The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	20145	117826	5607837	terminase,integrase,holin,tRNA,head,portal,protease,tail,capsid,transposase	Bacillus_phage(48.44%)	107	65941:65958	78871:78888
WP_000719210.1|20145_21651_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000929880.1|21634_22336_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000833096.1|22479_23805_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_038413270.1|24519_25404_+	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	81.2	2.6e-119
WP_021729050.1|25492_25789_-	hypothetical protein	NA	A0A2H4J3A2	uncultured_Caudovirales_phage	82.5	7.6e-39
WP_038413267.1|25813_26032_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	90.3	1.0e-29
WP_031310119.1|26373_26565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413265.1|26580_26847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021729103.1|27194_27395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413238.1|28007_28940_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.6	7.2e-160
WP_021729298.1|28957_29188_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	2.8e-33
WP_038413236.1|29286_30561_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_031310537.1|31086_31338_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	72.5	7.3e-27
WP_023901837.1|31368_31746_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	64.5	2.7e-41
WP_038415075.1|31762_37321_-	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	61.3	0.0e+00
WP_038413233.1|37317_38787_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.7	3.2e-231
WP_151152591.1|38828_41222_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	41.4	4.3e-39
WP_140161228.1|41255_41369_+	TRASH domain-containing protein	NA	NA	NA	NA	NA
WP_038413229.1|42703_43066_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	69.2	1.2e-41
WP_001004921.1|43072_43666_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_038413227.1|43666_43996_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	85.3	1.2e-48
WP_038413224.1|43992_44349_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	59.0	2.0e-33
WP_038413222.1|44341_44641_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_038413220.1|44637_44910_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	55.1	3.6e-19
WP_001016250.1|44906_45164_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_038413218.1|45179_46364_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	23.1	7.3e-08
WP_000361708.1|46380_46965_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_038413216.1|46921_48145_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.3	1.3e-140
WP_038413214.1|48158_49859_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.5	2.6e-248
WP_038413211.1|49855_50218_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_038413207.1|50707_51010_-	HNH endonuclease	NA	A0A1S5SD32	Streptococcus_phage	46.6	2.4e-08
WP_038413205.1|51026_51248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686481.1|51425_51608_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_038413203.1|51659_52085_+	pilus assembly protein HicB	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	78.7	2.5e-59
WP_038413911.1|52470_52872_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	97.7	5.2e-67
WP_038413201.1|52909_53236_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	1.4e-57
WP_000540089.1|53232_53760_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.9	8.3e-97
WP_038413198.1|53798_54158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093039.1|54240_55032_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_038413196.1|55178_55469_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	95.8	1.7e-51
WP_038413194.1|55527_55962_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	95.8	2.3e-76
WP_001245737.1|56000_56558_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_038413192.1|56581_56812_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	1.7e-33
WP_038413190.1|56804_57284_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	96.9	1.4e-82
WP_038413188.1|57295_58249_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	4.9e-148
WP_038413186.1|58342_58681_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	98.2	7.5e-51
WP_038413184.1|58613_58829_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	94.4	3.6e-30
WP_000178946.1|58828_59542_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.6	1.9e-128
WP_000453492.1|59559_59994_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	98.6	3.1e-73
WP_001187283.1|60020_60209_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_038413182.1|60220_61036_-	antirepressor	NA	A0A0S2MV65	Bacillus_phage	83.3	1.8e-122
WP_000383685.1|61260_61449_-	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_001042666.1|61462_61717_-	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_038413181.1|61902_62382_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	98.7	7.6e-81
WP_021729275.1|62395_62836_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	100.0	1.8e-81
WP_021729274.1|62862_63930_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	100.0	1.5e-201
WP_000743906.1|63995_65534_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
65941:65958	attL	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_016090283.1|66253_66463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090284.1|66475_66805_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_044157420.1|66821_68414_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090286.1|68466_68814_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_016090287.1|68940_69231_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090288.1|69223_69511_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090289.1|69577_70840_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090290.1|70844_71423_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090291.1|71419_72616_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090293.1|72769_72997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038415078.1|73328_75758_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	4.9e-83
WP_016090295.1|75859_76186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090297.1|76488_76758_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090298.1|76980_77565_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090299.1|77613_78792_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.9	8.0e-140
WP_001029993.1|78870_80505_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
78871:78888	attR	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_000917311.1|80543_80828_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_000745326.1|81219_81969_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001246200.1|81965_82157_+	YdiK family protein	NA	NA	NA	NA	NA
WP_000372699.1|82186_82816_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001987845.1|82949_84929_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000414585.1|85414_86431_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
WP_000367190.1|86430_86874_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000865756.1|86887_87580_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000049649.1|87560_88034_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000344239.1|94528_94987_-	SprT family protein	NA	NA	NA	NA	NA
WP_001143642.1|95182_95299_+	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000426236.1|95357_97526_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000635965.1|97593_97944_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_038415080.1|97948_98236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390616.1|98544_99714_-	alanine racemase	NA	NA	NA	NA	NA
WP_002100659.1|99831_100782_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000583417.1|100938_101298_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_038415082.1|101391_101964_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000961167.1|101956_102919_-	UV DNA damage repair endonuclease UvsE	NA	NA	NA	NA	NA
WP_000206584.1|103013_104591_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
WP_000595961.1|104895_106272_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000161427.1|106334_107420_-	D-alanine--D-alanine ligase B	NA	NA	NA	NA	NA
WP_000799726.1|107648_108920_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.9	7.8e-16
WP_000809349.1|109027_110443_-	amino acid permease	NA	NA	NA	NA	NA
WP_013141710.1|110675_111848_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000674006.1|111813_112770_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000810922.1|112836_113955_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_001083690.1|114348_114459_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|114502_114619_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|114653_114770_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|114804_114921_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_025988984.1|114955_115072_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000766421.1|115504_116377_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_087942833.1|116484_117826_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 2
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	691419	788400	5607837	terminase,integrase,holin,tRNA,portal,head,protease,tail,capsid	Bacillus_phage(36.21%)	111	707688:707708	743612:743632
