The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007207	Flavobacterium psychrophilum FPG3 chromosome, complete genome	2715909	667990	679293	2715909		Tupanvirus(22.22%)	9	NA	NA
WP_034101289.1|667990_670438_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.3	2.1e-17
WP_011963429.1|670441_671422_+	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.9	2.7e-85
WP_011963428.1|671432_672704_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	26.4	6.2e-21
WP_011963427.1|672735_674112_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	31.6	4.7e-59
WP_011963426.1|674117_675164_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.5	1.3e-85
WP_038466088.1|675232_676105_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.6	2.7e-100
WP_038466091.1|676119_677145_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	39.9	4.0e-47
WP_038466094.1|677149_678238_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.4	3.5e-25
WP_038466097.1|678237_679293_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	24.6	2.2e-11
>prophage 2
NZ_CP007207	Flavobacterium psychrophilum FPG3 chromosome, complete genome	2715909	1401844	1475007	2715909	tRNA,protease,transposase	Bacillus_phage(18.18%)	50	NA	NA
WP_011963018.1|1401844_1402486_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011963019.1|1402533_1403229_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011963020.1|1403894_1405775_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	2.0e-145
WP_038466399.1|1406232_1408536_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_038466402.1|1408983_1409775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466405.1|1409831_1410353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963024.1|1410515_1412849_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.9	1.2e-123
WP_052079095.1|1412993_1413863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466408.1|1413873_1414503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466411.1|1414503_1415688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466414.1|1415691_1417053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963025.1|1417233_1417854_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	27.2	6.5e-08
WP_011963026.1|1417964_1420025_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_034098105.1|1420105_1421146_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	37.9	1.4e-50
WP_011963028.1|1421238_1422033_-	HNH endonuclease	NA	A0A0S2SY41	Pseudomonas_phage	31.5	7.8e-06
WP_117386928.1|1422072_1423168_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_034098087.1|1423333_1424359_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011963031.1|1424526_1424847_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_034098089.1|1425178_1426867_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.4	4.4e-83
WP_038466418.1|1427030_1427213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963034.1|1427212_1427770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963035.1|1427812_1428205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098091.1|1428332_1432676_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_034098110.1|1432749_1433880_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011963038.1|1434234_1434816_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_034098093.1|1435042_1436971_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011963040.1|1437274_1438702_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011963041.1|1439001_1439820_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_052079096.1|1439866_1441144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098095.1|1441177_1441873_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_034098114.1|1441899_1443228_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011963045.1|1443245_1443974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098098.1|1444297_1446169_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_052079097.1|1446516_1449435_-	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	22.5	1.3e-05
WP_011963048.1|1449965_1450310_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_011963049.1|1450484_1450682_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071948519.1|1450791_1451340_-	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_034098102.1|1451363_1453310_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.3	1.4e-125
WP_038466422.1|1459794_1459986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038466425.1|1461393_1461573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466428.1|1461933_1462650_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038466431.1|1462646_1463897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466434.1|1463961_1464174_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_038466437.1|1465074_1466277_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	5.3e-46
WP_038467163.1|1466584_1467538_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_038467167.1|1467775_1469305_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_034098120.1|1469396_1470599_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_038466443.1|1470899_1471880_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0A8WHZ5	Clostridium_phage	27.8	3.5e-16
WP_038467170.1|1471876_1472725_-	EcoRV family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_038466449.1|1473423_1475007_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP007207	Flavobacterium psychrophilum FPG3 chromosome, complete genome	2715909	1481126	1546800	2715909	integrase,transposase	uncultured_virus(25.0%)	52	1487711:1487770	1527847:1528387
WP_016361990.1|1481126_1482329_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_038466466.1|1482441_1482924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466470.1|1482935_1484120_-	C10 family peptidase	NA	NA	NA	NA	NA
WP_052079098.1|1484507_1485590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106388619.1|1485893_1486808_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_038466475.1|1486750_1487134_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_038466478.1|1487341_1487767_-	hypothetical protein	NA	NA	NA	NA	NA
1487711:1487770	attL	CTTCAACAAAGAATTACACCAATATGAATGTATAAAAGAAGGGTCAAACAAAGCCATCTT	NA	NA	NA	NA
WP_016361990.1|1488366_1489569_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_038467178.1|1489889_1490579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080731695.1|1491191_1493669_-	S8 family serine peptidase	NA	A0A2K9L1P3	Tupanvirus	33.9	2.3e-11
WP_038466486.1|1493665_1494070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466489.1|1496066_1496567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466492.1|1497406_1498624_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.0	1.2e-13
WP_038466495.1|1498894_1499782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098978.1|1499926_1500208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162179067.1|1500794_1501628_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_038466501.1|1503918_1506021_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	25.2	4.6e-29
WP_074460308.1|1506017_1507289_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_038466504.1|1507312_1512175_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_038466509.1|1512181_1515475_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.1	2.6e-55
