The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	934737	942050	4667283	integrase,protease	Dickeya_phage(16.67%)	7	923475:923489	942268:942282
923475:923489	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|934737_935856_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|935852_937799_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|937928_938150_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938473_938794_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934059.1|938824_941101_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_001117984.1|941313_941511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941672_942050_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942268:942282	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	1013682	1024475	4667283	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1013682_1014312_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1014295_1014922_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_038394111.1|1014918_1016628_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_038394112.1|1016627_1017209_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	91.2	9.2e-97
WP_001674638.1|1017685_1018654_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1019301_1019928_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1020287_1020974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1021244_1021436_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1021862_1024475_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	1226338	1275587	4667283	protease,lysis,holin,integrase,tail	Salmonella_phage(28.57%)	47	1226174:1226203	1245794:1245823
1226174:1226203	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1226338_1227418_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1227392_1227671_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1228084_1230064_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1230752_1231001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1231064_1231664_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1231660_1231888_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1232017_1232707_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1232803_1233328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1233701_1234151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1234511_1235198_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1235473_1235803_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1235786_1236239_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1236256_1236736_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1237630_1238164_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1238253_1238949_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000161704.1|1243003_1243726_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|1244204_1245005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077916163.1|1246862_1247357_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	1.4e-21
1245794:1245823	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_001013467.1|1247546_1247777_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1247830_1248364_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1248620_1248788_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|1248852_1249041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348542.1|1249095_1249587_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.6e-41
WP_001687735.1|1251691_1252192_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_012543349.1|1252288_1252489_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|1253058_1253184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|1253684_1253831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|1254318_1254933_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|1254942_1255101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|1255233_1256148_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001576018.1|1259286_1259427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|1259592_1259862_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|1260234_1260654_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|1261026_1261503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|1261832_1262228_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|1262911_1263634_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|1263918_1264083_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|1264306_1264957_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|1264975_1265167_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|1265277_1265514_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|1265631_1267071_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001529852.1|1267148_1269782_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|1269750_1271034_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|1271162_1271660_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|1271757_1272444_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|1272463_1274512_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|1274705_1275587_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	1466426	1480702	4667283	holin,tRNA	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|1466426_1467800_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1467843_1468779_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1469095_1469713_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1469740_1470058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1470142_1470364_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1470801_1471323_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1471430_1471586_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1471970_1472438_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1472710_1473040_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1473201_1473756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1473752_1474685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1475054_1475267_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1475557_1475728_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1475790_1476390_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1476389_1476680_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1476676_1477213_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1479700_1479889_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1479878_1480160_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1480156_1480702_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	2134372	2144879	4667283		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2134372_2135686_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2135712_2136792_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2136796_2137570_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2137585_2138560_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2138565_2139117_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2139117_2139996_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2140043_2140943_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|2140942_2142028_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2142404_2143298_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2143475_2144879_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	2212075	2221246	4667283	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2212075_2214109_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2214349_2214808_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2214979_2215510_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2215566_2216034_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2216080_2216800_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2216796_2218482_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2218704_2219436_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2219495_2219603_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2219583_2220315_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2220298_2221246_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	2457555	2463615	4667283		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2457555_2458497_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2459739_2460129_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2460097_2460352_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2460369_2462292_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2463281_2463425_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|2463363_2463615_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 8
NZ_CP009090	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE8-1021710 chromosome, complete genome	4667283	2692811	2792518	4667283	terminase,head,tRNA,lysis,integrase,transposase,plate,capsid,tail,portal	Salmonella_phage(76.36%)	91	2711185:2711199	2791423:2791437
WP_000083345.1|2692811_2693549_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2693678_2695013_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|2695030_2695930_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2696032_2696620_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2696681_2697065_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2697383_2698073_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2698188_2699226_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|2699429_2699849_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|2699921_2700602_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082648.1|2700655_2703316_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2703430_2704786_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2704830_2705154_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2705150_2706452_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|2706555_2707011_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
2711185:2711199	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|2712791_2715365_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|2715494_2716226_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2716222_2717203_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2717334_2718072_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2718343_2718682_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2718785_2718833_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|2718932_2720093_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2720053_2720962_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2721019_2722141_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2722150_2723221_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2723660_2724179_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2724171_2725392_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2725548_2725896_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469801.1|2725936_2726704_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2726748_2727297_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2727315_2727564_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2727816_2729178_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2729343_2730135_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2730154_2731441_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|2731561_2732167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2732201_2732792_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2732915_2733794_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2733879_2735541_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2735689_2736028_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2736193_2736484_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2736473_2736950_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2737099_2737582_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|2738196_2749671_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|2749735_2751145_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|2751141_2753322_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|2753329_2754493_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2755044_2755263_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2755331_2756432_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2756428_2756914_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|2756910_2759718_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|2759710_2759830_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2759844_2760147_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2760201_2760717_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046107.1|2760726_2761899_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	5.7e-223
WP_000974843.1|2762001_2762226_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2763095_2763671_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2763670_2765524_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2765520_2766126_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_038394120.1|2766118_2766784_-|plate	baseplate J/gp47 family protein	plate	E5G6N8	Salmonella_phage	73.2	1.5e-103
WP_000189373.1|2766770_2767130_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2767126_2767705_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2767782_2768634_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2768635_2769082_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2769074_2769506_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2769601_2770030_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|2770026_2770542_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|2770522_2770738_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2770741_2770945_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2770944_2771409_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2771502_2772153_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730760.1|2772156_2773218_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000216276.1|2773234_2774068_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2774210_2775977_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2775976_2777017_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2777120_2778785_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2779098_2779776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|2779889_2780123_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|2780133_2780322_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2780474_2782889_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2782885_2783743_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2783739_2783967_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2783966_2784200_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2784267_2784609_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2784572_2784773_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2784780_2785290_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2785323_2785566_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2785687_2786320_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2786322_2787339_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2787891_2788554_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|2788815_2789409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2789807_2790611_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2791406_2792518_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2791423:2791437	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