WP_001267308.1|691419_691800_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001127250.1|691956_692886_+	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_000922850.1|692912_693725_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002097946.1|693792_694443_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_001255073.1|694476_694989_+	acyltransferase	NA	NA	NA	NA	NA
WP_000517720.1|695128_696640_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001288079.1|696725_697682_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.0e-89
WP_000455200.1|697847_698654_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001190080.1|698883_699342_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000138459.1|699362_700244_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_000712186.1|700247_701201_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.8	1.7e-63
WP_000006560.1|701289_702240_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.7e-52
WP_000250307.1|702263_702512_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001049162.1|702839_703421_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000018924.1|703661_704531_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000215909.1|704551_704758_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000575919.1|704769_705120_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000938972.1|705116_706133_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000095408.1|706133_706610_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_001226064.1|706639_707128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216166.1|707221_707428_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
707688:707708	attL	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_038413879.1|707842_708979_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	4.0e-96
WP_038413877.1|709009_709477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523448.1|709487_709880_-	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	2.5e-13
WP_000216290.1|710044_710275_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523446.1|710309_710543_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_038413873.1|710769_710997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209506.1|710997_711348_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	66.4	3.2e-36
WP_003280171.1|711368_712016_+	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	78.1	9.9e-92
WP_038413868.1|712249_712453_+	hypothetical protein	NA	A0A2H4J979	uncultured_Caudovirales_phage	85.1	2.3e-23
WP_038413866.1|712452_712734_+	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	82.8	9.4e-39
WP_038413864.1|712711_713263_+	hypothetical protein	NA	A0A2H4JFX2	uncultured_Caudovirales_phage	92.3	6.7e-89
WP_038413862.1|713265_713862_+	hypothetical protein	NA	A0A1B2AQ10	Phage_Wrath	88.4	1.0e-90
WP_038413860.1|713877_714570_+	AAA family ATPase	NA	A0A2H4J9A0	uncultured_Caudovirales_phage	95.9	1.6e-119
WP_038413858.1|714569_715049_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	43.8	1.4e-29
WP_038413856.1|715115_715496_+	hypothetical protein	NA	A8E2Q7	Enterococcus_phage	48.8	2.2e-27
WP_038413854.1|715492_717847_+	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	87.0	0.0e+00
WP_038413852.1|718112_718541_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	86.6	4.9e-71
WP_080703607.1|718543_718918_+	hypothetical protein	NA	H0USU9	Bacillus_phage	55.6	1.5e-28
WP_000617754.1|718914_719454_+	hypothetical protein	NA	A0A0S2SXQ1	Bacillus_phage	51.4	7.6e-45
WP_000331834.1|719455_719728_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	53.4	3.4e-17
WP_000169951.1|719779_720217_+	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	82.1	6.1e-61
WP_001216580.1|720286_720550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413846.1|720585_720885_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	74.7	7.9e-36
WP_140159945.1|721043_721232_+	hypothetical protein	NA	S5MC27	Brevibacillus_phage	62.3	1.1e-11
WP_038413844.1|721273_721660_+	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	74.4	4.4e-47
WP_038413842.1|721859_722249_+	DUF3942 domain-containing protein	NA	NA	NA	NA	NA
WP_038413982.1|722872_723070_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	80.0	2.1e-21
WP_038413841.1|723115_723337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413839.1|723333_723657_+	phage protein	NA	A0A1C8EAA0	Bacillus_phage	57.4	4.5e-21
WP_038413837.1|723653_724046_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.9	9.6e-74
WP_038413835.1|724130_724568_+|terminase	terminase small subunit	terminase	A0A1B1P7N7	Bacillus_phage	90.3	2.0e-67
WP_038413833.1|724564_726292_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	97.7	0.0e+00
WP_038413832.1|726307_727513_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	91.0	1.3e-209
WP_038413830.1|727481_728060_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	81.5	1.4e-84
WP_038413828.1|728061_729429_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	79.3	7.8e-155
WP_038413826.1|729430_729691_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	94.2	1.7e-39
WP_038413824.1|729665_730001_+	phage protein	NA	A0A1B0T691	Bacillus_phage	97.2	7.2e-54
WP_038413822.1|729990_730320_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	4.4e-56
WP_038413820.1|730319_730697_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	99.2	5.1e-64
WP_038413819.1|730708_731344_+|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	96.2	3.8e-112
WP_000113342.1|731355_731742_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	100.0	7.3e-66
WP_038413816.1|731985_735507_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	84.9	1.6e-284
WP_038413814.1|735508_736192_+	hypothetical protein	NA	A0A1B1P7Q0	Bacillus_phage	97.8	9.1e-128
WP_038413812.1|736188_738531_+	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	97.8	0.0e+00
WP_038413811.1|738545_739826_+	DUF2479 domain-containing protein	NA	A0A1C8E978	Bacillus_phage	77.5	3.1e-190
WP_038413980.1|739875_740085_+	hypothetical protein	NA	A0A1B2APY8	Phage_Wrath	84.8	7.0e-23
WP_038413810.1|740086_740290_+	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	95.3	8.8e-31
WP_038413809.1|740286_741339_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	93.1	6.4e-189
WP_038413808.1|741517_741850_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	70.0	1.5e-32
WP_038413806.1|741928_742177_-	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	95.1	2.7e-37
WP_038413978.1|742490_743324_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.2	3.8e-120
WP_000647955.1|743890_745198_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
743612:743632	attR	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_000869730.1|745207_745453_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_001258185.1|745588_746617_+	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000161236.1|746643_747648_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001036350.1|747787_748972_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_001231038.1|749004_749760_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001231158.1|749756_751286_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000103951.1|751316_752612_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001125064.1|752663_753614_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000673222.1|753966_754335_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000557264.1|755117_755351_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000976870.1|755509_756253_+	carboxylesterase	NA	NA	NA	NA	NA
WP_000391097.1|756395_758834_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_001123919.1|758960_759428_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000915084.1|760235_761168_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_001100112.1|762721_762901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|763074_764382_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_002101540.1|765125_765446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000815809.1|766696_767374_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000749436.1|767701_768718_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000042063.1|768737_769754_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	6.0e-59
WP_000631245.1|769750_770815_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000590071.1|770811_771564_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000576729.1|772012_773551_+	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_038415123.1|773757_774729_-	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000635745.1|775183_776146_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000834708.1|776195_776600_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001071092.1|776742_777258_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000054869.1|777695_779243_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	6.7e-54
WP_001293750.1|779248_780442_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	2.0e-42
WP_000792610.1|780622_780835_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_000980954.1|780901_781141_+	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000568580.1|781169_781526_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_001986875.1|781522_781957_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000714051.1|782273_783332_+	endonuclease	NA	NA	NA	NA	NA
WP_000455078.1|783364_784867_+	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000573649.1|785075_785471_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_001057102.1|785853_786771_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001021098.1|787140_788400_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	9.0e-89
