protein	NA	A0A0G2Y404	Acanthamoeba_polyphaga_mimivirus	33.6	7.8e-10
WP_038464441.1|1043593_1045996_-	hypothetical protein	NA	A0A0G2Y404	Acanthamoeba_polyphaga_mimivirus	33.6	3.5e-09
WP_038464444.1|1046215_1046548_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	31.0	2.0e-08
WP_038464447.1|1047244_1047493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675917.1|1047508_1047958_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_038464449.1|1047963_1048932_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.2	1.8e-49
WP_038464452.1|1049067_1049505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462882.1|1050008_1051013_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156956656.1|1051120_1051705_-	DUF483 domain-containing protein	NA	NA	NA	NA	NA
WP_038464457.1|1051734_1053294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464458.1|1054122_1054320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261562.1|1054498_1056682_+	FxsB family radical SAM/SPASM domain protein	NA	NA	NA	NA	NA
WP_038464462.1|1056635_1057250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464466.1|1057278_1059084_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	4.6e-30
WP_038464469.1|1059112_1059874_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038464472.1|1060011_1060287_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_038464475.1|1060672_1061254_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_051908611.1|1061402_1061915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261607.1|1062024_1063509_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038463055.1|1063501_1064248_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	35.7	6.8e-36
WP_038464478.1|1064649_1065249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464481.1|1065311_1066130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908613.1|1066333_1070287_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.2	6.9e-87
WP_051908616.1|1070299_1078702_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.5	9.6e-78
WP_038464484.1|1078784_1080380_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_051908618.1|1080553_1081951_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_051908620.1|1082340_1082964_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051908623.1|1082960_1083368_+	hypothetical protein	NA	S5VXX4	Leptospira_phage	30.3	2.7e-10
WP_038464487.1|1083770_1085033_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	42.7	9.0e-89
WP_038464493.1|1085768_1086473_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.1	6.8e-54
WP_051908625.1|1086691_1088614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464496.1|1088988_1090122_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_038464493.1|1090851_1091556_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.1	6.8e-54
WP_038464499.1|1091978_1092170_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	1097307	1173228	2470036	transposase,integrase	Escherichia_phage(33.33%)	56	1172219:1172246	1175350:1175377
WP_051908629.1|1097307_1098162_+|transposase	IS481 family transposase	transposase	S5VKT1	Leptospira_phage	35.4	6.9e-08
WP_038464528.1|1098255_1099302_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	75.1	1.7e-154
WP_051908631.1|1100768_1101098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675921.1|1101082_1101286_-	hypothetical protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	6.4e-05
WP_156956658.1|1101544_1102681_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038464534.1|1102720_1103512_-	cell division protein ZapE	NA	A0A2L1IVB6	Escherichia_phage	56.7	6.0e-75
WP_038464493.1|1104764_1105469_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.1	6.8e-54
WP_038464540.1|1105566_1106502_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156956659.1|1106637_1107618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464545.1|1107851_1108700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261616.1|1108713_1109997_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_051908635.1|1110095_1111109_-	response regulator	NA	NA	NA	NA	NA
WP_038464551.1|1111937_1112174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464553.1|1112394_1112673_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_038464556.1|1112740_1112971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464559.1|1113167_1116662_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	32.9	5.1e-09
WP_038464562.1|1116678_1117143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464565.1|1117297_1117840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464568.1|1118463_1120329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464571.1|1120636_1121236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908637.1|1122226_1123369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464574.1|1123280_1125761_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_051908638.1|1125984_1127307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084675923.1|1127547_1127958_-|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	53.1	3.1e-30
WP_038464577.1|1127959_1128232_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_038464578.1|1128344_1128947_+	resolvase	NA	H2A0H0	Bacteroides_phage	37.5	3.2e-28
WP_084676035.1|1129029_1132161_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_038462597.1|1132574_1133672_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_038464584.1|1134306_1134699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675925.1|1136987_1139153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956660.1|1139868_1140027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956661.1|1140039_1140450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464588.1|1141461_1142058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464592.1|1142850_1143672_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075261566.1|1144153_1144417_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038464594.1|1144318_1144615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908645.1|1144871_1147151_+	response regulator	NA	A0A1V0SGX0	Hokovirus	36.7	4.8e-56
WP_038462882.1|1147362_1148367_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038464595.1|1148689_1149403_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.9	1.0e-52
WP_038464597.1|1149437_1149872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464599.1|1149940_1150921_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_038464601.1|1151057_1152248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464604.1|1152735_1153617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908649.1|1153962_1154931_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.1	1.8e-49