WP_038466512.1|1515565_1516021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038466515.1|1516027_1516210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038466518.1|1516199_1518629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158409052.1|1518817_1518979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086440623.1|1519045_1519219_-	hypothetical protein	NA	A0A2H4J2N9	uncultured_Caudovirales_phage	64.3	3.0e-11
WP_038466521.1|1519399_1519747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466524.1|1519743_1520544_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_123960885.1|1520990_1521212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466526.1|1522297_1522540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466529.1|1522529_1522793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361983.1|1522926_1523238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106407974.1|1523246_1524134_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.9	6.0e-15
WP_038466532.1|1525159_1525834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466535.1|1528521_1529175_-	HAD family hydrolase	NA	NA	NA	NA	NA
1527847:1528387	attR	CTTCAACAAAGAATTACACCAATATGAATGTATAAAAGAAGGGTCAAACAAAGCCATCTTACTATTTAAAGGCGAGAAAACCGACAGCAAAGGATACATCAAGCGAACGTATCGAAGCAGTGAGAGCTTTTGTAAAAACTGTCCATTAAGAGAACAATGCTGCGGAAAAACAACCAAATACAAAAAGATAGACGACAGCATTCATAAAGAACACTACGACAGAATGCACAAAAAGCTCACACAAAACCCAGAGTATGCCAAGAAAATGGTACGAGTAAGAAGCAAAACCGTAGAACCGGTAATAGGAACATTGGTAAACTTTACCAATATGAAAAGAGTAAACACACGAGGAATAAGAAATGCCAACAAACACGTACTAATGGCATCATTAACCTACAACCTCAAGAAATACTTACGCTTTGTTGTGAAAAAACCAAGTATTTTGACTCAAGTGCTATCCCAAAAAGTAGGGAAGAACCAAGCTTTTTTAAAAACGATCCTTTTTAACTTGAAACGTATGTTTTTAAGGCATCAAAATTTT	NA	NA	NA	NA
WP_038466538.1|1529351_1529732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466541.1|1530280_1532068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466544.1|1532256_1532745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466547.1|1532748_1533930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466550.1|1534167_1534677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466553.1|1534669_1535113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466556.1|1535209_1536169_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_038466559.1|1536165_1536711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466565.1|1537055_1538225_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_038466568.1|1538396_1539005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466571.1|1540239_1540647_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_123960888.1|1540649_1541147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466577.1|1541194_1542265_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_038466580.1|1542419_1542617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466583.1|1542792_1543047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466586.1|1543049_1543511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466589.1|1543685_1545086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162179067.1|1545966_1546800_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007207	Flavobacterium psychrophilum FPG3 chromosome, complete genome	2715909	2149329	2223932	2715909	tRNA,integrase,protease,transposase	Staphylococcus_phage(15.38%)	50	2148044:2148060	2213118:2213134
2148044:2148060	attL	TATAAAGCCAAAAACAA	NA	NA	NA	NA
WP_034098375.1|2149329_2150634_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.1	1.5e-17
WP_034098373.1|2150775_2152062_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	34.8	4.6e-32
WP_034098402.1|2152247_2153144_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_011963735.1|2153209_2153851_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_034098400.1|2153851_2154421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034098371.1|2154426_2155605_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011963732.1|2155604_2156693_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_034098369.1|2156774_2157770_-|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	33.5	1.0e-15
WP_034098367.1|2158071_2158710_-	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_011963729.1|2158743_2159448_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_034098365.1|2159449_2160472_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.6	8.9e-71
WP_052079116.1|2160602_2165129_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_011963726.1|2165200_2166187_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_034098363.1|2166247_2167249_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011963723.1|2168465_2169077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098360.1|2169491_2171027_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011963721.1|2171324_2172212_-	EamA family transporter	NA	NA	NA	NA	NA
WP_034098358.1|2172520_2174293_-	MFS transporter	NA	NA	NA	NA	NA
WP_034098356.1|2174409_2175339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963718.1|2175832_2177230_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_011963717.1|2177525_2177693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034098352.1|2178254_2180726_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_034098350.1|2180883_2181225_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	33.6	3.6e-08
WP_034098395.1|2181304_2182258_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011963713.1|2182250_2183300_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011963712.1|2183324_2184320_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_034098348.1|2184568_2184985_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	43.8	1.5e-21
WP_034098346.1|2184986_2185601_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011963708.1|2185729_2186203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963707.1|2186266_2186590_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034098344.1|2186982_2187480_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_011963705.1|2187482_2187863_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_034098341.1|2188055_2190518_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.6	6.3e-70
WP_011963703.1|2190522_2191164_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_034098337.1|2191169_2192624_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_011963701.1|2192610_2193747_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.4	5.3e-64
WP_038466889.1|2194231_2195479_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.1	1.3e-36
WP_038466892.1|2195855_2197310_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_052079117.1|2197321_2198134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038466895.1|2198140_2199649_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052079118.1|2199645_2201334_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_038466898.1|2201335_2202118_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_080731703.1|2202114_2202957_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_038466907.1|2204202_2207136_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_052079120.1|2207154_2208558_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_038466910.1|2208622_2209390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038466914.1|2209506_2210709_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	5.3e-46
WP_038466917.1|2213264_2214467_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.6e-45
2213118:2213134	attR	TATAAAGCCAAAAACAA	NA	NA	NA	NA
WP_034098285.1|2215840_2216530_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	9.1e-27
WP_166504501.1|2222981_2223932_-|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.3	2.9e-07