>prophage 3
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	890024	986522	5607837	integrase,terminase,coat,holin,tRNA,portal,head,protease,tail,capsid,transposase	Bacillus_phage(79.03%)	100	902586:902605	991977:991996
WP_000241505.1|890024_891137_-|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000856300.1|891142_892489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106091.1|892433_893537_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000351147.1|893699_894203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665094.1|894226_894718_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000614218.1|894838_895840_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125494.1|895901_896117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|896311_896548_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248588.1|896743_897052_+	YuzD family protein	NA	NA	NA	NA	NA
WP_002101505.1|897104_897899_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|898021_898690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002101500.1|898740_899379_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000843107.1|899365_899836_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000383681.1|899925_900180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607080.1|900216_900600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155274731.1|900888_901686_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000622258.1|901755_902037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212737.1|902196_902538_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
902586:902605	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000679246.1|902758_903556_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470265.1|903539_904199_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_001054089.1|904254_904428_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000682077.1|904661_905732_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000595026.1|906078_906318_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077397.1|906586_907453_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573825.1|907494_907848_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_087942842.1|907929_909275_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000834606.1|909700_910465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833145.1|911088_911442_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000237487.1|911530_912592_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000896931.1|913554_913785_+	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_001164934.1|913952_915083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|915485_915815_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_000368216.1|916062_916308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277643.1|916452_916641_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000960416.1|916958_917675_+	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000218620.1|917836_918151_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382495.1|918425_919073_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	99.5	8.9e-117
WP_015382176.1|919296_920313_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|920275_921088_+	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|921129_921396_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|921467_921632_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|921649_921865_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|921861_922161_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001098845.1|922311_922611_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000404184.1|922964_923372_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|924780_925062_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166155.1|925419_925905_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|925901_926444_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382276.1|926650_926896_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_000017440.1|927298_927586_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000464752.1|927622_927850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443965.1|927895_928075_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000002725.1|928109_928349_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000773601.1|928365_928578_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000870105.1|928712_928967_+	hypothetical protein	NA	W8CYT4	Bacillus_phage	97.6	1.3e-42
WP_001139454.1|928956_929334_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000233390.1|929463_929967_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_000621131.1|929968_931663_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000577489.1|931851_933105_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_001259159.1|933091_933802_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000361137.1|933839_935006_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_000244586.1|935026_935314_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382490.1|935300_935624_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000763219.1|935616_936051_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_000609194.1|936047_936407_+	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000896769.1|936407_937016_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_015382489.1|937062_937380_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000344049.1|937408_937585_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_000517105.1|944142_945624_+|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_001260185.1|945620_949646_+	hypothetical protein	NA	H0USX5	Bacillus_phage	93.6	0.0e+00
WP_000373903.1|950070_950496_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_000405777.1|950495_951197_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000119484.1|953173_953512_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000043398.1|953565_954144_-	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_001137905.1|954149_954329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649833.1|954337_954535_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001257569.1|954717_955035_+	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000170777.1|955031_955214_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_000891535.1|955329_956511_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000551103.1|956452_957073_+	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000710530.1|957082_957910_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000635484.1|958232_958694_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_038415129.1|958773_959655_+	decarboxylase	NA	NA	NA	NA	NA
WP_000391942.1|959672_960920_-	MFS transporter	NA	NA	NA	NA	NA
WP_000902159.1|961085_961565_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038415131.1|962035_972007_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000829788.1|972119_973109_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856612.1|973570_974779_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000415321.1|974902_975409_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027016.1|975405_975723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920098.1|975809_976436_+	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000487942.1|976595_978080_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000545253.1|978254_978860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104221.1|979003_980728_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_002097988.1|980835_981723_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001252163.1|981768_982362_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_038415133.1|982412_983156_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001140612.1|983251_983635_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_087942833.1|983689_985032_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000287147.1|985145_986522_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
991977:991996	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	1336379	1344065	5607837		Bacillus_phage(33.33%)	9	NA	NA
WP_001036847.1|1336379_1337363_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
WP_000403760.1|1337352_1338123_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001086121.1|1338155_1338920_+	class B sortase	NA	NA	NA	NA	NA
WP_000587826.1|1338992_1339316_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255971.1|1339611_1340811_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_001014310.1|1340849_1341044_-	YwbE family protein	NA	NA	NA	NA	NA
WP_000018029.1|1341386_1342079_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_000609140.1|1342080_1343016_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000221066.1|1343141_1344065_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 5
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	3638221	3690652	5607837	integrase,transposase,tRNA,bacteriocin	Orpheovirus(28.57%)	32	3663261:3663277	3689204:3689220
WP_000377332.1|3638221_3639520_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.5	1.8e-76
WP_001167912.1|3640061_3640541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|3640683_3642028_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000482274.1|3642085_3643597_-	peptidase M36	NA	NA	NA	NA	NA