WP_084675927.1|1154936_1155299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038464606.1|1155519_1156878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464608.1|1156874_1157294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464611.1|1157616_1158180_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	45.6	6.3e-42
WP_038464613.1|1158630_1158873_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038464615.1|1158865_1159264_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_038464617.1|1159322_1165127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038464618.1|1165129_1166419_-	patatin-like phospholipase family protein	NA	A0A1V0SF81	Hokovirus	29.4	7.4e-06
WP_038464619.1|1166593_1167232_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	47.6	7.6e-36
WP_084675929.1|1167683_1171031_+	hypothetical protein	NA	NA	NA	NA	NA
1172219:1172246	attL	AGTTTGTTCTTGCTTCCCATTTACGCAA	NA	NA	NA	NA
WP_084675931.1|1172532_1172937_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_051908658.1|1172940_1173228_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	33.0	2.1e-09
1175350:1175377	attR	AGTTTGTTCTTGCTTCCCATTTACGCAA	NA	NA	NA	NA
>prophage 6
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	1422936	1549559	2470036	protease,tRNA,transposase,integrase	Wolbachia_phage(21.05%)	93	1427234:1427252	1529057:1529077
WP_038464994.1|1422936_1424340_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038464996.1|1424423_1425266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038464999.1|1425232_1426264_+	patatin-like phospholipase family protein	NA	G9E620	Micromonas_pusilla_virus	27.4	3.0e-05
WP_075261571.1|1426478_1427357_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1427234:1427252	attL	GCCCGAACTTATAGAAATT	NA	NA	NA	NA
WP_038465005.1|1428373_1429042_+	hypothetical protein	NA	NA	NA	NA	NA
1427234:1427252	attL	GCCCGAACTTATAGAAATT	NA	NA	NA	NA
WP_051908695.1|1429120_1429423_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	43.5	5.8e-10
WP_156956688.1|1429563_1430451_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_038465009.1|1430447_1430924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465011.1|1431289_1432024_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_038465013.1|1432111_1434211_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_038465015.1|1434214_1435543_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_075261622.1|1435558_1435903_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_038465019.1|1435934_1436528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465022.1|1436541_1437561_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_038465024.1|1437536_1439213_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_038465026.1|1439466_1440021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465028.1|1440411_1441368_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_051908696.1|1441419_1442376_-	site-specific tyrosine recombinase XerD	NA	W8EHC2	Mycobacterium_phage	29.3	3.9e-12
WP_038465030.1|1442335_1442761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465032.1|1442849_1444160_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_038465033.1|1444323_1445109_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	7.4e-25
WP_156956689.1|1445245_1445686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908697.1|1445929_1446286_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038465037.1|1446349_1447042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908698.1|1447103_1447457_-	helix-turn-helix domain-containing protein	NA	K4K6E9	Caulobacter_phage	45.6	2.2e-08
WP_084675957.1|1447870_1448224_+	F-box protein	NA	NA	NA	NA	NA
WP_038465041.1|1448207_1449863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465043.1|1450150_1451056_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038465045.1|1451286_1452750_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_075261623.1|1452910_1454209_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_038465049.1|1454221_1455220_-	response regulator	NA	NA	NA	NA	NA
WP_156956690.1|1455455_1455623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908699.1|1455631_1456156_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	44.8	8.4e-33
WP_051908700.1|1456134_1456380_-|transposase	transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	52.6	3.9e-17
WP_038467301.1|1456449_1456614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084675959.1|1456714_1457077_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_084675961.1|1457042_1457438_+|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	56.3	1.8e-27
WP_038465051.1|1457502_1462464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675963.1|1463792_1464128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038465057.1|1464362_1465313_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	38.8	4.4e-40
WP_156956763.1|1465325_1466258_-|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	49.3	6.9e-62
WP_075261573.1|1466922_1467768_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.9	7.5e-15
WP_038465061.1|1467906_1468911_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051908702.1|1469551_1470649_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_051908703.1|1470804_1471125_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_084675965.1|1471121_1471484_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_051908705.1|1472284_1472869_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1471990:1472008	attR	GCCCGAACTTATAGAAATT	NA	NA	NA	NA
WP_084675968.1|1473119_1473854_-	hypothetical protein	NA	NA	NA	NA	NA
1471990:1472008	attR	GCCCGAACTTATAGAAATT	NA	NA	NA	NA
WP_051908706.1|1474544_1475492_+	EamA family transporter	NA	NA	NA	NA	NA
WP_038465065.1|1476178_1476883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465068.1|1477252_1477453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465070.1|1477799_1478015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465072.1|1478466_1478964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465074.1|1479841_1480423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465076.1|1480846_1481164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465079.1|1481917_1482124_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	42.6	1.3e-08
WP_156956763.1|1483000_1483933_+|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	49.3	6.9e-62
WP_038465080.1|1483913_1489061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908707.1|1489083_1491885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465082.1|1493195_1493924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908709.1|1494282_1495464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956691.1|1495532_1495733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465085.1|1495835_1497476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908712.1|1499317_1499602_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_051908713.1|1499594_1500017_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_051908714.1|1500231_1502496_-	sel1 repeat family protein	NA	L7Y4H2	Megavirus	35.3	2.0e-14
