The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008855	Bacillus sp. X1(2014) strain X1 chromosome, complete genome	3422674	5696	15109	3422674		Staphylococcus_phage(50.0%)	10	NA	NA
WP_038534885.1|5696_7415_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	7.0e-60
WP_038534887.1|7770_7971_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	1.3e-18
WP_038534889.1|8026_8269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038534892.1|8588_9056_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038534893.1|9402_10062_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	48.5	2.1e-41
WP_081905004.1|10098_10728_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	60.5	5.0e-64
WP_038534894.1|10766_11234_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	56.3	1.4e-42
WP_038534895.1|11654_12614_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038534896.1|12579_13638_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_038541571.1|13642_15109_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	30.8	6.7e-19
>prophage 2
NZ_CP008855	Bacillus sp. X1(2014) strain X1 chromosome, complete genome	3422674	1630415	1674661	3422674	transposase,protease	Bacillus_phage(40.0%)	39	NA	NA
WP_144243006.1|1630415_1632668_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_038537532.1|1632881_1633103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537534.1|1633215_1634475_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_038537536.1|1634666_1634936_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_038537539.1|1634949_1637061_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_051968223.1|1637549_1638068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537541.1|1638151_1639030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537544.1|1639034_1639640_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	7.5e-17
WP_038537548.1|1639632_1640826_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038538187.1|1640938_1642300_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	52.5	9.3e-124
WP_038537550.1|1642673_1643153_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_038537552.1|1643615_1644086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537554.1|1644298_1644520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038537556.1|1645134_1645860_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_038537558.1|1645862_1647290_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_038537560.1|1647317_1648034_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_038537562.1|1648278_1649007_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038537564.1|1649350_1651057_+	lactate permease LctP family transporter	NA	NA	NA	NA	NA
WP_038537566.1|1651264_1652677_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_038537569.1|1652673_1654002_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_038537571.1|1654529_1654772_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_038537574.1|1654845_1655778_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	49.0	4.0e-70
WP_038537577.1|1655867_1656125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537579.1|1656264_1657047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158332809.1|1657142_1657313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038537582.1|1657598_1658189_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_038541957.1|1658544_1658775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038537586.1|1660197_1660416_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_038537588.1|1660454_1660673_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_038537591.1|1660896_1661853_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_038537593.1|1661962_1663909_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_158332810.1|1664015_1665935_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_038537599.1|1666204_1667083_-	ROK family protein	NA	NA	NA	NA	NA
WP_038537601.1|1667645_1667930_+	DUF2651 family protein	NA	NA	NA	NA	NA
WP_038537603.1|1667954_1668965_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_038536220.1|1670741_1671302_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	31.5	1.2e-08
WP_051968224.1|1671463_1671991_+|transposase	transposase	transposase	Q9MBP7	Staphylococcus_prophage	39.6	1.2e-23
WP_038537606.1|1672762_1674256_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038537608.1|1674409_1674661_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP008855	Bacillus sp. X1(2014) strain X1 chromosome, complete genome	3422674	2230571	2240477	3422674		Synechococcus_phage(42.86%)	9	NA	NA
WP_038538843.1|2230571_2231870_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	3.5e-19
WP_038538846.1|2232090_2232804_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	44.1	4.8e-47
WP_038538849.1|2232796_2233051_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_038538851.1|2233047_2233731_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_038538854.1|2233714_2235940_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.8	1.8e-169
WP_038538858.1|2235915_2237325_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.5	6.4e-51
WP_038538860.1|2237330_2238365_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	45.7	3.3e-65
WP_038538863.1|2238361_2238964_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.8	9.1e-23
WP_038538866.1|2238938_2240477_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.6	2.4e-75
>prophage 4
NZ_CP008855	Bacillus sp. X1(2014) strain X1 chromosome, complete genome	3422674	2749047	2805743	3422674	transposase,integrase,tRNA	Bacillus_phage(33.33%)	55	2782138:2782195	2793468:2793525
WP_038538187.1|2749047_2750409_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	52.5	9.3e-124
WP_038539917.1|2750560_2752045_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_038539920.1|2752041_2752245_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_038539923.1|2752736_2753405_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	30.6	6.6e-14
WP_038539926.1|2753477_2753816_+	YfhH family protein	NA	NA	NA	NA	NA
WP_038539929.1|2753874_2754030_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_038539932.1|2754161_2754428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038539934.1|2754471_2755452_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038539936.1|2755614_2756721_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_038539939.1|2756758_2756950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038539942.1|2757065_2757815_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_038539947.1|2757889_2758102_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_038539950.1|2758269_2758527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038539952.1|2758689_2759220_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_038539954.1|2759411_2761181_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-52
WP_038539956.1|2761356_2762427_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_038542151.1|2762624_2767094_-	glutamate synthase	NA	NA	NA	NA	NA
WP_144242985.1|2767391_2768693_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_038539961.1|2768855_2769869_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.7	2.2e-21
WP_038539964.1|2769861_2770653_+	daunorubicin ABC transporter permease	NA	NA	NA	NA	NA
WP_038539966.1|2770659_2771445_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_051968357.1|2771600_2771951_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_038539972.1|2772033_2772501_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_038539974.1|2772789_2773341_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_038539977.1|2773448_2773901_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_038539980.1|2774204_2774555_-	YgzB family protein	NA	NA	NA	NA	NA
WP_038539983.1|2774706_2775582_+	hypothetical protein	NA	NA	NA	NA	NA
2782138:2782195	attL	GCACGACTCAAAATCGTGTTCCTTCGGGAGTGTCGGTTCGACCCCGACCACCGGTATC	NA	NA	NA	NA
WP_038539986.1|2782325_2783285_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	49.3	5.6e-75
WP_038539988.1|2783478_2784249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038539991.1|2784698_2785046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038539994.1|2785396_2785960_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	52.2	2.7e-45
WP_038539996.1|2786327_2786531_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038539999.1|2786686_2786881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038540002.1|2786877_2788005_+	DNA translocase FtsK	NA	A0A1B1P7T5	Bacillus_phage	38.8	8.9e-64
WP_038540005.1|2787997_2788627_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	51.5	4.4e-52
WP_038540008.1|2788623_2788845_-	helix-turn-helix transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	52.2	1.0e-11
WP_038540010.1|2788994_2789180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038540013.1|2789505_2789712_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038540016.1|2789725_2790217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081905138.1|2790468_2790921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038540018.1|2791007_2791223_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038540021.1|2791268_2791877_+	hypothetical protein	NA	A6M961	Geobacillus_virus	38.0	1.9e-07
WP_158332817.1|2792499_2792673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038540027.1|2792673_2793210_+	hypothetical protein	NA	Q331Y6	Clostridium_botulinum_C_phage	36.1	3.3e-08
WP_038537718.1|2794045_2795260_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
2793468:2793525	attR	GCACGACTCAAAATCGTGTTCCTTCGGGAGTGTCGGTTCGACCCCGACCACCGGTATC	NA	NA	NA	NA
WP_038540030.1|2795308_2796031_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.1	5.8e-32
WP_038540033.1|2796030_2797539_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_051968282.1|2797702_2798434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038540036.1|2798586_2799024_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	33.6	8.9e-12
WP_038540042.1|2799742_2799991_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_038540045.1|2800311_2800584_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_038540048.1|2801095_2801767_-|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_038540051.1|2801873_2803019_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_051968283.1|2803062_2804355_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.3	1.8e-28
WP_087946637.1|2804626_2805743_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	65.7	2.0e-103