WP_000045222.1|3643927_3644512_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001093123.1|3644513_3645599_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_000754899.1|3645649_3648751_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.9	5.7e-153
WP_000883846.1|3649138_3653341_-|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_000275558.1|3653678_3654170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498601.1|3654281_3654500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621475.1|3654529_3654859_-	DUF2085 domain-containing protein	NA	NA	NA	NA	NA
WP_000384921.1|3654971_3656660_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	8.1e-77
WP_000637451.1|3656960_3657737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063706.1|3657786_3658221_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000634884.1|3658304_3658688_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_000692580.1|3658691_3659819_-	PBS lyase	NA	NA	NA	NA	NA
WP_000714949.1|3660236_3660797_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001082769.1|3661133_3661466_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	61.1	1.1e-33
WP_001259000.1|3661806_3662898_-	hypothetical protein	NA	NA	NA	NA	NA
3663261:3663277	attL	GAAAGGATGGCGTTTTT	NA	NA	NA	NA
WP_001089284.1|3664173_3664683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021280.1|3664996_3665233_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000239530.1|3669675_3670629_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000451337.1|3672840_3673578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009203.1|3674101_3677581_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_038415434.1|3677958_3678687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038415438.1|3678688_3680398_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_038415442.1|3683105_3683729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|3683870_3685166_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|3685155_3685908_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001053969.1|3686906_3688343_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|3688662_3689073_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|3689221_3690652_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
3689204:3689220	attR	GAAAGGATGGCGTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	3796109	3861233	5607837	integrase,terminase,bacteriocin,coat,head,protease,tail,capsid,transposase	Bacillus_phage(89.8%)	74	3795748:3795766	3841066:3841084
3795748:3795766	attL	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_000730123.1|3796109_3796934_+	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
WP_000551102.1|3796943_3797564_-	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	8.3e-112
WP_000891545.1|3797505_3798687_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000170790.1|3798802_3798985_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_001257568.1|3798981_3799296_-	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000941958.1|3799484_3799691_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_000669561.1|3799690_3800494_+	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000751888.1|3800563_3801628_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000389067.1|3801624_3801855_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000822831.1|3801907_3802867_-|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.4	1.2e-173
WP_038415465.1|3802968_3806994_-	phage minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	89.8	0.0e+00
WP_038413466.1|3806990_3808475_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	99.4	1.9e-295
WP_038415467.1|3808486_3812335_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	88.8	0.0e+00
WP_078405533.1|3812349_3812613_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	88.7	5.3e-20
WP_000169371.1|3813156_3814464_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|3814637_3814817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015382186.1|3816189_3816507_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_000896775.1|3816554_3817160_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382185.1|3817160_3817520_-	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_015382183.1|3817942_3818266_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_000244586.1|3818252_3818540_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_000361137.1|3818560_3819727_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_001259159.1|3819764_3820475_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000233390.1|3823584_3824088_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|3824217_3824595_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000870105.1|3824584_3824839_-	hypothetical protein	NA	W8CYT4	Bacillus_phage	97.6	1.3e-42
WP_000773601.1|3824973_3825186_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|3825202_3825442_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|3825476_3825656_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|3825701_3825929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|3825965_3826253_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_015382276.1|3826655_3826901_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_001012176.1|3827107_3827650_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_000166155.1|3827646_3828132_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000965619.1|3828490_3828772_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|3830175_3830583_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|3830936_3831236_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|3831386_3831686_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|3831682_3831898_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|3831915_3832080_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|3832151_3832418_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|3832459_3833272_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382274.1|3833234_3834251_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.0e-187
WP_038415676.1|3834493_3835141_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.9e-112
WP_000176230.1|3835164_3835473_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_015382272.1|3835634_3836378_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	76.4	2.9e-103
WP_000549467.1|3836603_3836792_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_000714354.1|3836867_3837074_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000258007.1|3837249_3837594_+	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_000936291.1|3837993_3839214_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_038415472.1|3839953_3841045_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.3	6.9e-162
WP_001166434.1|3841376_3841967_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
3841066:3841084	attR	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_002004921.1|3842056_3843211_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000226253.1|3843281_3844250_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000741975.1|3844252_3844681_-	NfeD family protein	NA	NA	NA	NA	NA
WP_001245226.1|3844955_3846173_+	MFS transporter	NA	NA	NA	NA	NA
WP_000405394.1|3846222_3847698_-	amidase	NA	NA	NA	NA	NA
WP_000178288.1|3847880_3848327_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000747647.1|3848350_3849091_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_000617573.1|3849102_3849600_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015382268.1|3849855_3850989_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000770738.1|3851097_3851394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016109792.1|3851398_3851704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435828.1|3851676_3852243_-	DUF1572 domain-containing protein	NA	NA	NA	NA	NA
WP_001263016.1|3852223_3852553_-	chaperone CsaA	NA	NA	NA	NA	NA
WP_000839661.1|3852618_3853965_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_087942842.1|3854441_3855786_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_001220524.1|3855846_3856494_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_000055257.1|3856750_3857620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000353738.1|3857828_3859136_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000217338.1|3859137_3859620_+	DUF456 family protein	NA	NA	NA	NA	NA
WP_000861653.1|3859644_3860268_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001045960.1|3860369_3860549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340535.1|3860774_3861233_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	3869597	3923149	5607837	coat,protease,transposase	Bacillus_phage(30.77%)	55	NA	NA