WP_051908715.1|1502585_1505672_-	SEL1-like repeat protein	NA	A0A0G2Y2X0	Acanthamoeba_polyphaga_mimivirus	25.7	9.1e-18
WP_051908716.1|1505794_1507843_-	sel1 repeat family protein	NA	K7YAQ5	Megavirus	26.8	4.2e-11
WP_051908717.1|1507848_1509591_-	sel1 repeat family protein	NA	L7RDP7	Acanthamoeba_polyphaga_moumouvirus	29.4	3.5e-06
WP_051908718.1|1509818_1512473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465087.1|1512522_1514478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956692.1|1514606_1516562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465091.1|1516539_1517646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465093.1|1517658_1519356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675970.1|1519872_1520184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051908720.1|1520291_1520561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465095.1|1520918_1524392_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_156956764.1|1524515_1525181_-	DUF1016 family protein	NA	NA	NA	NA	NA
WP_051908722.1|1525764_1527069_+	hypothetical protein	NA	M1HHE0	Acanthocystis_turfacea_Chlorella_virus	34.2	1.6e-08
WP_038465097.1|1527457_1528987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465099.1|1529056_1529248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465101.1|1529505_1530381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465103.1|1530393_1531662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156956693.1|1532462_1532687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908723.1|1533470_1536113_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_051908724.1|1536162_1539030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908725.1|1539276_1540404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465109.1|1541014_1542688_+	F-box protein	NA	NA	NA	NA	NA
WP_084675972.1|1542814_1544521_+	F-box protein	NA	NA	NA	NA	NA
WP_038465113.1|1544950_1545673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465114.1|1545858_1546461_+	F-box protein	NA	NA	NA	NA	NA
WP_038465117.1|1547528_1548242_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.9	2.2e-52
WP_038462882.1|1548554_1549559_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP008941	Candidatus Paracaedibacter acanthamoebae isolate PRA3, complete genome	2470036	1564654	1621881	2470036	transposase,integrase	Streptococcus_phage(16.67%)	51	1611892:1611906	1626077:1626091
WP_075261607.1|1564654_1566139_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_051908730.1|1566242_1566722_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038465143.1|1566744_1569108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956695.1|1570249_1570447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465147.1|1570893_1573530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038465148.1|1573593_1573797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465152.1|1575217_1576102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908732.1|1577112_1577364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465154.1|1577417_1577633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038465156.1|1577696_1578389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465158.1|1578454_1579003_-	recombinase family protein	NA	A0JC18	Ralstonia_phage	44.3	8.2e-31
WP_051908733.1|1579161_1579824_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_038465160.1|1579813_1581199_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_075261577.1|1581273_1582824_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.8	2.9e-129
WP_084675978.1|1583586_1584012_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.8	1.8e-17
WP_084675980.1|1584002_1584518_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	32.5	1.3e-06
WP_084675981.1|1584887_1586561_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_038465165.1|1587251_1588637_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_051908735.1|1588626_1589208_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_038465168.1|1589752_1591609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465169.1|1591832_1592801_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.8	2.7e-45
WP_038465171.1|1592936_1593644_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_038465173.1|1593712_1594507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956696.1|1594510_1595272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465177.1|1595285_1596281_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	1.7e-18
WP_038465179.1|1596295_1597759_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_084675982.1|1597774_1598437_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_038465184.1|1598485_1599712_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_051908896.1|1599742_1600243_-	HIT family protein	NA	NA	NA	NA	NA
WP_084675983.1|1600279_1600981_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_156956697.1|1600980_1601340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465186.1|1601728_1601992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084675984.1|1601976_1602408_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_084675985.1|1602404_1602629_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	44.4	7.3e-10
WP_156956698.1|1602832_1603985_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.9	3.6e-20
WP_156956699.1|1605277_1605853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051908741.1|1605663_1606149_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038465190.1|1606655_1608512_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_156956763.1|1608936_1609869_+|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	49.3	6.9e-62
WP_051908742.1|1609903_1610725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156956765.1|1610879_1611086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038465194.1|1611169_1611760_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.2e-40
1611892:1611906	attL	TGAGAAAGAAGAAAG	NA	NA	NA	NA
WP_038465196.1|1612185_1612428_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_051908897.1|1612516_1612807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084676040.1|1613260_1614022_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_075261625.1|1614441_1614699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038465200.1|1615024_1615963_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_051908743.1|1616334_1617291_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	38.8	3.8e-47
WP_038465202.1|1617330_1619052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038465205.1|1619062_1620385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084675986.1|1621476_1621881_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	32.5	3.0e-06
1626077:1626091	attR	TGAGAAAGAAGAAAG	NA	NA	NA	NA