WP_000937997.1|3869597_3870674_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000817485.1|3870855_3871398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000858822.1|3871444_3872056_-	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000943769.1|3872628_3873045_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000824280.1|3873104_3874766_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002098546.1|3874850_3875837_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000283913.1|3875862_3876315_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_001083648.1|3876448_3877486_+	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_001042736.1|3877515_3878175_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001053969.1|3878470_3879907_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_002132987.1|3879884_3880106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126151.1|3880370_3881321_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|3881459_3881930_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000613420.1|3882042_3882993_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001040871.1|3883090_3884560_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000376357.1|3884821_3885724_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001068749.1|3885748_3886333_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001168116.1|3886417_3887881_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_000683357.1|3888058_3888250_+	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_000594031.1|3888354_3889356_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087942833.1|3889468_3890810_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000798320.1|3890871_3891816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488206.1|3892031_3892487_-	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000105199.1|3892589_3893033_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000370203.1|3893273_3894314_+	membrane protein	NA	NA	NA	NA	NA
WP_000965059.1|3894348_3894714_-	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000539571.1|3895036_3895342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001073075.1|3897720_3898773_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000426317.1|3899678_3900026_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|3900110_3900335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|3900534_3900897_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001101741.1|3901040_3901247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082497.1|3901295_3902471_-	MFS transporter	NA	NA	NA	NA	NA
WP_000874082.1|3902518_3903454_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001259906.1|3903560_3903869_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000099756.1|3903910_3904858_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_000648325.1|3905132_3905420_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_001026002.1|3905535_3907416_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000174901.1|3907691_3908510_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_000024999.1|3908559_3909021_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_001048102.1|3909052_3909250_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|3909355_3910516_-	peptidase	NA	NA	NA	NA	NA
WP_001034835.1|3910666_3911419_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000540423.1|3911642_3911783_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000686789.1|3911870_3912836_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000816391.1|3912949_3913117_-	DUF3933 domain-containing protein	NA	NA	NA	NA	NA
WP_000439399.1|3913129_3914572_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001287305.1|3914690_3915305_+	amino acid transporter	NA	NA	NA	NA	NA
WP_033667350.1|3915358_3916588_-	MFS transporter	NA	NA	NA	NA	NA
WP_000113545.1|3916823_3917030_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_000877670.1|3917154_3917997_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000200704.1|3918034_3919018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001250558.1|3919041_3919308_-	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000909581.1|3919304_3920543_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_000275580.1|3921853_3923149_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
>prophage 8
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	3946118	3954269	5607837		Bacillus_phage(66.67%)	7	NA	NA
WP_001258538.1|3946118_3946991_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
WP_000818979.1|3947281_3948001_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001231621.1|3948290_3949364_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000612414.1|3949360_3950038_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_000453861.1|3950123_3951884_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_001194306.1|3952124_3952889_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755525.1|3952988_3954269_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 9
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	4617220	4690702	5607837	terminase,holin,tRNA,head,portal,protease,tail,capsid,transposase	Bacillus_phage(46.0%)	83	NA	NA
WP_000110985.1|4617220_4618210_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000966128.1|4618490_4619237_-	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	40.5	8.0e-45
WP_000513275.1|4619380_4620169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412656.1|4620275_4621514_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_001100533.1|4621545_4622478_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_001986215.1|4623015_4623192_-	competence protein ComG	NA	NA	NA	NA	NA
WP_000487722.1|4623246_4624119_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000028691.1|4624148_4624883_-	hydrolase	NA	NA	NA	NA	NA
WP_001211116.1|4625039_4625222_+	YjzD family protein	NA	NA	NA	NA	NA
WP_000365401.1|4625260_4627861_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.1	2.4e-120
WP_000531421.1|4628070_4628250_-	YjzC family protein	NA	NA	NA	NA	NA
WP_001041232.1|4628741_4629551_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000516816.1|4629656_4629797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527407.1|4629797_4629995_+	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_000364432.1|4630020_4630878_-	YitT family protein	NA	NA	NA	NA	NA
WP_001120849.1|4630978_4631128_+	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_001214215.1|4631257_4632115_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_001153798.1|4632154_4632418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548429.1|4632637_4633123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281260.1|4633541_4634396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040149.1|4634626_4635118_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000397871.1|4635979_4636291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103580702.1|4636591_4637833_-	alpha-amylase	NA	NA	NA	NA	NA
WP_000367127.1|4638106_4639342_+	ammonium transporter	NA	NA	NA	NA	NA
WP_000076219.1|4639462_4640104_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001238640.1|4640280_4640517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003283577.1|4640537_4641164_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_000148974.1|4641271_4641505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619724.1|4641494_4641791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038415544.1|4641804_4646343_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.1	7.2e-72
WP_000486133.1|4646388_4646739_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_001069180.1|4647550_4649017_-	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
WP_000163133.1|4649076_4650036_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000730207.1|4650514_4651348_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000100788.1|4651365_4651656_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_001016122.1|4651680_4651899_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000742862.1|4652038_4652605_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_000405773.1|4652770_4653703_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000373898.1|4653702_4654128_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_001004976.1|4654165_4654540_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	98.4	2.7e-65
WP_015382232.1|4654555_4659400_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_000094123.1|4659396_4660866_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
WP_015382231.1|4660907_4664540_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_038415545.1|4664760_4665132_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	69.7	3.5e-41
WP_001004921.1|4665138_4665732_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000172080.1|4665732_4666062_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001273706.1|4666058_4666415_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000998123.1|4666407_4666707_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_000600950.1|4666703_4666976_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_001016250.1|4666972_4667230_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_001031425.1|4667245_4668430_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_000361708.1|4668446_4669031_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_000499523.1|4669327_4670521_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000522435.1|4670615_4671794_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_033676369.1|4671807_4673496_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_001282601.1|4673504_4673867_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_038415547.1|4674356_4674659_-	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	47.5	5.7e-18
WP_000196707.1|4674675_4674876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686481.1|4675054_4675237_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000711196.1|4675288_4675708_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_033676375.1|4676090_4676492_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_038413362.1|4676529_4676856_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	2.3e-57
WP_000540088.1|4676852_4677380_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_000590880.1|4677415_4677727_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000389429.1|4677960_4678365_-	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000356654.1|4678524_4678707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093039.1|4678791_4679583_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_001268033.1|4679729_4680020_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_001010921.1|4680078_4680513_-	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_015382228.1|4680551_4681109_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_000139235.1|4681132_4681363_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933912.1|4681355_4681835_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000510888.1|4681846_4682800_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_038413358.1|4682893_4683232_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_015382226.1|4683164_4683380_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_000178947.1|4683379_4684093_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_000453494.1|4684111_4684546_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_001186272.1|4684572_4684761_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000372563.1|4684772_4685525_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_000385074.1|4686007_4686280_-	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000130922.1|4686429_4687113_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000289677.1|4687128_4687347_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038415549.1|4688923_4690702_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
>prophage 10
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	5160933	5215313	5607837	integrase,terminase,head,portal,protease,tail,capsid,transposase	Bacillus_phage(92.31%)	59	5163550:5163568	5205548:5205566
WP_000948949.1|5160933_5162250_-	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
WP_038415591.1|5162237_5163410_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
5163550:5163568	attL	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730127.1|5163907_5164789_+	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000842173.1|5164793_5165402_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000511371.1|5165391_5166558_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000495118.1|5166568_5166889_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000467327.1|5167351_5167573_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000423300.1|5167641_5167971_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000542506.1|5168011_5168830_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_001076454.1|5168829_5169042_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000151530.1|5169044_5169326_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_000822820.1|5169339_5170299_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_015382189.1|5170395_5174421_-	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000232880.1|5174417_5175902_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_000779042.1|5180061_5180379_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_000896661.1|5180425_5181031_-|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_000609197.1|5181031_5181391_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	100.0	3.5e-62
WP_000763223.1|5181387_5181825_-	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_001068030.1|5181817_5182141_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000244586.1|5182127_5182415_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_038415593.1|5182435_5183602_-|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	96.9	1.4e-208
WP_038415596.1|5184337_5185591_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.5	5.9e-242
WP_015382179.1|5185779_5187474_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_000233388.1|5187475_5187979_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_001139459.1|5188107_5188485_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_001198493.1|5188474_5188729_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_000778983.1|5188864_5189077_-	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_000002720.1|5189093_5189333_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000443964.1|5189361_5189547_-	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_001050326.1|5189595_5190462_-	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000792998.1|5190543_5190726_-	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_015382178.1|5191097_5191343_-	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_001012176.1|5191549_5192092_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_000166155.1|5192088_5192574_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_038415598.1|5192931_5193216_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	97.9	4.9e-43
WP_000404184.1|5194624_5195032_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|5195385_5195685_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|5195835_5196135_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5196131_5196347_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5196364_5196529_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5196600_5196867_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5196908_5197721_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382176.1|5197683_5198700_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_000123128.1|5198923_5199571_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_015382175.1|5200320_5201100_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000549466.1|5201325_5201514_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_000813892.1|5201546_5201783_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000511082.1|5201931_5202276_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000466636.1|5202675_5203914_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_038415600.1|5204431_5205532_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	99.7	4.3e-204
WP_038413299.1|5205470_5206517_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
5205548:5205566	attR	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730997.1|5206593_5207445_-	phospholipase C	NA	NA	NA	NA	NA
WP_087970930.1|5207786_5208945_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000948209.1|5208989_5209334_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000645827.1|5209453_5210506_-	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_038415602.1|5210731_5211886_+	MFS transporter	NA	NA	NA	NA	NA
WP_000964468.1|5211806_5212232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658667.1|5212253_5212595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001252962.1|5212913_5215313_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 11
NZ_CP007607	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5607837	5571796	5580172	5607837		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|5571796_5572384_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|5572380_5573421_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|5573526_5574942_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055562.1|5574926_5577146_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000666789.1|5577129_5577813_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5577809_5578064_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|5578056_5578776_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|5578864_5580172_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 1
NZ_CP007615	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence	293574	151773	225452	293574	holin,transposase	Bacillus_phage(33.33%)	41	NA	NA
WP_087942375.1|151773_153335_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_000762722.1|153747_154152_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	6.5e-41
WP_000929144.1|155400_155697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015406625.1|156813_157932_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	3.0e-173
WP_000701098.1|159288_160362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|160473_161385_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033679397.1|162062_163184_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.9e-170
WP_000790998.1|163941_165261_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000975321.1|165323_166553_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_001063469.1|166584_167718_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_015406629.1|171252_172248_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000998670.1|173130_173400_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001227945.1|173399_174002_+	SdpI family protein	NA	NA	NA	NA	NA
WP_000827070.1|174446_174977_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_000473523.1|174961_175912_+	membrane protein	NA	NA	NA	NA	NA
WP_000724589.1|175955_176576_+	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_000526840.1|176765_177158_+	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_000730548.1|177477_178794_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015406631.1|179429_179963_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.9	7.3e-16
WP_078405493.1|180025_180226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000423181.1|180447_181338_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000864460.1|183352_183805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|185464_186760_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|186749_187502_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000357137.1|188728_190144_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001039073.1|192608_194978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089638.1|197715_199617_+	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_016090221.1|201539_203270_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.6e-16
WP_001026061.1|204106_204601_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000380161.1|204605_205805_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_000215668.1|206215_207172_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	40.1	4.8e-50
WP_000369823.1|207461_210992_+	pesticidal crystal protein cry1Aa	NA	NA	NA	NA	NA
WP_000769223.1|211498_213658_+	pesticidal crystal protein cry1Ia	NA	NA	NA	NA	NA
WP_014481901.1|213872_214979_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_000591046.1|215144_216170_-	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	40.4	9.1e-23
WP_000555978.1|216184_216817_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_001067062.1|218877_220779_-	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_000922362.1|220868_221627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545193.1|221793_222297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679389.1|224417_224669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000892197.1|225029_225452_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
>prophage 1
NZ_CP007616	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence	416210	8177	75349	416210	protease,transposase	Bacillus_phage(62.5%)	55	NA	NA
WP_040120027.1|8177_9473_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.3e-42
WP_001245659.1|10177_12001_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.4	1.7e-24
WP_040120028.1|14824_15262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120029.1|15933_17808_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	2.6e-36
WP_016090246.1|18040_19741_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000228952.1|19999_20983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090247.1|20986_21919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002183131.1|22134_22422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633815.1|23239_23524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090248.1|23718_24486_+	hypothetical protein	NA	I3VYV9	Thermoanaerobacterium_phage	27.9	1.1e-09
WP_109141051.1|24528_24711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679411.1|24738_25218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679413.1|25855_26242_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000798818.1|26228_26639_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_016090251.1|28924_30634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090252.1|32459_34157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090253.1|34317_34785_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000688781.1|35138_36788_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.4	7.0e-09
WP_016090254.1|36998_37346_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	36.1	1.3e-10
WP_040120030.1|37562_38681_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.8	8.3e-171
WP_000577229.1|39110_39518_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016090256.1|39507_39921_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000913857.1|40553_41039_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016090258.1|42020_43763_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_001167047.1|43929_44145_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
WP_000733519.1|44217_44634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090260.1|45488_46583_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.9	2.8e-94
WP_016090261.1|46881_47097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120031.1|47207_48182_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000824502.1|48536_48920_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000677474.1|52000_52432_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000926479.1|52599_53181_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016090269.1|53212_53662_+	cyanase	NA	NA	NA	NA	NA
WP_013555075.1|53789_55070_+	xanthine/uracil/vitamin C permease	NA	NA	NA	NA	NA
WP_016090270.1|55698_56151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691090.1|57570_57723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178819.1|58427_58763_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_000797393.1|58759_59473_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_016090272.1|59701_61090_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_016097395.1|61231_62344_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	7.9e-81
WP_000762755.1|62355_62754_-|transposase	IS200/IS605-like element ISBth16 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.3e-51
WP_016090274.1|63138_64350_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000673778.1|64614_65043_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
WP_000579788.1|65065_65494_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000527101.1|65630_65867_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_016090275.1|65939_66866_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	3.7e-76
WP_000460733.1|66968_67355_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_016099955.1|67592_68561_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_001051379.1|68702_69524_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	4.9e-27
WP_000405795.1|69796_70681_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.2e-77
WP_016090502.1|70871_71105_+	XpaF1 protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	83.8	8.1e-12
WP_000499523.1|71199_72393_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000570185.1|72690_72930_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_016090503.1|72926_73982_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	72.1	6.2e-152
WP_040120045.1|74227_75349_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.2	8.3e-163
>prophage 2
NZ_CP007616	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence	416210	118531	188629	416210	transposase	Bacillus_phage(27.27%)	45	NA	NA
WP_040120033.1|118531_119650_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	8.9e-173
WP_016090534.1|120009_120282_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	2.8e-24
WP_016090535.1|120420_120786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936395.1|121674_122100_+	HD domain-containing protein	NA	A0A060QNR4	Streptococcus_phage	64.2	1.1e-38
WP_016090536.1|122270_124106_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016090537.1|124494_125220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090538.1|126362_127103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090539.1|127625_127949_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016090540.1|127970_129023_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_016090541.1|129303_131217_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016090543.1|131850_132288_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016090544.1|132540_133959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090545.1|134466_135540_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.9	9.1e-74
WP_000709205.1|135536_135662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090546.1|135803_136349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090547.1|137291_138392_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_016090548.1|138924_141636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090549.1|141955_142789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090550.1|143569_144268_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_016090551.1|144458_145283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|146280_147033_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|147022_148318_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_016090552.1|148603_150661_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.6	1.3e-41
WP_153580446.1|151310_151466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090553.1|151794_152136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090555.1|153155_154247_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	8.6e-88
WP_033679605.1|154724_154937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090556.1|155212_160852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090557.1|161290_161716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090558.1|161725_162343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|162320_163757_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_033679622.1|163896_164463_+	acyltransferase	NA	NA	NA	NA	NA
WP_016090560.1|165173_165500_-	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	36.8	1.3e-10
WP_001105580.1|165645_165864_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090561.1|165990_166401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019438.1|166710_167355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090562.1|167566_169111_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_016090563.1|169597_170524_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_016090564.1|170889_178488_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.3	4.2e-165
WP_001053969.1|179290_180727_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090641.1|180913_181285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000364215.1|181572_181983_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|182131_183562_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016090640.1|183897_184818_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_040120008.1|185680_188629_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.7	1.4e-79
>prophage 3
NZ_CP007616	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence	416210	215613	286113	416210	transposase	Bacillus_phage(31.25%)	57	NA	NA
WP_000275580.1|215613_216909_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_016090632.1|216943_217831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090630.1|218565_218757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090629.1|220031_220793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074628990.1|220903_221326_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016090627.1|221508_222861_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_016090626.1|222899_223217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090625.1|223381_224470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090623.1|225990_228075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187351.1|229029_230283_+	MFS transporter	NA	NA	NA	NA	NA
WP_016090622.1|230393_230975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090621.1|231629_231950_+	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	40.9	1.6e-10
WP_016090620.1|232417_234886_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016090619.1|234882_235596_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.0e-33
WP_016090618.1|235617_236418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090617.1|237119_237812_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016090616.1|237816_239049_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	2.8e-18
WP_016090615.1|240127_240388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090614.1|241032_241737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090613.1|241876_242722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266942.1|242776_244121_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.1	1.8e-111
WP_016097411.1|244963_245398_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_130055941.1|245666_245867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090611.1|246409_246745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958635.1|248526_248820_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090610.1|249212_249413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033679611.1|252189_253299_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	5.8e-92
WP_016090607.1|253295_253427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097410.1|253709_254822_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.9	1.1e-79
WP_000762752.1|254833_255232_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_071686443.1|255422_255602_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_001206759.1|256144_256558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210390.1|257104_257398_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000084567.1|258026_258239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004894.1|258311_258515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090603.1|258566_259163_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_016090602.1|259951_260809_+	glucose uptake protein glcU	NA	NA	NA	NA	NA
WP_016090601.1|260825_261611_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.0e-26
WP_016090600.1|261976_262264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090599.1|262298_264008_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.1	6.0e-19
WP_033679607.1|264172_265561_-	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_000706800.1|266615_266999_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001103609.1|266995_267862_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.6e-20
WP_000906771.1|267851_268499_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_016090598.1|268719_270117_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	43.6	2.2e-88
WP_016090597.1|270892_271636_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016090596.1|271927_272566_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	2.8e-22
WP_016090595.1|272582_272966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090594.1|273262_273898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582601.1|273894_274527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090593.1|276163_277090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090592.1|278098_279715_-	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.3e-43
WP_001236345.1|281065_282295_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000219740.1|282645_282942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087971388.1|283095_283221_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_016090591.1|284008_284683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406502.1|284770_286113_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 1
NZ_CP007614	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB95, complete sequence	94637	28599	91531	94637	transposase	Lactococcus_phage(30.0%)	58	NA	NA
WP_000275580.1|28599_29895_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_001175925.1|31103_31457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003274315.1|31472_31961_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_002134110.1|32254_32518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854242.1|32519_33056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000590519.1|33673_33832_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000027439.1|33831_34932_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.2	3.1e-85
WP_003274307.1|35175_36081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380666.1|36143_36641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000681204.1|36711_38892_-	peptidase	NA	NA	NA	NA	NA
WP_000878056.1|38917_39997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000864768.1|40030_40330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000411023.1|40351_40732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686751.1|40744_41269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823706.1|41361_41877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120011.1|42475_45439_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	5.4e-201
WP_000382147.1|45457_46312_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_001053969.1|46648_48085_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_001077597.1|48644_49031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477383.1|49065_49596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020776.1|50100_50991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000600039.1|51095_52067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109011.1|52079_53525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765660.1|53547_54684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769510.1|54705_55455_-	flagellar protein FlgA	NA	NA	NA	NA	NA
WP_002134102.1|55470_56760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178926.1|57027_58902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000890312.1|58907_59096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542404.1|59107_61261_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	40.0	5.3e-89
WP_003286265.1|61340_61772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000676587.1|62039_64301_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003275077.1|64311_66381_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_000240013.1|66569_66809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000448102.1|66798_67062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134101.1|67153_68386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812484.1|68519_68879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000063563.1|69472_70675_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000085281.1|70682_71084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005319.1|71467_72688_+	hypothetical protein	NA	A0A1B1P784	Bacillus_phage	46.0	2.2e-28
WP_000334981.1|73416_73719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000809080.1|73753_74023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|74379_75609_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000480048.1|76024_76495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495110.1|76999_77224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000572916.1|77240_78278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877615.1|78293_80168_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_001088572.1|80183_81221_+	conjugation transfer protein	NA	A0A0A8WIF2	Clostridium_phage	30.7	7.3e-28
WP_000738668.1|81237_81807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002083864.1|81819_82077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000768556.1|82090_83107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000694786.1|83121_83808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265610.1|83829_85233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000173533.1|85245_85518_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001031864.1|85563_85749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000749015.1|86157_86646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|87840_88593_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|88582_89878_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_013555051.1|90085_91531_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
